- Email: [email protected]
Somatic mutations of the translocated bcl-2 gene are associated with morphologic transformation of follicular lymphoma to diffuse large-cell lymphoma
Annals of Oncology 8 (Suppl. 2): S119-S122, 1997. © 1997 Kluwer Academic Publishers. Printed in the Netherlands.
Original article Somatic mutations of the translocated bcl-2 gene are associated with morphologic transformation of follicular lymphoma to diffuse large-cell lymphoma A. Matolcsy,1 R. A. Warnke,2 & D. M. Knowles3 ^Department of Pathology, University Medical School of Pecs, Pecs, Hungary; 2 Department of Pathology, Stanford University Medical Center, Stanford, CA, USA; 3Department of Pathology, The New York Hospital- Cornell Medical Center, New York, NY, USA
Summary
Introduction
Morphologic transformation of low-grade B-cell follicular lymphoma (FL) to diffuse aggressive intermediate- or high-grade non-Hodgkin's lymphoma (NHL) occurs in about 25% to 30% of patients during their clinical course [1]. This morphologic transformation is usually associated with acceleration of the clinical course and shortened survival. Approximately 90% of FLs are associated with the t(14;18) translocation that places the bcl-2 oncogene into juxtaposition with the joining (J H ) segment of the immunoglobulin (Ig) heavy-chain (H) gene. In most cases, the breakpoints on chromosome 18 are clustered either in the 3' end of the last bcl-2 exon or within the 3'-untranslated region of the gene, leaving the open reading frame (ORF) intact [2, 3]. The t(14;18) translocation deregulates expression of the bcl-2 gene product, which contributes to prolonged cell survival by blocking programmed cell death (apoptosis) [4]. In general, FL cells undergoing transformation to a higher grade NHL retain their t(14;18) translocation and acquire secondary genetic abnormalities, including nonrandom chromosomal changes, c-myc
Key words: bcl-2 oncogene, diffuse large-cell lymphoma, follicular lymphoma, lymphoma transformation, somatic mutation
gene rearrangement, or p53 tumor-suppressor gene mutations, suggesting that heterogeneous genetic lesions and different molecular mechanisms underlie this neoplastic evolution [5-7]. To analyze whether secondary alterations of the translocated bcl-2 gene are associated with the morphologic transformation of FL, we analyzed the nucleotide sequence of the breakpoint and ORF regions of the bcl-2 oncogene in six cases of FL that underwent morphologic transformation to diffuse large-cell lymphoma (DLL).
Materials and methods Tumor biopsies and criteria for morphologic transformation Six histologically transformed FLs occurring in patients observed at Stanford University Medical Center were selected for this study. The matched pre-transformed FL was also available in all six cases. The histology of the six pre-transformed tumor samples were follicular center-cell lymphoma (FL), provisional cytologic grade I; the transformed high-grade NHLs were classified as DLL (Table 1).
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
Background: Ninety percent of low-grade follicular lymphomas (FLs) carry the t(14;18) translocation. This event juxtaposes the bcl-2 oncogene to the immunoglobulin (Ig) heavy-chain gene and leads to bcl-2 gene overexpression. Morphologic transformation of FL to high-grade lymphoma is associated with multiple secondary chromosomal abnormalities of the neoplastic cells. Design: To analyze whether additional structural alterations of the translocated bcl-2 gene are associated with morphologic transformation of FL, we PCR-amplified, cloned, and sequenced the major breakpoint region (MBR) and the open reading frames (ORF) of the translocated bcl-2 oncogene in six paired samples of FL and subsequent diffuse large-cell lymphoma (DLL). Results: In five cases, FL and DLL cells were clonally related,
as suggested by the identical MBR sequences, but in one case they were different. PCR single-strand conformation polymorphism (SSCP) and sequence analyses were performed for identification of structural alterations of the bcl-2 gene in the OFR region corresponding to the 239 amino acid p26-bcl-2a protein. In three of the six patients, a total of 11 point mutations of the ORF were detected in the DLL cells. Four of them, at positions 29,46, 59, and 106, yielded amino acid replacements. Conclusions: These findings demonstrate that FL and DLL cells may be clonally related or unrelated. They also show that transformation of FL cells can be associated with somatic point mutations of the bcl-2 oncogene ORF sequence resulting in alteration of the p26-Z>c/-2a gene product.
