- Email: [email protected]
STAT3 signaling maintains homeostasis through a barrier function and cell survival in corneal endothelial cells
Experimental Eye Research 179 (2019) 132–141
Contents lists available at ScienceDirect
Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer
STAT3 signaling maintains homeostasis through a barrier function and cell survival in corneal endothelial cells
T
Susumu Haraa,b,∗, Motokazu Tsujikawab,c, Kazuichi Maruyamab,d, Kohji Nishidab,∗∗ a
Department of Stem Cells and Applied Medicine, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan Department of Ophthalmology, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan c Division of Health Sciences Area of Medical Technology and Science, Department of Biomedical Informatics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan d Department of Innovative Visual Science, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan b
A R T I C LE I N FO
A B S T R A C T
Keywords: Cornea Corneal endothelial cells Barrier function ZO-1 STAT3 LIF
The cornea protects the eye from inflammation, which is one of the leading causes of blindness. Severe inflammation in the anterior chamber disrupts the barrier function of corneal endothelial cells (CECs) leading to severe visual loss. However, the mechanism by which such inflammation affects CEC function and survival is unknown. Activation of STAT3 signaling regulates various intracellular responses through inflammation and generally mediates expression of the barrier function marker zonula occludens-1 (ZO-1). In this study, we investigated the relationship between the corneal endothelial barrier function and activation of STAT3 signaling through a variety of cytokines in human CECs. Phosphorylated STAT3 (pSTAT3) was expressed in human and mouse CECs. Inhibition of pSTAT3 remarkably decreased the expression of the ZO-1 protein, reduced the transendothelial electric resistance, and induced cell apoptosis. The expression level of ZO-1 mRNA was correlated with that of STAT3 mRNA in the human corneal endothelium. pSTAT3 was increased with the addition of LIF, IL6, and IFN-γ. LIF expressed in CECs suppressed pSTAT3 activation as observed experimentally using an anti-LIF antibody. Promoter regions of ZO-1 and SOCS3 were directly regulated by transcriptional activation of STAT3. These findings suggest that regulation of the STAT3 pathway is essential for corneal endothelial homeostasis via barrier function and may protect from various inflammatory factors.
1. Introduction The cornea is a tissue composed of three layers (epithelium, stroma, and endothelium). Corneal endothelium is located on the anterior chamber side and functions as a barrier and pump (ZO-1 and Na+/K+ATPase) preventing water outflow from the anterior chamber to the corneal stroma (Maurice, 1972). Corneal endothelial cells (CECs) have poor proliferative capacity; thus, damage from excessive inflammation can lead to loss of sight. The corneal endothelium notably consists of less antigen presenting cells, and the endothelial side of the cornea is exposed to aqueous humor associated immune deviation (ACAID) to maintain transparency (Streilein, 2003). CECs possess immune modulation-related molecules such as PD-1 to suppress immune reactions or induction of regulatory T cells (Streilein, 2003). Therefore, infiltration of inflammatory cells into the cornea is regulated by various immunosuppressive factors in the
eye, especially CECs. To prevent this situation, the anterior segment facing the CEC shows immune privilege, and thus inflammation is selfregulated to protect the CEC function. When the immune privilege disrupts visual acuity, the most important function of the eye may be affected negatively. This is why rejection of corneal transplants are lower as compared to other tissues or organs. Corneal transplantation for corneal endothelial dysfunction in Fuchs’ corneal dystrophy and Bullous keratopathy is generally performed using penetrating keratoplasty, Descemet stripping automated endothelial keratoplasty, and Descemet membrane endothelial keratoplasty. However, the density of the transplanted corneal endothelium gradually decreases in the long term (Goldich et al., 2015; Hamzaoglu et al., 2015). A recent study measuring the levels of various cytokines in the aqueous humor revealed an increase in the levels of inflammatory cytokines, which may reduce corneal endothelial density (Yagi-Yaguchi et al., 2017b; Yazu et al., 2018).
∗
Corresponding author. Department of Stem Cells and Applied Medicine, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan. ∗∗ Corresponding author. E-mail addresses: [email protected] (S. Hara), [email protected] (K. Nishida). https://doi.org/10.1016/j.exer.2018.11.008 Received 23 July 2018; Received in revised form 9 October 2018; Accepted 8 November 2018 Available online 12 November 2018 0014-4835/ © 2018 Elsevier Ltd. All rights reserved.
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
anti-STAT3 antibodies were purchased from Cell Signaling Technology. Anti-pSTAT3 (goat polyclonal) and anti-SOCS3 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and the anti-βactin (Actin) antibody was purchased from Millipore Sigma. The antiNa+/K+-ATPase antibody was purchased from Millipore. The anti-ZO1 antibody was purchased from Thermo Fisher Scientific (Waltham, MA), and the anti-LIF antibody was purchased from R&D Systems.
