Spontaneous transformation of cynomolgus mesenchymal stem cells in vitro: Further confirmation by short tandem repeat analysis

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 3 5 –4 4 0

Available online at www.sciencedirect.com

www.elsevier.com/locate/yexcr

Spontaneous transformation of cynomolgus mesenchymal stem cells in vitro: Further confirmation by short tandem repeat analysis Zhenhua Rena, b , Y. Alex Zhanga,⁎, Zhiguo Chena, c,⁎ a

Center for regenerative medicine, Xuanwu Hospital, Capital Medical University, Beijing, China, and Key Laboratory of Neurodegeneration, Ministry of Education, Beijing, China b Department of Anatomy, Anhui Medical University, Hefei, 230032, China c Stanford Institute for Stem Cell Biology and Regenerative Medicine and Department of Neurosurgery, Stanford, California, USA

A R T I C L E I N F O R M A T I O N

A B S T R A C T

Article Chronology:

It remains a highly debatable issue whether mesenchymal stem cells (MSCs) can undergo

Received 11 December 2011

spontaneous transformation in culture. Recently, two groups retracted their previous

Accepted 12 December 2011

publications due to the finding that the claimed transformed cells are actually contaminating

Available online 20 December 2011

cancer cells, which calls for a more stringent identification of transformed cells in the field. In this study, we continued with our previous finding of spontaneous transformation of

Keywords:

cynomolgus MSCs and provided further evidence using short tandem repeat analysis that the

Mesenchymal stem cells

transformed mesenchymal stem cells were indeed derived from cynomolgus MSCs.

Cynomolgus

© 2011 Elsevier Inc. All rights reserved.

Spontaneous transformation Short tandem repeat

Commentary In the recent study published from our lab in 2011 [1], we described a spontaneous transformation of cynomolgus mesenchymal stem cells (MSCs). The spontaneously transformed MSCs (TMCs) show telomerase activity and can lead to tumor development following injection into immunocompromised (NOD/SCID) mice, but fail to exhibit multiple differentiation potentials in vitro or in vivo. Spontaneous transformation of MSCs still remains controversial in the field, with several groups presenting conflicting results [2–6]. Recently, two groups retracted or commented on their previous publications after they discovered that the human TMCs were actually derived from contaminating cancer cells [7,8], which calls for a stringent identification of the transformed cells in the field. Torsvik et al., who belong to the group that reported the contamination of human cancer cells in TMCs [7,9],

commented on our publication and questioned the thoroughness of TMC identification. In the published study [1], we tried to identify the TMCs by two means. Firstly, we PCR-amplified and sequenced the housekeeping genes GAPDH, beta-actin, and Vimentin, and compared the sequences between cynomolgus MSCs and TMCs. Housekeeping genes are evolutionarily conserved genes that are required to maintain the minimum basic cellular functions [10]. We reason that if during evolution, the housekeeping genes show a lower mutation rate than that of the highly polymorphic genes, such as major histocompatibility class II (MHCII) [11], those housekeeping genes should also remain relatively stable in culture, even during the spontaneous transformation process. Although there are only a small number of nucleotides that are mismatched between the housekeeping genes of cynomolgus and human, if the PCR amplicons of the three housekeeping genes all exactly match those of cynomolgus but are all different from those of human,

⁎ Corresponding authors at: Xuanwu Hospital, Capital Medical University, 45 Changchun Street, Beijing 100053, China. Fax: +86 10 8319 8889. E-mail addresses: [email protected] (Y.A. Zhang), [email protected] (Z. Chen). 0014-4827/$ – see front matter © 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2011.12.012

436

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 3 5– 4 4 0

Fig. 1 – PCR analysis and sequence alignment for GAPDH, Beta-atin and Vimentin. (A) cDNAs of cMSCs and TMCs were subjected to PCR analysis using primers specific for GAPDH, Beta-atin and Vimentin. PCR products were separated on agarose gel and the bands of cMSCs and TMCs were of the same size. PCR reactions without cDNA template were used as negative controls (right lanes). (B–D) Comparison between cMSC, TMC and homo sapiens sequences for GAPDH (B), beta-actin (C) and Vimentin (D). The sequencing results for the PCR amplicons fully matched between cMScs, TMCs and the Macaca facicularis sequences deposited in GenBank. There was an 8-, 4-, and 2-bp mismatch between the sequences of TMCs and homo sapiens for GAPDH, beta-actin, and Vimentin, respectively.

