Specific Expression of Maize SBEIIb Promoter Mediated by Different Promoter Region in Transgenic Tobacco Plants

Agricultural Sciences in China

November 2009

2009, 8(11): 1277-1285

Specific Expression of Maize SBEIIb Promoter Mediated by Different Promoter Region in Transgenic Tobacco Plants SUN Cui-xia1, HAN Jing2, LI Meng1, WANG Xiao-peng1, ZHANG Guo-dong1, TIAN Yan-chen1 and WANG Ze-li1 1 2

National Key Laboratory of Crop Biology, College of Life Sciences, Shandong Agricultural University, Tai’an 271018, P.R.China Maize Research Institute, Shandong Academy of Agricultural Sciences, Jinan 250000, P.R.China

Abstract Starch branching enzyme (SBE) catalyzes the biosynthesis of amylopectin. We described the isolation and characterization of SBEIIb promoter and their expression patterns in transgenic tobacco. Using the genomic DNA of maize cultivar Lunuo 1 as template, the SBEIIb promoter was isolated by PCR and was cloned into pMD18-T vector. To study SEBIIb gene regulation at the cellular level, SBEIIb promoter was fused to the β-glucuronidase (GUS) report gene. The results of the fluorometric GUS assays indicate that the sbeIIb-GUS fusion directed a seed-specific expression. Four series of constructs were made with the promoter and the GUS reporter gene to investigate the cis-acting analysis, showing that the four different constructs all can drive expression of the GUS gene in seed plumule and cotyledon and the GUS activity was apparently decreased with the progressive loss of promoter 5´ end. Key words: maize starch-branching enzyme, promoter, cloning, specific expression

INTRODUCTION The synthesis of starch is a complex biochemical process. Starch branching enzyme (SBE) is the key enzyme of amylopectin biosynthesis in plants. SBEs catalyze the formation of branch-points within glucan chains by an hydrolyzing α-1,4 linkage and reattaching the chain to a glucan chain via α-1,6 bond. Thus, SBEs are of crucial importance for the quantity and quality of starch synthesized in the plant (Edwards et al. 1988). Three isoforms of starch-branching enzymes, SBEI, SBEIIa, and SBEIIb, have been identified in leaves and/or kernels of maize (Zea mays) by Boyer and Preiss (1978), and Dang and Boyer (1988). In maize, barley, and rice, two isoforms of SBEII,

SBEIIa, and SBEIIb, have been separated by anionexchange separation (Boyer and Preiss 1978) and characterized (Singh and Preiss 1985). SBEIIa and SBEIIb, though closely related, are encoded by different genes. cDNAs for both SBEIIa and SBEIIb were cloned from maize, rice and barley (Mizuno et al. 1993; Gao et al. 1997). Isolation of the maize cDNAs encoding SBE isoforms (SBEIIa and SBEIIb) enabled the investigation of the Sbe genes at molecular level (Baba et al. 1991; Fisher et al. 1993, 1995, 1996; Gao et al. 1996, 1997; Kim et al. 1998a, b; Blauth et al. 2001). Maize SBEIIa and SBEIIb have been shown to share several biochemical properties (Guan and Preiss 1993; Takeda et al. 1993) and their cDNA sequences share high homology and their cDNAs show 85% nucleotide sequence identity over

Received 30 April, 2009 Accepted 1 June, 2009 Correspondence WANG Ze-li, Professor, Ph D, E-mail: [email protected], [email protected]

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd. doi: 10.1016/S1671-2927(08)60339-9