Tight junction proteins through intracellular barriers in cell-cell junctions offer protection from immune cells (Dejana, 2004). ZO-1 proteins have a major barrier function in CECs, and are present in the vicinity of the cell membrane and retain the barrier structure (Willott et al., 1993). Similar to the barrier function, the pump function is also one of the important physiological functions of the corneal endothelium. Na+/K+-ATPase is one of the important pump molecules in the corneal endothelium. During inflammation, Tumor Necrosis Factor (TNF)-α reduces the barrier function through ZO-1 in CECs (Rajashekhar et al., 2014), whereas Interferon (IFN)-γ, Interleukin (IL)1β, and TGF-β regulate the expression and activity of Na+/K+-ATPase in epithelial cells (Hamacher et al., 2017), though there are few reports of inflammation in the corneal endothelium. It is unclear how the regulation of corneal endothelial physiological function in homeostasis is maintained in a steady-state and an inflammation-state in CECs. Corneal endothelium receives intracellular signals including various inflammatory factors from the aqueous humor or the corneal stromal layer side (Yamagami et al., 2003). Among them, we focused on STAT3, because it is the most expressed member of the STAT family in the corneal endothelium (Yoshihara et al., 2017). STAT3 is one of the important molecules in the intracellular transduction for inflammation, development, differentiation, and cell proliferation (Yu et al., 2007). In the activation of STAT3 through cytokines, STAT3 proteins are phosphorylated by Janus kinase (JAK) family members comprising JAK1, JAK2, and JAK3; they form a homodimer, and are present in the nucleus. STAT3 protein activity is suppressed through a negative-feedback loop of SOCS3 proteins (Murray, 2007; Yu et al., 2009). The mechanism of STAT3 transcriptional regulation in CECs has been rarely reported. In many reports on regenerative medicine by cell-based therapy of CECs, ZO-1 and Na+/K+-ATPase are used as functional markers of CEC culture (Hara et al., 2014; Okumura et al., 2009; Watanabe et al., 2011; Zhang et al., 2014). Thus, transcriptional regulation of corneal endothelial functional markers (ZO-1 and Na+/K+-ATPase) is poorly understood. It is important to clarify the transcriptional regulation of such physiological function markers in both the normal and inflammation state to maintain homeostasis. In this study, we focused on the relationship between the corneal endothelial functional marker and inflammatory transcription factor STAT3 and investigated the roles of STAT3 activation in CECs.
2.3. Immunoblotting Cells or tissues were lysed with Laemmli sample buffer containing βmercaptoethanol, sonicated using a Q500 sonicator (QSONICA, Newtown, CT) and boiled at 95 °C for 5 min. The lysates were centrifuged at 15000×g for 5 min at 4 °C. The samples were then loaded on to 4–12% NuPAGE gels (Thermo Fisher Scientific) and were transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% skim milk-TBST and incubated with the following primary antibodies: pSTAT3 (1:2000), STAT3 (1:2000), ZO-1 (1:1000), Na+/ K+-ATPase (1:1000), and Actin (1:20,000). For pSTAT3 detection, 50 mM sodium fluoride (phosphatase inhibitor) was added to the blocking and primary antibody dilution buffer (Hara et al., 2013). The membranes were further incubated with horseradish peroxidase-conjugated-anti-mouse or rabbit or goat antibody (1:5000; Jackson ImmunoResearch Laboratories, West Grove, USA), detected using ECL Prime (GE Healthcare; Pittsburgh, PA), and observed using a ChemiDocXRS system (BIO-RAD, Hercules, CA). The band density was measured using Image Lab software (BIO-RAD). 2.4. Immunostaining Cultured cells and tissues were fixed with 4% paraformaldehyde at RT for 30 min or with cold-methanol at −30 °C for 30 min and treated with TBS containing 0.3% Triton X100 and 5% normal donkey serum. Primary antibodies were: pSTAT3 (1:100), STAT3 (1:100), ZO-1 (1:100), and Na+/K+-ATPase (1:100). After incubation, the samples were stained with Alexa Fluor −488, −568, or −647 conjugated antidonkey IgG secondary antibodies (Thermo Fisher), and counterstained with Hoechst 33342. The samples were observed under a confocal microscope (LSM710, Carl Zeiss, Jena, Germany) or a fluorescence microscope (Carl Zeiss).
2. Materials and methods 2.5. Cell culture 2.1. Human and mouse tissues The HCEC-B4G12 cell line (Valtink et al., 2008) and primary CECs (Hara et al., 2014) were maintained in DMEM supplemented with 10% FBS (Thermo Fisher Scientific), 2 ng/ml bFGF, 100 U/ml penicillin, and 100 μg/ml streptomycin (Thermo Fisher Scientific) on cell culture plates or inserts coated with 100 ng/cm2 Laminin-511E8 (Nippi Inc, Tokyo, Japan). For ex vivo experiments, the tissue was cultivated in a serum-free medium containing DMEM:nutrient mixture F-12, 10% knockout serum-replacement, insulin-transferrin-selenium (Thermo Fisher Scientific), 4 ng/ml bFGF, 10 ng/ml LIF, 100 U/ml penicillin, and 100 μg/ml streptomycin (Liu et al., 2015). Human corneal endothelial progenitor cells (CEPs) were cultured in serum-free medium according to a previous report (Hara et al., 2014). After 2 days, the conditioned medium (CM) was collected in a conical tube, centrifuged at 3000×g for 10 min and stored at −80 °C. For the STAT3 phosphorylation assay, cells were provided with new medium 2 h prior to the assay, treated with the respective cytokine, and the reaction was stopped using the Laemmli sample buffer. For neutralization of LIF protein, samples were treated with anti-LIF antibody for 2 h at RT.