120 Table 1. Summary of bcl-2 gene breakpoint and ORF sequence analysis in six cases of FL and supervening DLL. Patients
Sample
Date of biopsy
Histology
Bcl-2 breakpoint sequences mbr (position)
08-31-83 03-27-85
FL-I DLL
+(147) +(147)
A B
03-26-87 04-20-90
FL-I DLL
+(62) +(121)
3
A B
08-09-84 10-09-86
FL-I DLL
4
A B
10-05-89 08-17-90
5
A B
6
A B
2
D
JH
(position)
21 A/G Number polyof mutamortions phism
Type of mutations (position)
Missense mutation (position)
JH6b(25) JH6b(25)
A/G A/G
:
:
J H 4b(6) JH4b(10)
A A
2
C>T(-11); G > A(66)
+(118) +(118)
JH6c(32) JH6c(32)
A/G A/G
-
-
-
FL-I DLL
+(167) +(167)
JH6b(23) JH6b(23)
G G
4
G > A(24, 66, 85); C > T(137)
E > K(29); P > L(46)
05-12-86 03-17-87
FL-I DLL
+(61) +(61)
J H 6c(ll) J H 6c(U)
A/G A/G
-
-
-
05-07-87 12-29-88
FL-I DLL
+(60) +(60)
JH6c(25) JH6c(25)
A/G A/G
5(G)*
C > T(33, 175, 176); P > L(59); R > H(106) G > A(317,354)
-
D21-9
-
:
Abbreviations: DLL - diffuse large B-cell lymphoma; FL-I - follicular lymphoma, grade I, predominantly small cleaved; mbr (position) - major breakpoint region (bp distance of the breakpoint from the mbr primer); mcr - minor cluster region; D - Ig heavy-chain diversity region gene; JH (position) - Ig heavy-chain joining region gene (bp distance of the breakpoint from the J H primer); ORF - open reading frame; * - mutation detected in only G polymorphic sequences.
Polymerase chain reaction (PCR) and sequence analysis of t( 14; 18) breakpoints. PCR and sequence analysis of genomic DNAs was used to characterize the t(14;18) translocation in six paired samples of FL and DLL. Major breakpoint region (mbr) or minor cluster region (mcr) specific bcl-2 sense primers in conjunction with an J H antisense primer were used in PCR, as previously described [8], The PCR products were cloned and sequenced.
PCR single-strand conformation polymorphism (SSCP) and sequence analysis oibcl-2 proto-oncogene ORF PCRs were performed to amplify DNA segments of the bcl-2 ORF corresponding to the p26-6c/-2a protein. Three pairs of amplification primers were designed and used in separate reactions to achieve the PCR amplification of the first 717 bp corresponding to amino acids 1 to 239 of the ORF. The pairs of sense and antisense primers were (-40) AGAGGTGCCGTTGGCCCCCGTTGC / (221) GTCTGCAGCGGCGAGGTCCT; (202) AGGACCTCGCCGCTGCAGAC / (478) TGACGCTCTCCACACACATGAC AND (448)TTGAGTTCGGTGGGGTCATG / (741) TTTGGGGCAGGCATGTTGAC. PCR reactions were performed with 100 ng of DNA, 10 pmol of each primer, 2.5 nmol dNTPs, 1 uCi of [a-32P]dCTP (NEN; specific activity, 3000 Ci/mmol), 10 mmol Tris (pH 8.8), 50 mmol KC1, 1.5 mmol MgCl2, 0.5 U of Ampli Taq DNA polymerase (Boehringer Mannheim Corp, Indianapolis, IN) in a final volume of 10 uL. Amplifications were performed for 30 cycles (denaturing: 95 °C for 1 min; annealing: 58 °C for 2 min; extension: 72 °C for 2 min). The SSCP analysis of the PCR products was performed as described previously [7],
Results Molecular characterization oft(14;18) chromosomal translocations A fusion was demonstrated between the bcl-2 gene and members of the Ig J H exons in all six FL and DLL samples, confirming the presence of t(14;18) translocations in these tumors (Figure 1, Table 1). In five patients (cases 1 and 3-6), the FL and DLL cells showed identical bcl-2 and J H breakpoints and intervening junctional sequences, suggesting a common clonal origin for the two tumor cell populations. In the FL cells from one patient (case 2), the bcl-2 breakpoint was 62 bp and the J H breakpoint was 6 bp distant from the annealing site of the sense and antisense primers, respectively. The junctional sequence of the hybrid gene was found to contain a D21-9 gene. In the DLL cells from the same patient, the bcl-2 breakpoint was 121 bp and the J H breakpoint was 10 bp distant from the annealing site of the sense or antisense primers, respectively. The junctional sequence of the hybrid gene was 8 bp long and showed no homology to the junctional sequence of the FL cells. The fact that the bcl-2/igH gene hybrid of the DLL cells in patient 2 incorporated longer bcl-2 and J H fragments than the preexisting FL cells suggests that the DLL cells developed through an additional independent t(14;18) translocation rather than by deletion of diversity (D) genes from the bcl-2/lgH gene hybrid of the FL cells.