1278

the central region with divergent 5´ and 3´ends. The relative expression levels of SBEIIa and SBEIIb differ amongst species. SBEIIa in maize is predominantly expressed in leaves, whereas the predominant form in the endosperm is SBEIIb (Gao et al. 1997). Similarly, in rice (Oryza sativa), two isoforms of SBEIIa and SEBIIb, are found in the endosperm, but SBEIIb is the major isoform and unique to the endosperm (Yamanouchi and Nakamura 1992). In barley (Hordeum vulgare), the activities of SBEIIa and SBEIIb isoforms are roughly equal within the endosperm (Sun et al. 1998) but the SBEIIb insoform is only expressed in the endosperm. Gao et al. (1996) showed that SBEI and SBEIIb are expressed in a coordinate fashion with the granule-bound starch synthase and ADP-Glc pyrophosphorylase, respectively, during maize endosperm development. The finding that many genes are involved in starch biosynthesis are regulated by sugar availability (Muller-Rober et al. 1990; Koch et al. 1992; Giroux et al. 1994; Salehuzzaman et al. 1994; Fu et al. 1995), suggesting that they may share common regulatory mechanisms controlling their expression. While the in vitro properties of SBEIa differed from those of SBEIIa and SBEIIb (Guan and Preiss 1993; Takeda et al. 1993), the SBE1a or SBE2a single mutants obtained using Mu-mediated transposon mutagenesis indicated that the chain-length (CL) profiles of starch produced in endosperm in vivo were not affected by the deficiency of either SBEIa or SBEIIa (Blauth et al. 2001, 2002). Conversely, the mutant, which is deficient in SBEIIb, results in major changes in endosperm amylopectin structure (Yuan et al. 1993; Shi and Seib 1995; Klucinec and Thompson 2002). The in vivo functional behavior of these three single sbe mutants led us to hypothesize that during amylopectin biosynthesis in maize endosperm, the function of SBEIIb was predominant to that of both SBEIa and SBEIIa, and therefore the SBE1a mutant might affected starch structure only in its background. The aims of the present study were to investigate the characterization of maize SBEIIb regulatory sequences. Here, we report functional analysis of the SBEIIb promoter. The SBEIIb promoter was isolated using the genomic DNA of maize cultivar Lunuo 1 as template and fused to the β-glucuronidase (GUS) reporter gene. We then introduced psbeIIb-GUS into to-

SUN Cui-xia et al.

bacco by agrobacterium mediation. In order to study the characteristics of SBEIIb promoter in driving foreign gene expression, analysis of sbeIIb-GUS expression patterns in different tissues in transgenic tobacco was operated on. This is useful because the components can offer the research of SBEIIb gene expression and regulation mechanism.

MATERIALS AND METHODS Plant materials Seedlings of maize cultivar Lunuo 1 were grown in the greenhouse, or in a growth chamber with 16 h day (24°C) and 8 h night (20°C) under mild illumination (2 000 lux). Maize tissues were collected from the seedlings in the greenhouse or growing in a growth chamber. Tobacco plants (Nicotiana tabacum cv. ws38) were grown in growth chambers for agroinfiltration and gene transformation.

DNA extraction Maize leaves were frozen in liquid nitrogen and stored at -80°C. Genomic DNA was isolated from frozen leaves of maize cultivar Lunuo 1 with a cetyltrimethylammonium bromide (CTAB) technique (Fjellstrom et al. 2002). For the CTAB technique, 900 —L of PEX/CTAB extraction buffer (6.25 mmol L-1 potassium ethyl xanthogenate, 0.5% CTAB, 700 mmol L-1 NaCl, 10 mmol L-1 EDTA, and 100 mmol L-1 Tris, pH 7.5) was added to lyophilized leaf tissue cut into small pieces and put in 2-mL Eppendorf tubes, then lightly vortexed. The tubes were placed in a 65°C water bath for 1 h, mixed with 700 —L of 100% chloroform, and centrifuged for 10 min. The aqueous layer was collected and 800 —L of isopropanol was added to precipitate the nucleic acids. Nucleic acid pellets were washed with 400 —L of 100% ethanol, dried, and resuspended in 100 —L of Tris-EDTA buffer (10 mmol L-1 Tris, pH 7.5, and 0.5 mmol L-1 EDTA).

SBEIIb gene promoter cloning and construction of expression vector A pair of specific oligonucleotide primers were designed