Human corneas were obtained from the SightLife of US eye bank, and were handled in accordance with the tenets of the Declaration of Helsinki. Normal ICR mice and pregnant ICR mice were obtained from Japan SLC, Inc. The animals were cared for in accordance with the Association for Research in Vision and Ophthalmology (ARVO). The Institutional Animal Care and Use Committee of Osaka University approved this study (#25-096-002). All animal experiments were performed according to the protocol approved by the committee. 2.2. Chemicals, cytokines, and antibodies Stattic (STAT3 inhibitory compound) was purchased from Millipore Sigma (Darmstadt, Germany). Basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF) were purchased from FUJIFILM Wako Pure Chemical Co, (Osaka, Japan). Leukemia Inhibitory Factor (LIF), IL6, ciliary neurotrophic factor (CNTF), TNF-α, IFN-γ, bone morphogenetic protein (BMP)-2, BMP-7, TGF-β1, TGF-β2, Wnt3a, dickkopf1 (DKK1), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), platelet-derived growth factor (PDGF), and vascular endothelial growth factor (VEGF) were purchased from R& D Systems (Minneapolis, MN). Anti-pSTAT3 (rabbit polyclonal) and
2.6. Trans-endothelial electronic resistance (TEER) B4G12-HCECs were cultured in a 6-well insert (BD). TEER was measured in the confluent cell culture either in the presence or absence 133
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 1. Localization of STAT3 in ocular tissues. (A) Immunoblotting of human corneal endothelial tissues. (B) In mouse development, pSTAT3 is not expressed in the periocular mesenchyme (PM) at E12.5. Expression of pSTAT3 and ZO-1 was localized in the corneal endothelium (CE) at E18.5 and in adult mouse eyes. The arrows indicate co-localization of pSTAT3 and ZO-1 proteins. (C–H): Immunostaining of pSTAT3 in human ocular tissues. pSTAT3 was distributed to the corneal endothelium (C–D), but not to the trabecular meshwork (E), corneal stroma (F), sclera (G), and corneal epithelium (H). Immunostaining with isotype controls was performed as a control in the corneal endothelium (I), TM (J), and Sclera (K). Hoechst 33342 (Hoechst) was used as a counterstaining reagent. Scale bar: 20 μm. CS, LV, TZ, and CE indicate corneal stroma, lens vehicle, transition zone, and corneal endothelium, respectively.
primer: 5′- taccgtcgactgcagGGAGGGAATTCAACTCGGACAAA -3′, SOCS3 forward primer: 5′- cgagctcaagcttcgGCTCCACACTCGCGTCAGG GTTG -3′, and SOCS3 reverse primer: 5′- taccgtcgactgcagCGGAGCAG GGAGTCCAAGTCGGA -3′. The lower-case letters in the primers indicate the homologous sequences used for vector construction. In order to generate a luciferase stable cell line, the HCEC-B4G12 cells (DSMZ, Braunschweig, Germany) were transfected using Lipofectamine 3000 reagent (Thermo Fisher Scientific) according to a standard protocol. After 2 days, the cells were subjected to medium containing 50–100 μg/ ml G418 for 2–4 weeks. The cells with LIF and/or Stattic were grown to confluence prior to performing the luciferase assay with Ready-To-Glo secreted luciferase reporter assay kit (Takara Bio). Luminescence was measured using the ARVO X4 system (Perkin Elmer).
of a STAT3 inhibitor using EVOM2 (WPI, Sarasota, USA). 2.7. TUNEL TUNEL assay was performed to assess apoptosis using an in situ cell death detection kit (Millipore Sigma), following the manufacturer's instructions. Image and data analyses were performed using Operetta (Perkin–Elmer, Hamburg, Germany). 2.8. Luciferase assay The promoter region of human ZO-1 and SOCS3 was sub-cloned in pMetLuc-Basic vector (Takara Bio, Shiga, Japan) using the In-Fusion cloning kit (Takara Bio). The primers used are: ZO-1 forward primer: 5′cgagctcaagcttcgGCAGCTTGACCCGTTCGGTCAAC -3′, ZO-1 reverse 134
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 2. Inhibition by pSTAT3 inhibitor in the CECs. (A): pSTAT3 inhibitor (pSTAT3i), 10 μM stattic-treated human corneal endothelial tissues ex vivo were blocked from expressing pSTAT3 and ZO-1 for 2 days, but not Na+/K+ATPase. (B): HCEC-B4G12 cell line also showed decreased pSTAT3 levels when treated with pSTAT3 inhibitor. (C): Immunostaining images for pSTAT3 in 5 μM pSTAT3itreated HCEC-B4G12 cells and vehicle-control cells. (D): Immunoblotting images f pSTAT3, total STAT3, ZO-1, and Na/K-ATPase with pSTAT3 inhibitor in HCEC-B4G12 cells. Actin (beta-actin) was used as a loading control in the immunoblot analysis. Trans-endothelial electric resistance (TEER, E) and cell viability (F) of HCEC-B4G12 cells was decreased with the addition of pSTAT3 inhibitor (n = 4) in a dose-dependent manner. (G): B4G12-HCEC cells showed increased apoptosis by the pSTAT3 inhibitor (n = 4) as seen in the TUNEL assay. Dimethyl sulfoxide (DMSO) was used as a solvent (control) for the pSTAT3 inhibitor studies. The data are shown as mean ± SD, *p < 0.05, **p < 0.01 and ***p < 0.001. Scale bars: 20 μm (A), 200 μm (B).
used to perform qPCR with TaqMan FAST master mix on a QuantStudio 12K Flex real-time PCR system (Thermo Fisher). TaqMan probes were purchased from Thermo Fisher (STAT3: Hs01047580_m1, ZO-1: Hs00268480_m1, Na+/K+-ATPase: Hs00167556_m1, and GAPDH: Hs99999905_m1).