Table 1 – STR analysis of cMSCs, TMCs and human MSCs using a human-specific kit. Locus

D19S433 D5S818 D21S11 D18S51 D6S1043 D3S1358 D13S317 D7S820 D16S539 CSF1PO PentaD Amelogenin vWA D8S1179 TPOX PentaE TH01 D12S391 D2S1338 FGA

cMSCs

TMCs

Human MSCs

Size 1

Size 2

Size 1

Size 2

Allele1

– – – – 375.68 119.33 – 226.47 – 364.25 403.14 107.43 – – – – – – 224.89 338.2

– – – – 383.33 127.22 – 234.39 – 364.25 403.14 113.41 – – – – – – 233.01 338.2

– – – – 374.99 119.12 – 226.57 – 364.2 403.23 107.39 – – – – – – 224.89 338.21

– – – – 383.34 127.17 – 234.45 – 364.2 403.23 113.40 – – – – – – 232.98 338.21

14.2 (117.79) 11 (163.38) 29 (223.1) 13 (302.01) 12 (388.29) 15 (138.57) 12 (195.32) 8 (223.2) 9 (281.07) 11 (339.8) 9 (400.19) X (107.41) 16 (149.54) 13 (229.28) 8 (277.75) 17 (377.54) 6 (158.68) 17 (105.17) 23 (249.18) 18 (302.51)

Allele2 14.2 11 31.2 15 18 16 13 11 11 11 9 Y 18 14 8 21 7 19 23 21

(117.79) (163.38) (233.21) (309.94) (411.83) (143.09) (199.3) (234.87) (289.07) (339.8) (400.19) (113.45) (157.66) (233.21) (277.75) (395.78) (166.56) (108.94) (249.18) (315.24)

Note: The numbers and letters under “Human MSCs” represent human haplotypes with STR sizes enclosed in parentheses. The numbers under “cMSCs” and “TMCs” represent STR sizes.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 3 5 –4 4 0

437

Fig. 2 – STR analysis of cynomolgus MSCs, TMCs and human MSCs using a human-specific kit. The genomic DNA of cynomolgus MSCs (cMSCs), TMCs and human MSCs (hMSCs) were subjected to STR analysis using a commercially available kit that amplifies 20 loci of human samples. 8 of 20 STR primers could amplify cynomolgus MSCs (cMSCs) and TMCs samples, confirming that the TMCs were not human cells. The STR sizes for cMSCs (A) and TMCs (B) fully matched each other but were different from those of human MSCs (C), which verified that TMCs were derived from cynomolgus MSCs.

438

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 3 5– 4 4 0

Table 2 – Macaca fuscata microsatellite loci. Locus

GenBank

MFGT19

Y11921

MFGT21

Y11922

MFGT22

Y11923

MFGT24

Y11924

Table 3 – STR primers. Locus

MFGT19 MFGT21 MFGT22 MFGT24

Primer sequences (5′-3′)

Annealing (°C)

F: GAGAGCATTACTTCAGCATC R: CCAATTAACAACAGATGCACC F: AACTTCAGTAAGATAAGGACC R: CCTGAGGTCTGGACTTTATAG F: CGTTAAGTATGATGTTAGCTAG R: CAACATAGAGAGATTCCATCTC F: GTTTCTGTTGAGTTGGCTGT R: GTAACTGTTTTGTGAATTAACTG