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Specific Expression of Maize SEBIIb Promoter Mediated by Different Promoter Region in Transgenic Tobacco Plants

based on the sequence of SBEIIb (AF072725). P1: 5´T C T C T C C A A C C C C T T C A AT C - 3 ´ ; P 2 : 5 ´GACCGCAAGAGCGAAATC-3´. The genomic DNA from leaves was as a template for PCR amplification reaction. Reactions were carried out in a 25-—L reaction containing 70 ng of genomic DNA, 25 pmol L-1 each of forward and reverse primers, 4.0 —L each of dNTP, 1.25 U LA Taq enzyme, 2 × GC buffer I (5 mmol L-1 Mg2+ plus) 12.5 —L. Amplification was done in a hybrid thermal cycle (Hybrid Limited, United Kingdom) consisted of an initial denaturation step at 94°C for 3 min, followed by 30 cycles of denaturation at 94°C for 30 s, and primer annealing and extension at 72°C for 2 min, with a final 5 min extension at 72°C. Ligation was performed with the TaKaRa Ligation Kit ver. 2.1 (TaKaRa, Dalian). Analysis of the DNA sequence was performed using DNASIS software (Hitachi Software Engineering, Tokyo). The vector pBI121 was a binary plasmid, which could be directly used for Agrobacterium-mediated transformation of plants, and could bear a foreign gene and express in plant cell. In order to investigate the function of SBEIIb promoter, the new plasmids were constructed. For construction of the new plasmids, 5 —g plasmid pBI121 were digested with Hind III and BamH I (TaKaRa) and CaMV35S promoter was excluded. After being precipitated with ethanol, DNA was dissolved in 10 —L ddH2O, and then ligated with above annealed dsDNA fragments separately. The ligation reaction was performed in a final volume of 10 —L including 1 —L 10 × T4 DNA ligase buffer (NEB), 0.5 —L excised p2355, 4.5 —L annealed double strand DNA, and 40 U T4 DNA ligase (NEB) at 16°C overnight. The SBE promoter was then cloned into expression vector pBI121 to replace the 35S promoter. Recombination plasmid was then transformed into E. coli competent cell.

1279

Table 1 Primers used in promoter constructs Construct PC1 PC2 PC3

Oligonucleotides ACTCAAAGCTTACTGTTGCTCACGGACT CGTTAGGATCCTGACTGCAGGGCTACAAT ACACTAAGCTTGCATCTGGAGCATTGC CGTTAGGATCCTGACTGCAGGGCTACAAT TGACTAAGCTTACGATCAGCAGGACCTC CGTTAGGATCCTGACTGCAGGGCTACAAT

and P3, contains a 5´-end Hind III restriction enzyme site, respectively. Reverse primer P4 contains a 5´-end BamH I site. These PCR products were digested with Hind III and BamH I and the resulting fragments were cloned into pBI121 to generate the constructs PC1 (-745/+12), PC2 (-335/+12), and PC3 (-218/+12) (all sequence data not shown in this paper). These deletions were recovered and inserted into the expression vectors respectively.

PCR and Southern blot To characterize the SBEIIb promoter, the sbeIIb-GUS chimera was constructed and transferred to tobacco by A. tumefaciens mediated transformation (Hauffe et al. 1991). The genomic DNA of transgenic plants was extracted with a CTAB technique. The sequence of the foreign gene was detected by polymerase chain reaction (PCR). Here, we set positive and negative controls, respectively. Genomic DNA of the PCR-positive plants was digested by BamH I and Hind III. PCR amplification fragments (900 bp) of the plasmid from agrobacterium were labelled by the digoxigenin (DIG). A DIG-labelled probe was used to hybrid genomic DNA, which had been dotted and fixed on the positively charged nylon membrane. Then DIG Marking and Setection Kit was used for probe tag, hybrid and detection.

Determination of GUS activity Chimaeric promoter constructs To create a series of 5´ deletions in the SBEIIb promoter, four primers were used for polymerase chain reaction (PCR) to amplify the fragments containing the promoter sequence -745 to + 12, -335 to + 12, -218 to + 12. Primers used in PCR to create the sbeIIb-GUS constructs are shown in Table 1. Each forward primer, P1, P2,

GUS activity was determined using Fluorometric assay as described by Jefferson (1987). The roots of plants after being subjected to the different treatments were homogenized in 0.6 mL of chilled lysis buffer (sodium phosphate 0.1 mol L-1 and EDTA 1 mmol L-1) and 10 —L were used for measuring the GUS activity, which was normalized to protein concentration for each crude