2.9. Chromatin immunoprecipitation (ChIP)- quantitative-PCR (qPCR) ChIP was carried out using a SimpleChIP chromatin IP kit (Cell signaling technology, Beverly, MA) according to the manufacturer's protocol. Cells were treated with or without 10 mM stattic and 10 ng/ ml LIF for 120 min. Formaldehyde (final concentration of 1%) was added and incubated for 10 min prior to quenching with glycine solution. DNA-protein fragments were prepared using an ultrasonicator (Covaris Inc., Massachusetts, USA) and were incubated overnight with anti-STAT3 antibody and control IgG at 4 °C following which Protein G conjugated magnetic beads were added. Effects of STAT3 on target genes was assessed by qPCR using the specific primers (ZO-1-forward primer: 5′- GGGAAGTTACGTGGCGAAG -3′, ZO-1-reverse primer: 5′GGGAATTCAACTCGGACAAA -3′, SOCS3-forward primer: 5′- GCTGCG AGTAGTGACTAAAC -3′, SOCS3- reverse: 5′- CAGGGAGTCCAAGTC GGA -3′) and SYBR Premix DimerEraser (Takara Bio).
2.11. Statistical analysis The data are shown as mean ± SD and were analyzed using Spearman's rank correlation coefficient or paired t-test. All statistical analyses were performed using JMP Pro 14.0.0 software (SAS Institute Japan, Tokyo, Japan). A p value less than 0.05 was considered statistically significant. 3. Results
2.10. Reverse transcription PCR and qPCR
3.1. Expression of phosphorylated STAT3 (pSTAT3) and corneal endothelial functional marker in ocular tissues
The cDNA of the human corneal endothelial tissue samples was prepared as previously reported by Yoshihara et al., 2015, 2017 was
Despite STAT3 being an immunologically important transcriptional regulator, its analysis in corneal endothelium is inadequate. Therefore, 135
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
we first investigated the expression of pSTAT3 and ZO-1, an important CEC functional marker. Based on immunoblotting results, we observed localization of pSTAT3 in the corneal endothelium (Fig. 1A). The corneal endothelium is derived through the periocular mesenchyme through the neural crest (Bahn et al., 1984). We also confirmed pSTAT3 and ZO-1 expression in a series of mouse embryos and adult eyes by immunostaining. The expression of pSTAT3 was not evident at E12.5 in the periocular mesenchyme but was observed in the corneal endothelium from E18.5 to the adult eye tissue, which later matched with the expression of ZO-1 (Fig. 1B). Next, to test the localization of pSTAT3 and ZO-1 proteins in human sclerocorneal tissue, we studied their expression by whole-mount immunostaining experiments. The expression level of pSTAT3 was extremely high in CECs compared with that in the other anterior segments (Fig. 1C–D). Moreover, pSTAT3 shows nuclear localization. However, the pSTAT3 signal was clearly observed in the trabecular meshwork, corneal stroma, sclera, and corneal epithelium, but its subcellular localization was different (Fig. 1E–H). We confirmed the specificity of each antibody using isotype controls (Fig. 1I–K). These data suggested that pSTAT3 is highly expressed in CECs and has transcriptional activity.
from the immunoblotting studies (Fig. 3C). Stable induction of pSTAT3 was observed only with the addition of LIF. In contrast, upon addition of IFN-γ, pSTAT3, and SOCS3 showed reduced the expression at 7 days. We then checked the viability of CECs after addition of these three cytokines via STAT3 signaling. The cell numbers in the high-dosage LIF treatment were lower compared to the untreated cells and those treated with a lower dose (Fig. 3D). This suggests that over-activation of pSTAT3 via inflammation may be toxic to CECs, even when the signal itself is necessary for survival. There was no significant difference in the number of cells when treated with IL-6 (Fig. 3D). Cells treated with IFNγ were also reduced dramatically and in a dose-dependent manner (Fig. 3D). These data revealed that cytokines including the inflammatory cytokines LIF, IL-6, and IFN-γ are involved in the pSTAT3 signaling of the corneal endothelium. 3.4. LIF and STAT3 in CECs The presence and roles of inflammatory cytokines IL-6 and IFN-γ in corneal endothelium is well-known (Lahdou et al., 2014; Sagoo et al., 2004; Yagi-Yaguchi et al., 2017a). Specifically, one study reported the involvement of LIF in the proliferation of CECs in serum-free medium, acting through the JAK-STAT3 pathway (Liu et al., 2015). However, STAT3 signaling via LIF in a physiologically steady-state of CECs is unknown. We focused on the LIF protein as a cytokine for the activation of STAT3. CECs might be exposed to inflammatory signaling both from the basal (corneal stromal side) and apical (aqueous humor side) sides. As the CEC faces the anterior chamber on its apical side for maintaining ACAID, the signal from the apical side might be important. To determine whether LIF stimulated the pSTAT3 signal from the apical or basal side, the cell culture insert system was used (Fig. 4A). LIF was added to the cells on the apical and basal side of the insert. We observed increased expression of pSTAT3 via stimulation of both apical and basal sides in a dose-dependent manner with LIF (Fig. 4B), but such effects could be neutralized with an anti-LIF antibody (Fig. 4C). In transcriptome analysis by Cap analysis of gene expression in corneal endothelial tissue, CECs and CEPs revealed LIF expression (Yoshihara et al., 2017). To further examine the autocrine secretion of LIF from primary CECs and CEPs, we collected the conditioned media (CM) of CECs and CEPs. We found that pSTAT3 levels in cells with CEC-CM and CEP-CM were dramatically reduced by the addition of an anti-LIF neutralizing antibody compared to that with control IgG (Fig. 4D and E). These data suggest that STAT3 may be activated by LIF molecules secreted from the anterior chamber and the corneal endothelium itself.