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
A B
1
mcr (position)
Bcl-2 OFR sequences (-40-741)
121
[Ai GAAAGCAGGAAACCTGTGGT (147)(B) GAAAGCAGGAAACCTGTGGT 1147)*
TCAGTATTTGTTCC TCAGTATTTGTTCC
IA) CCCTCCTGCCCTCCTTCCGC 162)(B) ATGCAGTGGTGCTTACGCTC (121)-
TCTTCTACTTAGGTGGCACCGAGGGA -GTATTACTATGATAG (D21-9)- ATA TCGTGCT
{AI GAAATGCAGTGGTGCTTACG (119) • IBI GAAATGCAGTGGTGCTTACG d i a l *
GTTTCGGGGTTTTG GTTTCGGGGTTTTG
(2 5) i CTACGGTATGGACGTCTGGGGCCAAGGGGCCACG U H 6 b ) (25) » CTACGGTATGGACGTCTGGGGCCAAGGGGCCACG (JH6bl (611 GGCCAGGGAACCCTG (JH4b) [10)1 CTGGGGCCAGGGAACCCTG
(A) AVGAAGCCAGACCTCCCCGG (1671* (E) ATGAAGCCAGACCTCCCCGG (167)-
(23)1 ACGGTATGGACGTCTGGGGCCAAGGGACCACG IJH6b) (2 3) # ACGGTATGGACGTCTGGGGCCAAGGGACCACG (J6b)
(A) GCCCTCCTGCCCTCCTTCCG 161)(B) GCCCTCCTGCCCTCCTTCCG (61)-
TTTTGTGCATAAGCCCCCAA TTTTGTGCATAAGCCCCCAA
(A) AGCCCTCCTGCCCTCCTTCC (60!(B) AGCCCTCCTGCCCTCCTTCC (601-
TTTTCGGGGATTCTA TTTTCGGGGATTCTA
111)* TCTGGGGCAAAGGGACCACG (JH6c) 111) # TCTGGGGCAAAGGGACCACG (JH6=I E 2 5) I CTACTACATGGACGTCTGGGGCAAAGGGACCACG(JK«<=> (2 5) • CTACTACATGGACGTCTGGGGCAAAGGGACCACG (Ju6c)
Figure 1. Bcl-2/JH junction sequences indentified in six FLs and subsequent DLLs by PCR-sequence analysis. DNA sequences flanking bcl-2 and J H breakpoints and the intervening D- and N-regions of FL and respective DLL cells are clustered in each case. The distance of bcl-2 (mbr) breakpoints from the sense primers and the distance of J H breakpoints from the antisense primers are shown in parentheses, respectively.
Frequency, type, and position of mutations in the bcl-2 ORF
Case 1 N N (G) (AA3) a b
Case 2
Cas»3
a
a
b
Case 4
Cases
Case 6
B Casei
Caw 2
C—3
C—4
CntS
Cases
Case 1
Case 2
Case 3
Case 4
Case 5
Case 6
Discussion The present report confirms previous studies showing that FL and transformed DLL may carry identical t(14;18) translocations and junctional bcl-2/JH gene sequences suggesting a common clonal origin for the two neoplasms, and it extends them by providing evidence that FL and DLL cells in the same patient can display different t(14;18) chromosome translocations and junctional bcl-2/JH gene sequences, thereby suggesting discrete clonal B-cell origins. Somatic mutation of the ORF of the translocated bcl-2 gene has been demonstrated in SU-DHL-6 lymphoma cell lines carrying the t(14;18) translocation [10], and in FL cells of different histological types [11], but the biological significance of these mutations is highly debated. The correlation of somatic mutations with transformed DLLs suggested in our recent study may be associated with the activated proliferating phenotype of high-grade NHL cells. Gene transfer studies in lymphokine-dependent hematopoietic cells indicate interactions of the bcl-2 protein with itself and other members of the bcl-2 family members, including bax, bcl-x-l and bcl-x-s. Bax is envisioned
Figure 2. PCR-SSCP analysis of bcl-2 gene corresponding to amino acid 1 to 239 of the ORF in six cases of FL (a) and subsequent DLL (b) samples. (A) PCR-SSCP analysis generated by the primers that span the region from -40 bp to 221 bp of the ORF. A/G hereditary polymorphism of the bcl-2 gene located at 21 bp into the ORF has been documented [9]. Lanes labeled N(A), N(G), and N(A/G) represent the migration pattern of wild type A, G, and A/G hereditary polymorphic forms located at 21 bp position, respectively. (B) PCR-SSCP analysis generated by the primers that span the region from 202 bp to 487 bp of the ORF. (C) PCR-SSCP analysis generated by the primers that span the region from 448 bp to 741 bp of the ORF. Arrows identify the abnormally migrating bands.