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

1280

extract and calculated (pMol 4-methyl umbelliferone mg-1 soluble protein min-1). To determine GUS activity in T0 plants, tissue samples were collected from each transgenic line about two months after plantlets were transplanted into soil from Murashige-Skoog selection medium. Roots were washed carefully to remove any soil, and samples were taken from various parts of the root bale. Leaf samples were collected from young ones just after their full expansion was about the 1/3 from the top, and stem samples were collected at about the same position. All T0 plants grew under the same conditions, and the samples were collected at the same developmental stage. Protein content was measured by the Bradford (1976) method using BSA as a standard. Histochemical assays were performed as follows (Stomp 1992): About 0.5 cm × 0.5 cm tobacco leaves were fixed in the fixing solution (sodium phosphate 0.1 mol L-1, pH 7.0; 0.1% formaldehyde; 0.1% Triton X-100; 0.1% 2mercaptoethane) for 30 min, and then stained in GUS staining reagent which contained sodium phosphate 0.1 mol L-1, EDTA 10 mmol L-1, potassium ferrocyanide 0.5 mmol L-1, potassium ferrocyanide 0.5 mmol L-1, X-glucuronide 1 mmol L -1, and 0.1% Triton X-100. Tissues were vacuum infiltrated with the reaction solution to assure homogeneous penetration of the substrate.

RESULTS

SUN Cui-xia et al.

motifs were characteristic of the eukaryotic gene promoter. In addition, within the sbeIIb promoter, we found AGCCC and ACGT elements at -294 and -687 bp upstream of the transcriptional start site, respectively. RY (CATGCA) elements, endosperm-sequence (CGAAAAGCG), and GCN4 motif (TGAGTTTC) were also found. Initial screening was in LB medium containing kanamycin (Kan, 100 —g mL-1). The recombinant pSBEIIbGUS was obtained by digesting plasmid containing positive clones. The pSBEIIb-GUS was transformed into E. coli competent cells and five positive clones were selected. After digestion of the restriction analysis, one 1.0 kb specific band was obtained (Fig.1-C). The length of the restriction fragment is consistent with the expectation. Thus fusions plasmid pSBEIIb-GUS has been successfully constructed.

PCR and Southern blot The results indicated four plants had specific band and the length of the amplified fragment was consistent with the positive control. There were no specific bands in the non-transformation plants (Fig.2-A). To furtherly identify the integration of foreign gene, the PCR-positive plants were tested by Southern blot analysis. The results showed that there were hybridization band presented in four transgenic plants, while there were no hybridization bands in non-transformed plants, indicat-

Sequence analysis of the SBEIIb promoter and the construction of expression vector PCR product (Fig.1-A) was cloned into pMD18-T vector and then transformed into E. coli DH5α competent cells and 15 positive clones were selected. After digestion of the restriction analysis, one 1.0 kb specific band was obtained. The result of sequencing showed that the size of this promoter is 946 bp (Fig.1-B). Only 14 nucleotides showed changes comparing to the reported sequence, and homologous rate was 98.73%. Sequence analysis revealed that the promoter is abundant in various cis-elements, including CAAT and TATA motifs that were located at the -648 and -32 nucleotide upstream of the transcriptional start site, respectively. These two

Fig. 1 A, PCR products analysis of SBE gene promoter. The PCR product amplified by primers P1 and P2 was about 1.0 kb. M, 2.9 kb marker; lanes 1-2, inserting 1.0 kb respectively. B, PCR product was recovered and inserted into pMD18-T vector and transformed into E. coli. Recombinant plasmids pSBEIIb-GUS was constructed and their accuracy was confirmed by restriction enzyme digestion and DNA sequencing. M, 2.9 kb marker; lane 1, dimeric internolecular recombination product; lane 2, inversion products. C, verifing digestion of expression vector. M, 2.9 kb marker; lane 1, inversion product.

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Specific Expression of Maize SEBIIb Promoter Mediated by Different Promoter Region in Transgenic Tobacco Plants

ing that the target gene had been integrated into the genome (Fig.2-B).

1281

Promoter sbeIIb

GUS

GUS assays Ten independent transgenic T0 lines were selected randomly for Fluorometric assay for GUS activity to monitor functional properties of the cloned SBEIIb promoter in different organs in transgenic plants of mature plants. GUS activities were measured in different organs (young leaves, stems, roots and dry seeds) for all the tobacco plants transformed. The pSBE-GUS fusion detected the highest level of expression in seeds. GUS activity was weak in leaves. But it was not detected in the roots and stems tissues (Fig.3). GUS staining was especially evident in radicle and cotyledon (Fig.4).