3.2. Inhibition of STAT3 signal in CECs STAT3 signaling may be important for many functions in CECs. We examined two important functional markers of CECs, ZO-1 and Na+/ K+-ATPase. ZO-1 is a key component of the tight-junction barrier function protecting CECs, whereas Na+/K+-ATPase is a key component of the pump function under the suppression of STAT3 signaling. The pSTAT3 inhibitor, static, disrupted both ZO-1 localization and expression, but had no effect on Na+/K+-ATPase expression (Fig. 2A). For further confirmation, we used the HCEC-B4G12 cell line expressing the corneal endothelial function markers, ZO-1 and Na+/K+-ATPase. These cells died in a dose-dependent manner upon adding the inhibitor (Fig. 2B). Furthermore, a decrease in the nuclear localization of pSTAT3 was observed by the inhibitor using immunostaining studies (Fig. 2C). Expression of ZO-1 in the pSTAT3 inhibitor-treated CEC cell line was also remarkably decreased in a dose dependent manner, but did not alter the expression levels of Na+/K+-ATPase (Fig. 2D). These immunohistological results indicate that STAT3 signaling is important for the barrier function. Functional analysis by TEER also confirmed this hypothesis. Suppression of pSTAT3 significantly reduced the barrier function in a dose dependent manner (Fig. 2E). Moreover, suppression of pSTAT3 affects the survival of CECs (Fig. 2F). TUNEL analysis showed that the cell number reduction by pSTAT3 inhibitor was due to apoptosis of CECs (Fig. 2G). We also used another STAT3 inhibitor (WP1066), and found reduced ZO-1 expression and cell survival of CECs (Supplementary Fig. 1A-D). Collectively, these data indicate that STAT3 signaling is essential for the barrier function and survival of CECs.
3.5. Regulation of ZO-1 and SOCS3 by STAT3 As the DNA binding motif of STAT3 is known (Wang et al., 2015), we identified and characterized the binding motif of STAT3 in the promoter region of ZO-1 (TJP1) and SOCS3 by performing ChIP-qPCR and luciferase assays. The expression of ZO-1 was decreased when treated with Stattic but was increased with the addition of high concentrations of LIF (Fig. 5A–C). However, the activity of the ZO-1 promoter in cells treated with stattic was increased and showed LIF-dosedependency (Fig. 5A–C). These findings suggest that the expression of ZO-1 and SOCS3 was directly regulated by STAT3 activation of in the CECs.
3.3. Moderator of STAT3 signaling To determine the candidate cytokines that moderate STAT3, we analyzed pSTAT3 levels in HCEC-B4G12 cells using immunoblotting. We found that cytokines of the IL-6 family, LIF, IL-6, and IFN-γ increased the levels of pSTAT3 in CECs (Fig. 3A). Activation of STAT3 in various tissues through these inflammatory cytokines has been reported, but the involvement of these cytokines and STAT3 in CECs during inflammation is still not known. Induction peaks of pSTAT3 due to these three cytokines were observed at 30 min intervals (Fig. 3B) Interestingly, the level of pSTAT3 induced by IFN-γ began to decline after 4 h. Incubation with LIF for 7 days increased the expression of ZO1 and SOCS3 (2.1- and 1.7-fold, relative ratio of ZO-1/Actin and SOCS3/Actin, control cells vs 50 ng/ml LIF-treated cells, respectively), whereas IL-6 and IFN-γ decreased the levels of ZO-1 protein as evident
3.6. STAT3 and corneal endothelial function markers in human CECs tissue Our results suggest a correlation between STAT3 and CEC function via ZO-1 expression. To investigate the relationship between corneal endothelial function markers and STAT3, we examined the gene expression in human corneal endothelial tissue using quantitative PCR. The donor details applicable to the expression analysis in human corneal endothelial tissues are as follows: 23 eyes from 16 donors; donors’ age, 68.6 ± 11.6 years. The expression levels of STAT3 were 136
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 3. Activator of STAT3 in CECs. (A): Immunoblotting data of pSTAT3 and STAT3 with various cytokines (concentration: 10 ng/ml) for 30 min in HCECB4G12 cells. Actin (beta-actin) was used as a loading control. (B): Time course analysis of STAT3 activation with LIF, IL-6, and IFN-γ. (C): Immunoblot image of pSTAT3, ZO-1, and SOCS3 in a dose-dependent manner with LIF, IL-6, and IFN-γ treatment for 7 days. (D): Number of cytokine-treated cells after 7 days (n = 4). The data are shown as mean ± SD and *p < 0.05, ***p < 0.001. Scale bar: 100 μm (A).
significantly correlated with those of ZO-1, but not those of Na+/K+ATPase (Fig. 6A–B). We found an approximately 4-fold increase in STAT3 expression in each human corneal endothelial tissue. Furthermore, the expression of STAT3 and ZO-1 showed a positive correlation in human corneal endothelial tissue. There was no significant correlation between these genes and age (ZO-1 vs. age: p = 0.5951, ATP1A1 vs. age: p = 0.1460 and STAT3 vs. age: p = 0.2052). This suggests the roles of STAT3 signaling in controlling CEC function in vivo.