as a cell-death (apoptosis) effector whose activity is neutralized by binding of bcl-2 [12]. The binding of bcl-x-s to bcl-2 was hypothesized to prevent bcl-2 from interacting with bax, thus leaving bax unopposed in its cell-death effector function [12]. Use of site-specific mutagenesis [13] and deletion mutants [12] of bcl-2 suggests that bcl-2 homodimerization and heterodimerization with other
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
Figure 2 shows the results of PCR-SSCP analysis generated by the primers that span the region -40 to 741 bp of the ORF. PCR products from DLL samples of patients 2, 4, and 6 showed altered electrophoretic mobility compared to their respective FL cell counterparts. Sequence analysis of the bcl-2 ORF in six FLs confirmed the results of SSCP analysis. None of the six FL samples showed nucleic acid changes compared to germline bcl-2 gene sequences. A total of 11 point mutations detected in the three DLLs (cases 2, 4, and 6) showed altered electrophoretic mobility by SSCP analysis, but these mutations were absent in the preexisting FLs (Table 1). All 11 somatic mutations were transitions (A > C or G > T) and four of them predicted amino acid substitutions within the p26-6c/-2a protein at codons 29 (E > K), 46 and 59 (P > L), and 106 (R > H).
N (A)
122 bcl-2 family members involves interaction between distinct regions within the bcl-2 protein. In our studies, we have shown that somatic mutation in DLL cells resulted in replacements of the amino acid at positions 29, 46, 59, and 106 of the bcl-2 protein. These structural alterations may affect interaction of bcl-2 with other bcl-2 family members and/or other oncogenes and tumor-suppressor genes. Since the precise amino acid residues of the bcl-2 protein involved in homo- or hetrodimerization have not been determined, the mechanism(s) by which structurally altered bcl-2 protein changes to biological behavior of FL cells is highly speculative. The demonstration of altered amino acid residues of the bcl-2 protein in morphologically transformed of FL cells showed in the present studies provides a reasonable starting point for the further investigation of the molecular basis and pathways of lymphoma transformation.
This study was partially supported by NIH grants EY-06337 to D. M. Knowles and CA-33119 and CA34233 to R. A.Warnke. References Garvin AJ, Simon RM, Osborne CK et al. An autopsy study of histologic progresssion in non-Hodgkin's lymphomas: 192 cases from the National Cancer Institute. Cancer 1983; 52: 393-405. Cleary ML, Sklar J. Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint cluster region near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci USA 1985; 82: 7439-43. Cleary ML, Galili N, Sklar J. Detection of a second t(14;18) break-
Correspondence to: Daniel M. Knowles, MD Department of Pathology The New York Hospital - Cornell Medical Cancer 525 East 68th Street New York, NY 10021 USA
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
Ackowledgements
point cluster region in human follicular lymphomas. J Exp Med 1986; 164: 315-20. Korsmeyer S J. Bcl-2 initiates a new category of oncogenes: Regulations of cell death. Blood 1992; 80: 879-86. Richardson ME, Quanguang C, Filippa DA et al. Intermediate- to high-grade histology of lymphomas carrying t(14; 18) is associated with additional nonrandom chromosome changes. Blood 1987; 70: 444-7. Yano T, Jaffe ES, Longo DL et al. MYC rearrangements in histologically progressed follicular lymphomas. Blood 1992; 80: 758-67. Lo Coco F, Gaidano G, Louie DC et al. P53 mutations are associated with histologic transformation of follicular lymphoma. Blood 1993; 82: 2289-95. Crescenzi M, Seto M, Herzig GP et al. Thermostable DNA polymerase chain amplification of t(14;18) chromosome breakpoints and detection of minimal residual disease. Proc Natl Acad Sci USA 1988; 85: 4869-73. Tanaka S, Kant J, Reed JC. G to A polymorphism in the second exon of the6c/-2 gene. Nucleic Acid Res 1991; 19:1964-9. 10. Seto M, Jaeger U, Hockett RD et al. Alternative promoters and exons, somatic mutation, and transcriptional deregulation of the bcl-2-Ig fusion gene in lymphoma. EMBO J 1988; 7:123-9. Tanaka S, Louie DC, Kant JA et al. Frequent incidence of somatic mutations in translocated bcl-2 oncogenes of non-Hodgkin's lymphomas. Blood 1992; 79: 229-37. 12. Sato T, Hanada M, Bodrug S et al. Interactions among members of the bcl-2 protein family analyzed with a yeast two-hybrid system. Proc Natl Acad Sci USA 1994; 91: 9238^2. 13. Yin X, Oltvai ZN, Korsmeyer SJ. HB1 and HB2 domains of bcl-2 are required for inhibition of apoptosis and heterodimerization with box. Nature 1994; 369: 321-3.