Fig. 2 PCR detection and Southern blot of transgenic plants. A, study on transgenic detection with PCR. To further identify the integration of foreign gene, the PCR-positive plants were tested by Southern blot analysis. B, Southern blot of transgenic plant. M, DNA marker DL-2000. 1, positive control; 2-5, transgenic plants; 6, non-transgenic plants.

Fig. 4 Histochemical staining for GUS in transgenic radicle and cotyledon of tobacco transformed with the sbeIIb-GUS constructs.

Chimaeric promoter constructs Based on sequence analysis, the promoter contains one TATA box, from nt -32 to -27, one CAAT-box, from nt -648 to -645, one ACGT element from nt -687 to -684, an endosperm-sequence (CGAAAAGCG) from nt -279 to -271, and a GCN4 motif (TGAGTTTC) from nt -866 to -859. To evaluate the promoting characteristics and expression patterns of different regions of the cloned product, a series of 5´ deletions were made with double restriction enzyme digestion Hind III combined with BamH I to obtain the promoter deletion at -745, -335, and -218, respectively. All deletions were verified by DNA sequencing analysis (Fig.5).

Tobacco transformation and effect of deletions on GUS expression

Fig. 3 Determination of GUS activity. Histogram showing the median GUS activities in four different organs for the SBEIIb promoter. The GUS activities are expressed as pmol 4-MU per mg protein per min.

All the recombinant plasmids described in the previous section were introduced into tobacco (N. benthamiana) by A. tumefaciens-mediated transformation (Horsch et al. 1985). The level of GUS activity for each construct was normalized compared with the negative control (promoterless plasmid). The construct PC0 containing the longest 5´-flanking sequence (-898/+12) exhibited 29-fold greater GUS activity than the control promoter vector. This construct (-898/+12) showed the highest transcriptional activity. Deletions that removed GCN4 reduced GUS activity by 10-15%, from

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

1282

SUN Cui-xia et al.

Fig. 5 Schematic diagram of SBEIIb promoter 5´ deletions-Gus gene constructs. The thick black lines denote the SBEIIb promoter sequences. The numbers at left indicate deletion-end points relative to the transcription initiation site of the SBEIIb gene.

that observed with the (-745/+12) construct (Fig.6). Removal of the region between -898 and -335 resulted in a 32% reduction of GUS activity. When the deletion was extended to nt -218, the GUS activity was decreased by 30% as compared with the construct with its 5´-end at nt -335 (Fig.6). The smallest 5´flanking construct examined (-218/ + 12), which contained both the TATA box and RY element, possessing 15-fold greater GUS activity than the promoterless control (Fig.6). The pattern of GUS activity for the various deletion constructs also revealed the importance of the CAAT and TATA region of the promoter in seed-specific gene expression. To determine whether this promoter can direct a low level of seed specific gene expression, more sensitive assays should be performed by increasing the amount of material and the reaction times. To make sure that this activity was significant, measurements should be done in the same conditions with several samples of seeds coming from 10 untransformed plants and with

Fig. 6 Fluorometric GUS assay in agroinfiltrated tobacco seeds carrying different pSBE-GUS fusions. The GUS activities are also expressed as pmol 4-MU per mg protein per min. The bars represent the mean ± SD of the measurements from four independent experiments.

seeds from 10 different plants transformed with pBI101 (vector containing the GUS reporter gene without a promoter).

DISCUSSION Eukaryotes are multilevel regulation of gene expression systems. The main gene regulation is at the transcriptional leve. Up to now, the regulation mechanism inducing eukaryotic gene expression is not very clear. However, eukaryotic gene expression is carried out strictly according to a certain time and spatial sequence. Kim (1998a) studied the cis-regulatory elements in the SBEI 5´ upstream region using maize endosperm cell suspension. Two sequences that can make LUC report gene higher expression were found in the 60 bp region between -315 to -255 bp. Nucleoprotein extracted from maize kernel can combine with this 60 bp fragment and the results of electrophoretic mobility shift assay (EMSA) showed the two obvious retardant bands. Kreis et al. (1985) identified a conservative area related to endosperm-specific gene expression in the upstream approximately 300 bp of transcription initiation site through comparative analysis of all kinds of cereal storage protein gene promoter. The region was known as the endosperm box. SBE gene promoter sequence was cloned in this research. Sequencing analysis of this SBE promoter through DNASIS software showed that some seedspecific motifs or regulatory elements, in addition to common cis-elements, are present within the SBEIIb promoter sequence, such as AT-rich sequence, RY repeat elements, AGCCC sequence elements, ACGT sequence elements, endosperm-sequence (CGAAAAGCG) and GCN4 motif (TGAGTTTC). Promoter activities were influenced by the deletion of a