4. Discussion We identified that cytokines LIF, IL-6, and IFN-γ activate STAT3 in CECs; the effects of IL-6 and IFN-γ on the corneal endothelium have been previously reported. IFN-γ induces apoptosis through nitric oxideinduced activation of NF-κB, p38, and STAT1 in CECs (Lahdou et al., 2014; Sagoo et al., 2004). Yagi-Yaguchi and colleagues reported the increase of IL-6 in the aqueous humor to be negatively correlated with 137
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 4. LIF is expressed by CECs and activates the STAT3 protein as an autocrine factor. (A): Corneal endothelial model of the culture insert system. (apical side: anterior chamber, basal side: corneal stroma side). (B): Immunoblot images of cells treated with 0.1–10 ng/ml LIF on each side for 30 min. STAT3 is phosphorylated on both the apical and basal sides in a dose-dependent manner with LIF. (C): Neutralization of LIF (C), CECs-CM (D) and CEPs-CM (E) using an anti-LIF antibody decreased the pSTAT3 expression levels.
Fig. 5. Transcriptional regulation of ZO-1 and SOCS3 gene by pSTAT3. (A, D): Schema of human ZO-1 and SOCS3 gene. The asterisks in the figure highlight the candidate STAT3 binding motif. (B, E): ChIP-qPCR of HCEC-B4G12 cells with or without 5 μM stattic (pSTAT3i) and 10 ng/ml LIF for 2 h (C, F): Promoter analysis using luciferase activity. The cells were incubated with LIF with or without pSTAT3i for 24 h, and the luciferase assay was performed (n = 4). The data are shown as mean ± SD and *p < 0.05. 138
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
A
B Relative expression Na+/K+-ATPase (ATP1A1)
Relative expression ZO-1 (TJP1)
10 8 6 4 2 0
r = 0.6344 P = 0.0011 0
0.5
1
1.5
Relative expression STAT3
2
Fig. 6. Expression of STAT3 and corneal endothelial marker in human CECs in vivo. Expression data by quantitative PCR in human corneal endothelial tissues. Graphs show the relationship between the expression levels of STAT3 mRNA and corneal endothelial functional marker genes, ZO-1 (A) and Na+/K+-ATPase (B) (n = 23). r: correlation coefficient, P: Spearman's rank correlation coefficient.
30 25 20 15
10
r = 0.3340 P = 0.1193
5 0
0
0.5
1
1.5
2
Relative expression STAT3
Although the LIF-STAT3 signaling pathway is widely known in various cells including stem cells (Cartwright et al., 2005), we also found that the transcriptional activities of ZO-1 and SOCS3 genes are enhanced through the LIF-STAT3 pathway in CECs. STAT3 activation through LIF increased the expression of ZO-1 proteins in a dose-dependent manner, but the survival rate of CECs was gradually decreased. Furthermore, suppression of the LIF-STAT3 signaling pathway also reduced cell viability. We found that excessive activation of STAT3 through LIF reduced the CEC density and thus, maintenance of an optimal LIF concentration is vital to maintain corneal endothelial homeostasis. Interestingly, these data suggest that STAT3 activation is regulated by the autocrine system via LIF secretion from the CECs, and that the corneal endothelial barrier function and survival were possible through the LIF-STAT3 signaling pathway. We demonstrated that LIF was present in the CEC-CM as well as in the CEP-CM and activated the STAT3 proteins in the CECs. Furthermore, the expression of ZO-1 and pSTAT3 co-localized at the corneal endothelium during the late ocular developmental stage (E18.5) of mouse embryos. The barrier function of CECs may thus be formed at the late stage of corneal endothelial development and become immune privileged at the time. Thus, pSTAT3 may be a necessary transcription factor upon commitment to the phenotype of the corneal endothelium. Although we were unable to identify the cytokines involved in STAT3 activation in vivo, these data suggest that LIF is an autocrine factor and may regulate the differentiation of corneal endothelium by activating the LIF-STAT3 signaling pathway and inducing ZO-1 expression. To date, there have been several reports of immune privilege in corneal tissues (Niederkorn, 2003; Streilein, 2003), and its underlying mechanism is being understood. TGF-β, an immunosuppressive molecule is abundantly present in the eye and is known to be involved in immune privilege (Green and Ferguson, 2001; Ohta et al., 2000), but activation of STAT3 through TGF-β has not been observed. Here, we showed the potential of STAT3 as one of the key immune factors via barrier function through LIF in the CECs. The concentration of proinflammatory cytokines in human aqueous humor has been studied using multiplex cytokine analysis (Curnow et al., 2005; Takai et al., 2012; Yagi-Yaguchi et al., 2017a; Yamaguchi et al., 2016), although very few reports focus on LIF. Recently, cell-based therapy using cultured human CECs with a rho-associated protein kinase (ROCK) inhibitor was reported in the regenerative medicine of human CECs (Kinoshita et al., 2018). The ROCK inhibitors show an effect of suppressing inflammation and inhibition of infiltration of macrophages in the ocular tissues (Nourinia et al., 2017; Uchida et al., 2017). Several studies have also reported that STAT3 modulates phosphorylation by the ROCK inhibitor (Lingor et al., 2008; Pernet et al., 2013). It is thus necessary to further analyze the immune privilege mechanism in CECs via STAT3 and ROCK. In the future, identifying the molecular regulation of immune