Original article Somatic mutations of the translocated bcl-2 gene are associated with morphologic transformation of follicular lymphoma to diffuse large-cell lymphoma A. Matolcsy,1 R. A. Warnke,2 & D. M. Knowles3 ^Department of Pathology, University Medical School of Pecs, Pecs, Hungary; 2 Department of Pathology, Stanford University Medical Center, Stanford, CA, USA; 3Department of Pathology, The New York Hospital- Cornell Medical Center, New York, NY, USA
Summary
Introduction
Morphologic transformation of low-grade B-cell follicular lymphoma (FL) to diffuse aggressive intermediate- or high-grade non-Hodgkin's lymphoma (NHL) occurs in about 25% to 30% of patients during their clinical course [1]. This morphologic transformation is usually associated with acceleration of the clinical course and shortened survival. Approximately 90% of FLs are associated with the t(14;18) translocation that places the bcl-2 oncogene into juxtaposition with the joining (J H ) segment of the immunoglobulin (Ig) heavy-chain (H) gene. In most cases, the breakpoints on chromosome 18 are clustered either in the 3' end of the last bcl-2 exon or within the 3'-untranslated region of the gene, leaving the open reading frame (ORF) intact [2, 3]. The t(14;18) translocation deregulates expression of the bcl-2 gene product, which contributes to prolonged cell survival by blocking programmed cell death (apoptosis) [4]. In general, FL cells undergoing transformation to a higher grade NHL retain their t(14;18) translocation and acquire secondary genetic abnormalities, including nonrandom chromosomal changes, c-myc
Key words: bcl-2 oncogene, diffuse large-cell lymphoma, follicular lymphoma, lymphoma transformation, somatic mutation
gene rearrangement, or p53 tumor-suppressor gene mutations, suggesting that heterogeneous genetic lesions and different molecular mechanisms underlie this neoplastic evolution [5-7]. To analyze whether secondary alterations of the translocated bcl-2 gene are associated with the morphologic transformation of FL, we analyzed the nucleotide sequence of the breakpoint and ORF regions of the bcl-2 oncogene in six cases of FL that underwent morphologic transformation to diffuse large-cell lymphoma (DLL).
Materials and methods Tumor biopsies and criteria for morphologic transformation Six histologically transformed FLs occurring in patients observed at Stanford University Medical Center were selected for this study. The matched pre-transformed FL was also available in all six cases. The histology of the six pre-transformed tumor samples were follicular center-cell lymphoma (FL), provisional cytologic grade I; the transformed high-grade NHLs were classified as DLL (Table 1).
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
Background: Ninety percent of low-grade follicular lymphomas (FLs) carry the t(14;18) translocation. This event juxtaposes the bcl-2 oncogene to the immunoglobulin (Ig) heavy-chain gene and leads to bcl-2 gene overexpression. Morphologic transformation of FL to high-grade lymphoma is associated with multiple secondary chromosomal abnormalities of the neoplastic cells. Design: To analyze whether additional structural alterations of the translocated bcl-2 gene are associated with morphologic transformation of FL, we PCR-amplified, cloned, and sequenced the major breakpoint region (MBR) and the open reading frames (ORF) of the translocated bcl-2 oncogene in six paired samples of FL and subsequent diffuse large-cell lymphoma (DLL). Results: In five cases, FL and DLL cells were clonally related,
as suggested by the identical MBR sequences, but in one case they were different. PCR single-strand conformation polymorphism (SSCP) and sequence analyses were performed for identification of structural alterations of the bcl-2 gene in the OFR region corresponding to the 239 amino acid p26-bcl-2a protein. In three of the six patients, a total of 11 point mutations of the ORF were detected in the DLL cells. Four of them, at positions 29,46, 59, and 106, yielded amino acid replacements. Conclusions: These findings demonstrate that FL and DLL cells may be clonally related or unrelated. They also show that transformation of FL cells can be associated with somatic point mutations of the bcl-2 oncogene ORF sequence resulting in alteration of the p26-Z>c/-2a gene product.