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Specific Expression of Maize SEBIIb Promoter Mediated by Different Promoter Region in Transgenic Tobacco Plants

series of 5´ upstream sequence. The SBEIIb gene promoter had lower activity when it had fewer positive motifs or elements. It can be assumed that the motifs or elements necessary for the seed-expression of the SBEIIb promoter are present in the 5´ upstream sequence. The above analysis shows that the promoter may have a seed-specific expression function. Comparison of the maize SBE1 and SBEIIb 5´-flanking sequences reveals little similarity, which possibly accounts for the different expression patterns of the two genes (Gao et al. 1996). SBE1 is expressed in most maize tissues or organs including endosperm, embryos, leaf, stem, root, and tassel, while SBEIIb is expressed only in endosperm and embryos as well as young tassel. Additionally, SBE1 and SBEIIb genes are expressed differentially during kernel development. The maize SBE2 gene is maximally expressed earlier in both developing endosperm and embryos than the maize SBEl gene. The GUS gene is a sensitive and versatile gene fusion marker in higher plants. It has been expressed at high levels in transformed tobacco plants with no obvious side effects on plant growth or reproduction. Many studies on the role of monocot promoters in tissuespecific expression were carried out by fusing promoters of various lengths with a uid A gene coding for GUS gene and subsequently assaying gene-specific activity in transgenic dicot species such as tobacco (Colot et al. 1987; Thomas and Flavell 1990). We have used the E. coli GUS gene as a gene fusion marker for analysis of gene expression in transformed plants. Higher plants tested lack intrinsic β-glucuronidase activity, thus enhancing the sensitivity with which measurements can be made. GUS is very stable, and tissue extracts continue to show high levels of GUS activity after prolonged storage. Expression of GUS can be measured accurately using Fluorometric assays of very small amounts of transformed plant tissue. Our data show that GUS gene directed by SBEIIb promoter was only specifically expressed in seed plumule and cotyledon through the GUS activity detection in the leaves, roots, stems, and immature seeds of transgenic tobacco, which proved that SBEIIb promoter is seed-specific promoter. The cis-elements responsible for enhancing GUS expression were distributed throughout the promoter. A series of 5´ deletions of the maize sbeIIb gene promoter fused to the β-glucuronidase

1283

(GUS) reporter gene has been examined for expression in transgenic tobacco plants. Promoter-deletion analysis in transgenic tobacco plants indicated that in several cases, these chimeric promoters displayed the typical regulated expression of their corresponding intact promoter: the soybean leghaemoglobin lbc3 gene (Stougaard et al. 1987), the maize Adh-1 gene (Ellis et al. 1987), the photosynthetic gene ST-LS1 (Stockhaus et al. 1989), and the potato proteinase inhibitor II gene (Keil et al. 1990). It indicated that these small promoter fragments contained all the necessary regulatory elements but needed strong enhancers to be functional.

Acknowledgements This research was supported by the projects in the National Key Technologies R&D Program during the 11th Five-Year Plan period of China (2006BAD01A03).