corneal endothelial cell density (Yagi-Yaguchi et al., 2017a). A few reports on the transcription factor STAT3 in each corneal layer are available (Nakamura et al., 2014; Yang et al., 2012). Activation of STAT3 in corneal epithelial cells reproduces the pathological phenotypes in the corneal epithelium of Lrig1-knockout mouse (Nakamura et al., 2014). In the corneal stroma, activation of STAT3 by IFN-γ in human keratocytes and the expression of indoleamine 2,3-dioxygenase are remarkably enhanced; consequently, the inflammatory response may be enhanced (Yang et al., 2012). Even though STAT3 in CECs is known to be a growth marker of cultured CECs (Liu et al., 2015), its effect on the steady-state in CECs is not clear. Here, we demonstrate that through regulation of STAT3 expression levels it is possible to control the corneal endothelial barrier function through ZO1 and the survival of CECs. In terms of immune privilege, the corneal endothelium is known to have higher immune tolerance among all corneal tissues (Hori et al., 2007). Although the corneal endothelium is activated in the steady-state, corneal epithelial cells and keratocytes show very little activation of STAT3 in normal corneas. These cells may induce an immune response through STAT3 activation. Our findings suggest that STAT3 may be one of the transcriptional factors playing a role in the immune privilege in corneal endothelium. We demonstrated that the transcriptional factor STAT3 is involved in the barrier function and cell survival in the corneal endothelium. Promoter analysis using ChIP and luciferase assay showed that ZO-1 proteins are transcriptionally regulated by the direct binding of STAT3 to the regions upstream of these genes. Interestingly, activation of STAT3 is also implicated in the transcriptional regulation of ZO-1 in intestinal epithelial cells and in defense during gastrointestinal infections (Wang et al., 2015; Wittkopf et al., 2015). Intestinal epithelial cells show immune tolerance from oral intake of antigens (Peterson and Artis, 2014). Hence, intestinal epithelial cells and CECs may protect tissues by a common regulatory mechanism of immune tolerance through the barrier function via STAT3 activation. Chen and colleagues analyzed the transcriptome data of fetal and adult corneal endothelial cells (Chen et al., 2013), and found that the expression levels of STAT3 and ZO-1 in adult CECs are higher when compared to those in fetal CECs. We have also previously succeeded in identifying a few comprehensive human corneal endothelium-specific transcription factors based on transcriptome analysis (Yoshihara et al., 2017). In this study, we found that STAT3 was correlated with ZO-1 by gene expression analysis. The amounts of pSTAT3 depend on the expression level of STAT3 in CECs. In fact, STAT3 has been reported to enhance its own transcription activity (He et al., 2005; Onishi and Zandstra, 2015), and may perhaps be controlling the expression of ZO-1 in CECs in the steady state. There is no report describing the expression of transcription factors and corneal endothelial function markers of human corneal endothelial tissue and this is the first report clarifying the relationship between ZO-1 and STAT3. 139
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
privilege in the corneal endothelium involving STAT3 signaling may be important to improve the prognosis of corneal endothelial transplantation and regenerative medicine. In conclusion, inhibition of pSTAT3 significantly decreased the expression of the ZO-1 protein and the cell viability in CECs. pSTAT3 was increased in the presence of LIF, IL-6, and IFN-γ. Regulation of the STAT3 pathway is thus essential for corneal endothelial homeostasis via barrier function and may be protected from various inflammatory factors.
Vis. Sci. 46, 4251–4259. Dejana, E., 2004. Endothelial cell-cell junctions: happy together. Nat. Rev. Mol. Cell Biol. 5, 261–270. Goldich, Y., Showail, M., Avni-Zauberman, N., Perez, M., Ulate, R., Elbaz, U., Rootman, D.S., 2015. Contralateral eye comparison of descemet membrane endothelial keratoplasty and descemet stripping automated endothelial keratoplasty. Am. J. Ophthalmol. 159, 155–159 e151. Green, D.R., Ferguson, T.A., 2001. The role of Fas ligand in immune privilege. Nat. Rev. Mol. Cell Biol. 2, 917–924. Hamacher, J., Hadizamani, Y., Borgmann, M., Mohaupt, M., Mannel, D.N., Moehrlen, U., Lucas, R., Stammberger, U., 2017. Cytokine-ion channel interactions in pulmonary inflammation. Front. Immunol. 8, 1644. Hamzaoglu, E.C., Straiko, M.D., Mayko, Z.M., Sales, C.S., Terry, M.A., 2015. The first 100 eyes of standardized descemet stripping automated endothelial keratoplasty versus standardized descemet membrane endothelial keratoplasty. Ophthalmology 122, 2193–2199. Hara, S., Arawaka, S., Sato, H., Machiya, Y., Cui, C., Sasaki, A., Koyama, S., Kato, T., 2013. Serine 129 phosphorylation of membrane-associated alpha-synuclein modulates dopamine transporter function in a G protein-coupled receptor kinase-dependent manner. Mol. Biol. Cell 24, 1649–1660 S1641-1643. Hara, S., Hayashi, R., Soma, T., Kageyama, T., Duncan, T., Tsujikawa, M., Nishida, K., 2014. Identification and potential application of human corneal endothelial progenitor cells. Stem Cell. Dev. 23, 2190–2201. He, F., Ge, W., Martinowich, K., Becker-Catania, S., Coskun, V., Zhu, W., Wu, H., Castro, D., Guillemot, F., Fan, G., de Vellis, J., Sun, Y.E., 2005. A positive autoregulatory loop of Jak-STAT signaling controls the onset of astrogliogenesis. Nat. Neurosci. 