120 Table 1. Summary of bcl-2 gene breakpoint and ORF sequence analysis in six cases of FL and supervening DLL. Patients
Sample
Date of biopsy
Histology
Bcl-2 breakpoint sequences mbr (position)
08-31-83 03-27-85
FL-I DLL
+(147) +(147)
A B
03-26-87 04-20-90
FL-I DLL
+(62) +(121)
3
A B
08-09-84 10-09-86
FL-I DLL
4
A B
10-05-89 08-17-90
5
A B
6
A B
2
D
JH
(position)
21 A/G Number polyof mutamortions phism
Type of mutations (position)
Missense mutation (position)
JH6b(25) JH6b(25)
A/G A/G
:
:
J H 4b(6) JH4b(10)
A A
2
C>T(-11); G > A(66)
+(118) +(118)
JH6c(32) JH6c(32)
A/G A/G
-
-
-
FL-I DLL
+(167) +(167)
JH6b(23) JH6b(23)
G G
4
G > A(24, 66, 85); C > T(137)
E > K(29); P > L(46)
05-12-86 03-17-87
FL-I DLL
+(61) +(61)
J H 6c(ll) J H 6c(U)
A/G A/G
-
-
-
05-07-87 12-29-88
FL-I DLL
+(60) +(60)
JH6c(25) JH6c(25)
A/G A/G
5(G)*
C > T(33, 175, 176); P > L(59); R > H(106) G > A(317,354)
-
D21-9
-
:
Abbreviations: DLL - diffuse large B-cell lymphoma; FL-I - follicular lymphoma, grade I, predominantly small cleaved; mbr (position) - major breakpoint region (bp distance of the breakpoint from the mbr primer); mcr - minor cluster region; D - Ig heavy-chain diversity region gene; JH (position) - Ig heavy-chain joining region gene (bp distance of the breakpoint from the J H primer); ORF - open reading frame; * - mutation detected in only G polymorphic sequences.
Polymerase chain reaction (PCR) and sequence analysis of t( 14; 18) breakpoints. PCR and sequence analysis of genomic DNAs was used to characterize the t(14;18) translocation in six paired samples of FL and DLL. Major breakpoint region (mbr) or minor cluster region (mcr) specific bcl-2 sense primers in conjunction with an J H antisense primer were used in PCR, as previously described [8], The PCR products were cloned and sequenced.
PCR single-strand conformation polymorphism (SSCP) and sequence analysis oibcl-2 proto-oncogene ORF PCRs were performed to amplify DNA segments of the bcl-2 ORF corresponding to the p26-6c/-2a protein. Three pairs of amplification primers were designed and used in separate reactions to achieve the PCR amplification of the first 717 bp corresponding to amino acids 1 to 239 of the ORF. The pairs of sense and antisense primers were (-40) AGAGGTGCCGTTGGCCCCCGTTGC / (221) GTCTGCAGCGGCGAGGTCCT; (202) AGGACCTCGCCGCTGCAGAC / (478) TGACGCTCTCCACACACATGAC AND (448)TTGAGTTCGGTGGGGTCATG / (741) TTTGGGGCAGGCATGTTGAC. PCR reactions were performed with 100 ng of DNA, 10 pmol of each primer, 2.5 nmol dNTPs, 1 uCi of [a-32P]dCTP (NEN; specific activity, 3000 Ci/mmol), 10 mmol Tris (pH 8.8), 50 mmol KC1, 1.5 mmol MgCl2, 0.5 U of Ampli Taq DNA polymerase (Boehringer Mannheim Corp, Indianapolis, IN) in a final volume of 10 uL. Amplifications were performed for 30 cycles (denaturing: 95 °C for 1 min; annealing: 58 °C for 2 min; extension: 72 °C for 2 min). The SSCP analysis of the PCR products was performed as described previously [7],
Results Molecular characterization oft(14;18) chromosomal translocations A fusion was demonstrated between the bcl-2 gene and members of the Ig J H exons in all six FL and DLL samples, confirming the presence of t(14;18) translocations in these tumors (Figure 1, Table 1). In five patients (cases 1 and 3-6), the FL and DLL cells showed identical bcl-2 and J H breakpoints and intervening junctional sequences, suggesting a common clonal origin for the two tumor cell populations. In the FL cells from one patient (case 2), the bcl-2 breakpoint was 62 bp and the J H breakpoint was 6 bp distant from the annealing site of the sense and antisense primers, respectively. The junctional sequence of the hybrid gene was found to contain a D21-9 gene. In the DLL cells from the same patient, the bcl-2 breakpoint was 121 bp and the J H breakpoint was 10 bp distant from the annealing site of the sense or antisense primers, respectively. The junctional sequence of the hybrid gene was 8 bp long and showed no homology to the junctional sequence of the FL cells. The fact that the bcl-2/igH gene hybrid of the DLL cells in patient 2 incorporated longer bcl-2 and J H fragments than the preexisting FL cells suggests that the DLL cells developed through an additional independent t(14;18) translocation rather than by deletion of diversity (D) genes from the bcl-2/lgH gene hybrid of the FL cells.