53

analysis

cMSCs

using

Macaca

TMCs

53 51 53

fuscata-specific Human MSCs

Size 1

Size 2

Size 1

Size 2

Size 1

Size 2

123.31 112.32 114.22 106.19

– 115.59 118.43 108.49

123.29 112.43 114.12 106.28

– 115.7 118.63 108.43

95.81 121.95 115.11 113.03

128.97 124.21 – 117.3

the probability is compellingly high that the TMCs are derived from cynomolgus rather than human cells. As expected (Fig. 1), all the PCR amplicons fully matched the gene sequences of cynomolgus GAPDH, beta-actin and Vimentin as deposited in PUBMED, whereas the amplicons showed an 8-, 4-, and 2-base pair mismatch than human GAPDH, beta-actin, and Vimentin, respectively. Secondly, we PCR-amplified the highly polymorphic region, MHCII loci, using the cDNAs of cynomolgus MSCs and TMCs as templates. We tried 10 sets of primers for the DQ, DP and DR loci and only 3 (DQA1, DQA2 and DPB) gave rise to positive bands, which showed the same number and size of amplicons as separated by electrophoresis [1]. Due to the low immunogenicity of MSCs and the low transcriptional level of MHCII genes, it was difficult to sequence the DQA1, DQA2 and DPB amplicons. The above results together with the karyotype analysis, as presented in the published paper [1], have pointed to a convincingly high probability that the TMCs were derived from the MSCs. However, as commented by Torsvik et al., the above methodologies may not be the most stringent way for an absolute identification of TMCs. Therefore, we have made the following effort to further confirm the TMC identity. As proposed by American Type Culture Collection Standards Development Organization Workgroup, short tandem repeat (STR) analysis may be the most stringent means for cell line identification to date [12]. However, no commercial kit is available for cynomolgus cells at present. Considering the high homology between human and cynomolgus DNA sequences, we did send

the genomic DNA of cynomolgus MSCs, TMCs and human MSCs for STR analysis using a human-specific kit (GoldeneyeTM20A). The kit amplifies 20 STR loci on human chromosomes. As presented in Table 1 and Fig. 2, all the 20 loci were amplified for the human MSC sample, while only 8 of the 20 loci for the cynomolgus samples, confirming that the TMCs are not contaminating human cells. In addition, the sizes of the 8 STR amplicons were all identical between cynomolgus MSCs and TMCs, but different than those of human MSCs, further verifying that the TMCs are derived from cynomolgus MSCs. It is encouraging that some human-specific STR primers can work on cynomolgus macaque samples, which suggests that STR primers specific for another macaque, hopefully with information available from literature, may work as well on cynomolgus macaque samples. Therefore, we performed additional STR tests using primers that had been shown to work on Japanese macaque (Macaca fuscata) samples [13] (Table 2). It turned out that the four sets of primers recognizing MFGT19, MFGT21, MFGT22, and MFGT24 STR loci could amplify both cynomolgus and human samples (Table 3). Again, the STR sizes of cynomolgus MSCs and TMCs fully matched each other but were all different from those of human MSCs (Fig. 3 and Table 3). The above data have adequately confirmed the identity of the TMCs, which are indeed originated from cynomolgus MSCs. Spontaneous transformation of MSCs has also been reported for other species, such as mice [14,15]. In Shi's report, murine MSCs and human MSCs are compared side by side for their propensities to spontaneous transformation. Not like murine MSCs, human MSCs show resistance to spontaneous transformation [14]. Weinberg R. et al. also showed that human cells require more genetic changes for neoplastic transformation than do their murine counterparts [16]. Although it is still debatable whether human MSCs can undergo spontaneous transformation, the current study has verified that cynomolgus MSCs can do so. The exact mechanisms underlying cynomolgus MSC transformation and whether species difference exists between monkey and human MSCs still require further investigation.

Acknowledgments The study was supported by the High Level Talent Fund of the Beijing Healthcare System (2009-2-14), Scientific Project of Beijing Municipal Science and Technology Commission (D07050701350706), National Basic Research Program of China (2011CB965103), National Science Foundation of China (31070946) and Research Assistance Fund of Anhui Medical University (XJ201008).

Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10. 1016/j.yexcr.2011.12.012.

Fig. 3 – STR analysis using Macaca fuscata-specific primers. The four sets of primers that can amplify the MFGT19 (A), MFGT21 (B), MFGT22 (C) and MFGT24 (D) STR loci of Macaca fuscata samples also worked on cynomolgus and homo sapiens samples. The STR sizes fully matched between cMSCs and TMCs, but were different than those of hMSCs.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 3 5 –4 4 0