References Baba T, Kimura K, Mizuno K, Etoh H, Ishida Y, Shida O, Arai Y. 1991. Sequence conservation of the catalytic regions of amylolytic enzymes in maize branching enzyme-I. Biochemical Biophysical Research Communications, 181, 8794. Blauth S L, Kim K N, Klucinec J, Shannon J C, Thompson D, Guiltinan M. 2002. Identification of Mutator insertional mutants of starch-branching enzyme 1 (sbe1) in Zea mays L. Plant Molecular Biology, 48, 287-297. Blauth S L, Yuan Y, Klucinec J D, Shannon J C, Thompson D B, Guilitinan M J. 2001. Identification of Mutator insertional Mutants of starch-branching enzyme 2a in corn. Plant Physiology, 125, 1396-1405. Boyer C D, Preiss J. 1978. Multiple forms of (1,4)-α-D-glucan, (1,4)-α-D -glucan-6-glucosyl transferase from developing Zea mays L. kernels. Carbohydrate Research, 61, 321-334. Bradford M H. 1976. Rapid and sensitive methods for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Annual Review of Biochemistry, 72, 248-254. Colot V, Robert L S, Kavanagh T A, Bevan M W, Thompson R D. 1987. Localization of sequences in wheat endosperm protein genes which confer tissue-specific expression in tobacco. The European Molecular Biology Organization Journal, 6, 3559-3564. Dang P L, Boyer C D. 1988. Maize leaf and kernel starch synthases and starch branching enzymes. Phytochemistry, 27, 12551259. Edwards J, Green J H, Rees T. 1988. Activity of branching

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

1284

SUN Cui-xia et al.

enzyme as a cardinal feature of the ra locus in Pisum sativum. Phytochemistry, 27, 1615-1620.

α-glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The European Molecular Biology

Ellis J G, Llewellyn D J, Dennis E S, Peacock W J. 1987. Maize Adh-1 promoter sequences control anaerobic regulation:

Organization Journal, 6, 3901-3907. Keil M, Sanchez-Serrano J, Schell J, Willmitzer L. 1990.

addition of upstream promoter elements from constitutive genes is necessary for expression in tobacco. The European

Localization of elements important for the wound-inducible expression of a chimeric potato proteinase inhibitor IICAT

Molecular Biology Organization Journal, 6, 11-16. Fisher D K, Boyer C D, Hannah L C. 1993. Starch branching

gene in transgenic tobacco plants. The Plant Cell, 2, 61-70. Kim K N, Fisher D K, Gao M, Guiltinan M J. 1998a. Genomic

enzyme II from maize endosperm. Plant Physiology, 102, 1045-1046.

organization and promoter activity of the maize starch branching enzyme I gene. Gene, 216, 233-243.

Fisher D K, Kim K N, Gao M, Boyer C D, Guiltinan M J. 1995. A cDNA encoding starch branching enzyme I from maize

Kim K N, Gao M, Fisher D K, Guiltinan M J. 1998b. Molecular cloning and characterization of the Amylose-Extender gene

endosperm. Plant Physiology, 108, 1313-1314. Fisher D K, Gao M, Kim K N, Boyer C D, Guiltinan M J. 1996.

encoding starch branching enzyme IIB in maize. Plant Molecular Biology, 38, 945-956.

Allelic analysis of the maize amylose-extender locus suggests that independent genes encode starch-branching enzymes IIa

Klucinec J D, Thompson D B. 2002. Structure of amylopectins from ae-containing maize starches. Cereal Chemistry, 79,

and IIb. Plant Physiology, 110, 611-619. Fjellstrom R, McClung A, Shank A R, Marchetti M A, Bormans

19-23. Koch K E, Nolte K D, Duke E R, McCarty D R, Avigne W T.

C, Park W D. 2002. Progress on development of microsatellite markers associated with rice blast resistance genes. In:

1992. Sugar levels modulate differential expression of maize sucrose synthase genes. The Plant Cell, 4, 59-69.

Proceedings of the 29th Rice Technical Working Group Meeting, Texas Agricultural Experiment Station, College

Kreis M, Shewry P R, Forde B G, Forde J, Miflin B J.1985. Structure and evolution of seed storage proteins and their

Station, TX. pp. 43-44. Fu H, Kim S Y, Park W D. 1995. High-level tuber expression and

genes with particular reference to those of wheat, barley and rye. In: Miflin B, ed, Oxford Surveys of Plant Molecular and

sucrose inducibility of a potato Sus4 sucrose synthase gene require 5´ and 3´ flanking sequences and the leader intron.

Cell Biology. Oxford University Press, London. pp. 253317.

The Plant Cell, 7, 1387-1394. Gao M, Fisher D K, Kim K N, Shannon J C, Guiltinan M J.

Mizuno K, Kawasaki T, Shimada H Satoh H, Kobayashi E, Okumura S, Arai Y, Baba T. 1993. Alteration of the structural

1997. Independent genetic control of maize starch branching enzymes IIa and IIb: isolation and characterization of a Sbe2a

properties of starch composition by the lack of an isoform of starch branching enzyme in rice seeds. Journal of Biological

cDNA. Plant Physiology, 114, 69-78. Gao M, Fisher D K, Kim K N, Shannon J C, Guiltinan M J.