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
A B
1
mcr (position)
Bcl-2 OFR sequences (-40-741)
121
[Ai GAAAGCAGGAAACCTGTGGT (147)(B) GAAAGCAGGAAACCTGTGGT 1147)*
TCAGTATTTGTTCC TCAGTATTTGTTCC
IA) CCCTCCTGCCCTCCTTCCGC 162)(B) ATGCAGTGGTGCTTACGCTC (121)-
TCTTCTACTTAGGTGGCACCGAGGGA -GTATTACTATGATAG (D21-9)- ATA TCGTGCT
{AI GAAATGCAGTGGTGCTTACG (119) • IBI GAAATGCAGTGGTGCTTACG d i a l *
GTTTCGGGGTTTTG GTTTCGGGGTTTTG
(2 5) i CTACGGTATGGACGTCTGGGGCCAAGGGGCCACG U H 6 b ) (25) » CTACGGTATGGACGTCTGGGGCCAAGGGGCCACG (JH6bl (611 GGCCAGGGAACCCTG (JH4b) [10)1 CTGGGGCCAGGGAACCCTG
(A) AVGAAGCCAGACCTCCCCGG (1671* (E) ATGAAGCCAGACCTCCCCGG (167)-
(23)1 ACGGTATGGACGTCTGGGGCCAAGGGACCACG IJH6b) (2 3) # ACGGTATGGACGTCTGGGGCCAAGGGACCACG (J6b)
(A) GCCCTCCTGCCCTCCTTCCG 161)(B) GCCCTCCTGCCCTCCTTCCG (61)-
TTTTGTGCATAAGCCCCCAA TTTTGTGCATAAGCCCCCAA
(A) AGCCCTCCTGCCCTCCTTCC (60!(B) AGCCCTCCTGCCCTCCTTCC (601-
TTTTCGGGGATTCTA TTTTCGGGGATTCTA
111)* TCTGGGGCAAAGGGACCACG (JH6c) 111) # TCTGGGGCAAAGGGACCACG (JH6=I E 2 5) I CTACTACATGGACGTCTGGGGCAAAGGGACCACG(JK«<=> (2 5) • CTACTACATGGACGTCTGGGGCAAAGGGACCACG (Ju6c)
Figure 1. Bcl-2/JH junction sequences indentified in six FLs and subsequent DLLs by PCR-sequence analysis. DNA sequences flanking bcl-2 and J H breakpoints and the intervening D- and N-regions of FL and respective DLL cells are clustered in each case. The distance of bcl-2 (mbr) breakpoints from the sense primers and the distance of J H breakpoints from the antisense primers are shown in parentheses, respectively.
Frequency, type, and position of mutations in the bcl-2 ORF
Case 1 N N (G) (AA3) a b
Case 2
Cas»3
a
a
b
Case 4
Cases
Case 6
B Casei
Caw 2
C—3
C—4
CntS
Cases
Case 1
Case 2
Case 3
Case 4
Case 5
Case 6
Discussion The present report confirms previous studies showing that FL and transformed DLL may carry identical t(14;18) translocations and junctional bcl-2/JH gene sequences suggesting a common clonal origin for the two neoplasms, and it extends them by providing evidence that FL and DLL cells in the same patient can display different t(14;18) chromosome translocations and junctional bcl-2/JH gene sequences, thereby suggesting discrete clonal B-cell origins. Somatic mutation of the ORF of the translocated bcl-2 gene has been demonstrated in SU-DHL-6 lymphoma cell lines carrying the t(14;18) translocation [10], and in FL cells of different histological types [11], but the biological significance of these mutations is highly debated. The correlation of somatic mutations with transformed DLLs suggested in our recent study may be associated with the activated proliferating phenotype of high-grade NHL cells. Gene transfer studies in lymphokine-dependent hematopoietic cells indicate interactions of the bcl-2 protein with itself and other members of the bcl-2 family members, including bax, bcl-x-l and bcl-x-s. Bax is envisioned
Figure 2. PCR-SSCP analysis of bcl-2 gene corresponding to amino acid 1 to 239 of the ORF in six cases of FL (a) and subsequent DLL (b) samples. (A) PCR-SSCP analysis generated by the primers that span the region from -40 bp to 221 bp of the ORF. A/G hereditary polymorphism of the bcl-2 gene located at 21 bp into the ORF has been documented [9]. Lanes labeled N(A), N(G), and N(A/G) represent the migration pattern of wild type A, G, and A/G hereditary polymorphic forms located at 21 bp position, respectively. (B) PCR-SSCP analysis generated by the primers that span the region from 202 bp to 487 bp of the ORF. (C) PCR-SSCP analysis generated by the primers that span the region from 448 bp to 741 bp of the ORF. Arrows identify the abnormally migrating bands.