439

440

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 3 5– 4 4 0

REFERENCES [8] [1] Z. Ren, J. Wang, W. Zhu, Y. Guan, C. Zou, Z. Chen, Y.A. Zhang, Spontaneous transformation of adult mesenchymal stem cells from cynomolgus macaques in vitro, Exp. Cell Res. 317 (2011) 2950–2957. [2] M.E. Bernardo, N. Zaffaroni, F. Novara, A.M. Cometa, M.A. Avanzini, A. Moretta, D. Montagna, R. Maccario, R. Villa, M.G. Daidone, O. Zuffardi, F. Locatelli, Human bone marrow derived mesenchymal stem cells do not undergo transformation after long-term in vitro culture and do not exhibit telomere maintenance mechanisms, Cancer Res. 67 (2007) 9142–9149. [3] L. Mazzini, I. Ferrero, V. Luparello, D. Rustichelli, M. Gunetti, K. Mareschi, L. Testa, A. Stecco, R. Tarletti, M. Miglioretti, E. Fava, N. Nasuelli, C. Cisari, M. Massara, R. Vercelli, G.D. Oggioni, A. Carriero, R. Cantello, F. Monaco, F. Fagioli, Mesenchymal stem cell transplantation in amyotrophic lateral sclerosis: a phase I clinical trial, Exp. Neurol. 223 (2010) 229–237. [4] L.A. Meza-Zepeda, A. Noer, J.A. Dahl, F. Micci, O. Myklebost, P. Collas, High-resolution analysis of genetic stability of human adipose tissue stem cells cultured to senescence, J. Cell. Mol. Med. 12 (2008) 553–563. [5] N. Serakinci, P. Guldberg, J.S. Burns, B. Abdallah, H. Schrodder, T. Jensen, M. Kassem, Adult human mesenchymal stem cell as a target for neoplastic transformation, Oncogene 23 (2004) 5095–5098. [6] Y. Wang, D.L. Huso, J. Harrington, J. Kellner, D.K. Jeong, J. Turney, I.K. McNiece, Outgrowth of a transformed cell population derived from normal human BM mesenchymal stem cell culture, Cytotherapy 7 (2005) 509–519. [7] A. Torsvik, G.V. Rosland, A. Svendsen, A. Molven, H. Immervoll, E. McCormack, P.E. Lonning, M. Primon, E. Sobala, J.C. Tonn, R. Goldbrunner, C. Schichor, J. Mysliwietz, T.T. Lah, H. Motaln, S. Knappskog, R. Bjerkvig, Spontaneous malignant transformation of human mesenchymal stem cells reflects cross-contamination:

[9]

[10]

[11]

[12] [13]

[14]

[15]

[16]

putting the research field on track — letter, Cancer Res. 70 (2010) 6393–6396. R. de la Fuente, A. Bernad, J. Garcia-Castro, M.C. Martin, J.C. Cigudosa, Retraction: spontaneous human adult stem cell transformation, Cancer Res. 70 (2010) 6682. G.V. Rosland, A. Svendsen, A. Torsvik, E. Sobala, E. McCormack, H. Immervoll, J. Mysliwietz, J.C. Tonn, R. Goldbrunner, P.E. Lonning, R. Bjerkvig, C. Schichor, Long-term cultures of bone marrow-derived human mesenchymal stem cells frequently undergo spontaneous malignant transformation, Cancer Res. 69 (2009) 5331–5339. A.J. Butte, V.J. Dzau, S.B. Glueck, Further defining housekeeping, or “maintenance,” genes Focus on “a compendium of gene expression in normal human tissues”, Physiol. Genomics 7 (2001) 95–96. C. Woodwark, A. Bateman, The characterisation of three types of genes that overlie copy number variable regions, PLoS One 6 (2011) e14814. Cell line misidentification: the beginning of the end, Nat. Rev. Cancer 10 (2010) 441–448. X. Domingo-Roura, T. Lopez-Giraldez, M. Shinohara, O. Takenaka, Hypervariable microsatellite loci in the Japanese macaque (Macaca fuscata) conserved in related species, Am. J. Primatol. 43 (1997) 357–360. M. Miura, Y. Miura, H.M. Padilla-Nash, A.A. Molinolo, B. Fu, V. Patel, B.M. Seo, W. Sonoyama, J.J. Zheng, C.C. Baker, W. Chen, T. Ried, S. Shi, Accumulated chromosomal instability in murine bone marrow mesenchymal stem cells leads to malignant transformation, Stem Cells 24 (2006) 1095–1103. H. Li, X. Fan, R.C. Kovi, Y. Jo, B. Moquin, R. Konz, C. Stoicov, E. Kurt-Jones, S.R. Grossman, S. Lyle, A.B. Rogers, M. Montrose, J. Houghton, Spontaneous expression of embryonic factors and p53 point mutations in aged mesenchymal stem cells: a model of age-related tumorigenesis in mice, Cancer Res. 67 (2007) 10889–10898. A. Rangarajan, S.J. Hong, A. Gifford, R.A. Weinberg, Species- and cell type-specific requirements for cellular transformation, Cancer Cell 6 (2004) 171–183.