Chemistry, 268, 19084-19091. Muller-Rober B T, Kobmann J, Hannah L C, Willmitzer L,

1996. Evolutionary conservation and expression patterns of maize starch branching enzyme I and IIb genes suggests

Sonnewald U. 1990. One of two different ADP-glucose pyrophosphorylase genes from potato responds strongly to

isoform specialization. Plant Molecular Biology, 30, 12231232.

elevated levels of sucrose. Molecular Genetics and Genomics, 224, 136-146.

Giroux M J, Boyer G, Feix G, Hannah L C. 1994. Coordinated transcriptional regulation of storage product genes in the maize

Salehuzzaman S N I M, Jacobsen E, Visser R G F. 1994. Expression patterns of two starch biosynthesis genes in in

endosperm. Plant Physiology, 106, 713-722. Guan H P, Preiss J. 1993. Differentiation of the properties of the

vitro cultured cassava plants and their induction by sugars. Plant Science, 98, 53-62.

branching isozymes from maize (Zea mays L.). Plant Physiology, 10, 1269-1273.

Shi Y C, Seib P A. 1995. Fine structure of maize starches from four wx-containing genotypes of the W64A inbred line in

Hauffe K D, Paszkowski U, Schulze-Lefert P, Hahlbrock K, Dangl L, Douglas C J. 1991. A parsley 4CL-1 promoter

relation to gelatinization and retrogradation. Carbohydrate Polymers, 26, 141-147.

fragment specifies complex expression patterns in transgenic tobacco. The Plant Cell, 3, 435-443.

Singh B K, Preiss J. 1985. Starch branching enzymes from maize: immunological characterization using polyclonal and

Horsch R B, Fry J E, Hoffmann N L, Eichholtz D, Rogers S G, Fraley R T. 1985. A simple and general method for transferring

monoclonal antibodies. Plant Physiology, 79, 34-40. Sun C, Satish P, Ahlandsberg S, Deiber A, Jansson C. 1997.

genes into plants. Science, 227, 1229-1230. Jefferson R D, Kavanagh T A, Bevan M W. 1987. GUS fusions:

Identification of four starch branching enzymes in barley endosperm: partial purification of forms I, IIa and IIb. New

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.

Specific Expression of Maize SEBIIb Promoter Mediated by Different Promoter Region in Transgenic Tobacco Plants

1285

Phytologist, 137, 215-222. Stockhaus J, Schell J, Willmitzer L. 1989. Identification of

Takeda Y, Guan H P, Preiss J. 1993. Branching of amylose by the branching isoenzymes of maize endosperm. Carbohydrate

enhancer elements in the upstream region of the nuclear photosynthetic gene ST-LS1. The Plant Cell, 1, 805-813.

Research, 240, 253-263. Thomas M S, Flavell R B. 1990. Identification of an enhancer

Stomp A M. 1992. Histochemical localization of α-glucuronidase. In: Gallagher S R, ed, GUS Protocols: Using GUS Gene as a

element for endosperm-specific expression of high molecular weight glutenin. The Plant Cell, 2, 1171-1180.

Reporter of Gene Expression. Academic Press, San Diego. pp. 103-113.

Yamanouchi H, Nakamura Y. 1992. Organ specificity of isoforms of starch branching enzyme (Q-enzyme) in rice. Plant Cell

Stougaard J, Sandal N N, Gron A, Ktlhle A, Marcker K A. 1987. 5´ Analysis of the soybean leghaemoglobin lbc3 gene:

Physiology, 33, 985-991. Yuan R C, Thompson D B, Boyer C D. 1993. Fine-structure of

regulatory elements required for promoter activity and organ specificity. The European Molecular Biology Organization

amylopectin in relation to gelatinization and retrogradation behavior of maize starches from3 wx-containing genotypes

Journal, 6, 3565-3569.

in 2 inbred lines. Cereal Chemistry, 70, 81-89. (Edited by ZHANG Yi-min)

© 2009, CAAS. All rights reserved. Published by Elsevier Ltd.