as a cell-death (apoptosis) effector whose activity is neutralized by binding of bcl-2 [12]. The binding of bcl-x-s to bcl-2 was hypothesized to prevent bcl-2 from interacting with bax, thus leaving bax unopposed in its cell-death effector function [12]. Use of site-specific mutagenesis [13] and deletion mutants [12] of bcl-2 suggests that bcl-2 homodimerization and heterodimerization with other
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
Figure 2 shows the results of PCR-SSCP analysis generated by the primers that span the region -40 to 741 bp of the ORF. PCR products from DLL samples of patients 2, 4, and 6 showed altered electrophoretic mobility compared to their respective FL cell counterparts. Sequence analysis of the bcl-2 ORF in six FLs confirmed the results of SSCP analysis. None of the six FL samples showed nucleic acid changes compared to germline bcl-2 gene sequences. A total of 11 point mutations detected in the three DLLs (cases 2, 4, and 6) showed altered electrophoretic mobility by SSCP analysis, but these mutations were absent in the preexisting FLs (Table 1). All 11 somatic mutations were transitions (A > C or G > T) and four of them predicted amino acid substitutions within the p26-6c/-2a protein at codons 29 (E > K), 46 and 59 (P > L), and 106 (R > H).
N (A)
122 bcl-2 family members involves interaction between distinct regions within the bcl-2 protein. In our studies, we have shown that somatic mutation in DLL cells resulted in replacements of the amino acid at positions 29, 46, 59, and 106 of the bcl-2 protein. These structural alterations may affect interaction of bcl-2 with other bcl-2 family members and/or other oncogenes and tumor-suppressor genes. Since the precise amino acid residues of the bcl-2 protein involved in homo- or hetrodimerization have not been determined, the mechanism(s) by which structurally altered bcl-2 protein changes to biological behavior of FL cells is highly speculative. The demonstration of altered amino acid residues of the bcl-2 protein in morphologically transformed of FL cells showed in the present studies provides a reasonable starting point for the further investigation of the molecular basis and pathways of lymphoma transformation.
This study was partially supported by NIH grants EY-06337 to D. M. Knowles and CA-33119 and CA34233 to R. A.Warnke. References Garvin AJ, Simon RM, Osborne CK et al. An autopsy study of histologic progresssion in non-Hodgkin's lymphomas: 192 cases from the National Cancer Institute. Cancer 1983; 52: 393-405. Cleary ML, Sklar J. Nucleotide sequence of a t(14;18) chromosomal breakpoint in follicular lymphoma and demonstration of a breakpoint cluster region near a transcriptionally active locus on chromosome 18. Proc Natl Acad Sci USA 1985; 82: 7439-43. Cleary ML, Galili N, Sklar J. Detection of a second t(14;18) break-
Correspondence to: Daniel M. Knowles, MD Department of Pathology The New York Hospital - Cornell Medical Cancer 525 East 68th Street New York, NY 10021 USA
Downloaded from http://annonc.oxfordjournals.org/ at NERL on May 31, 2015
Ackowledgements
point cluster region in human follicular lymphomas. J Exp Med 1986; 164: 315-20. Korsmeyer S J. Bcl-2 initiates a new category of oncogenes: Regulations of cell death. Blood 1992; 80: 879-86. Richardson ME, Quanguang C, Filippa DA et al. Intermediate- to high-grade histology of lymphomas carrying t(14; 18) is associated with additional nonrandom chromosome changes. Blood 1987; 70: 444-7. Yano T, Jaffe ES, Longo DL et al. MYC rearrangements in histologically progressed follicular lymphomas. Blood 1992; 80: 758-67. Lo Coco F, Gaidano G, Louie DC et al. P53 mutations are associated with histologic transformation of follicular lymphoma. Blood 1993; 82: 2289-95. Crescenzi M, Seto M, Herzig GP et al. Thermostable DNA polymerase chain amplification of t(14;18) chromosome breakpoints and detection of minimal residual disease. Proc Natl Acad Sci USA 1988; 85: 4869-73. Tanaka S, Kant J, Reed JC. G to A polymorphism in the second exon of the6c/-2 gene. Nucleic Acid Res 1991; 19:1964-9. 10. Seto M, Jaeger U, Hockett RD et al. Alternative promoters and exons, somatic mutation, and transcriptional deregulation of the bcl-2-Ig fusion gene in lymphoma. EMBO J 1988; 7:123-9. Tanaka S, Louie DC, Kant JA et al. Frequent incidence of somatic mutations in translocated bcl-2 oncogenes of non-Hodgkin's lymphomas. Blood 1992; 79: 229-37. 12. Sato T, Hanada M, Bodrug S et al. Interactions among members of the bcl-2 protein family analyzed with a yeast two-hybrid system. Proc Natl Acad Sci USA 1994; 91: 9238^2. 13. Yin X, Oltvai ZN, Korsmeyer SJ. HB1 and HB2 domains of bcl-2 are required for inhibition of apoptosis and heterodimerization with box. Nature 1994; 369: 321-3.