8, 616–625. Hori, J., Joyce, N.C., Streilein, J.W., 2007. Immune privilege and immunogenicity reside among different layers of the mouse cornea. 2000. Ocul. Immunol. Inflamm. 15, 225–239. Kinoshita, S., Koizumi, N., Ueno, M., Okumura, N., Imai, K., Tanaka, H., Yamamoto, Y., Nakamura, T., Inatomi, T., Bush, J., Toda, M., Hagiya, M., Yokota, I., Teramukai, S., Sotozono, C., Hamuro, J., 2018. Injection of cultured cells with a ROCK inhibitor for bullous keratopathy. N. Engl. J. Med. 378, 995–1003. Lahdou, I., Engler, C., Mehrle, S., Daniel, V., Sadeghi, M., Opelz, G., Terness, P., 2014. Role of human corneal endothelial cells in T-cell-mediated alloimmune attack in vitro. Invest. Ophthalmol. Vis. Sci. 55, 1213–1221. Lingor, P., Tonges, L., Pieper, N., Bermel, C., Barski, E., Planchamp, V., Bahr, M., 2008. ROCK inhibition and CNTF interact on intrinsic signalling pathways and differentially regulate survival and regeneration in retinal ganglion cells. Brain 131, 250–263. Liu, X., Tseng, S.C., Zhang, M.C., Chen, S.Y., Tighe, S., Lu, W.J., Zhu, Y.T., 2015. LIFJAK1-STAT3 signaling delays contact inhibition of human corneal endothelial cells. Cell Cycle 14, 1197–1206. Maurice, D.M., 1972. The location of the fluid pump in the cornea. J. Physiol. 221, 43–54. Murray, P.J., 2007. The JAK-STAT signaling pathway: input and output integration. J. Immunol. 178, 2623–2629. Nakamura, T., Hamuro, J., Takaishi, M., Simmons, S., Maruyama, K., Zaffalon, A., Bentley, A.J., Kawasaki, S., Nagata-Takaoka, M., Fullwood, N.J., Itami, S., Sano, S., Ishii, M., Barrandon, Y., Kinoshita, S., 2014. LRIG1 inhibits STAT3-dependent inflammation to maintain corneal homeostasis. J. Clin. Invest. 124, 385–397. Niederkorn, J.Y., 2003. The immune privilege of corneal grafts. J. Leukoc. Biol. 74, 167–171. Nourinia, R., Nakao, S., Zandi, S., Safi, S., Hafezi-Moghadam, A., Ahmadieh, H., 2017. ROCK inhibitors for the treatment of ocular diseases. Br. J. Ophthalmol (in press). Ohta, K., Yamagami, S., Taylor, A.W., Streilein, J.W., 2000. IL-6 antagonizes TGF-beta and abolishes immune privilege in eyes with endotoxin-induced uveitis. Invest. Ophthalmol. Vis. Sci. 41, 2591–2599. Okumura, N., Ueno, M., Koizumi, N., Sakamoto, Y., Hirata, K., Hamuro, J., Kinoshita, S., 2009. Enhancement on primate corneal endothelial cell survival in vitro by a ROCK inhibitor. Invest. Ophthalmol. Vis. Sci. 50, 3680–3687. Onishi, K., Zandstra, P.W., 2015. LIF signaling in stem cells and development. Development 142, 2230–2236. Pernet, V., Joly, S., Jordi, N., Dalkara, D., Guzik-Kornacka, A., Flannery, J.G., Schwab, M.E., 2013. Misguidance and modulation of axonal regeneration by Stat3 and Rho/ ROCK signaling in the transparent optic nerve. Cell Death Dis. 4, e734. Peterson, L.W., Artis, D., 2014. Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 14, 141–153. Rajashekhar, G., Shivanna, M., Kompella, U.B., Wang, Y., Srinivas, S.P., 2014. Role of MMP-9 in the breakdown of barrier integrity of the corneal endothelium in response to TNF-alpha. Exp. Eye Res. 122, 77–85. Sagoo, P., Chan, G.L., Larkin, D.F.R., George, A.J.T., 2004. Inflammatory cytokines induce apoptosis of corneal endothelium through nitric oxide. Invest. Ophthalmol. Vis. Sci. 45, 3964–3973. Streilein, J.W., 2003. Ocular immune privilege: therapeutic opportunities from an experiment of nature. Nat. Rev. Immunol. 3, 879–889. Takai, Y., Tanito, M., Ohira, A., 2012. Multiplex cytokine analysis of aqueous humor in eyes with primary open-angle glaucoma, exfoliation glaucoma, and cataract. Invest. Ophthalmol. Vis. Sci. 53, 241–247. Uchida, T., Honjo, M., Yamagishi, R., Aihara, M., 2017. The anti-inflammatory effect of ripasudil (K-115), a rho kinase (ROCK) inhibitor, on endotoxin-induced uveitis in rats. Invest. Ophthalmol. Vis. Sci. 58, 5584–5593. Valtink, M., Gruschwitz, R., Funk, R.H.W., Engelmann, K., 2008. Two clonal cell lines of immortalized human corneal endothelial cells show either differentiated or precursor cell characteristics. Cells Tissues Organs 187, 286–294. Wang, Z., Li, R., Tan, J., Peng, L., Wang, P., Liu, J., Xiong, H., Jiang, B., Chen, Y., 2015. Syndecan-1 acts in synergy with tight junction through Stat3 signaling to maintain
Conflicts of interest No conflict of interest exists for any author. Funding source This work was supported by JSPS KAKENHI Grant Number JP 17K169680 and JP 17K11448. Acknowledgments We thank Ms. Yuka Takada for technical assistance and support. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.exer.2018.11.008. Abbreviations ACAID associated immune deviation BDNF brain-derived neurotrophic factor bFGF basic fibroblast growth factor BMP bone morphogenetic protein CECs corneal endothelial cells CEPs corneal endothelial progenitor cells ChIP Chromatin immunoprecipitation CM conditioned medium CNTF ciliary neurotrophic factor DKK1 dickkopf1 EGF epidermal growth factor Na+/K + -ATPase sodium/potassium ATPase NGF nerve growth factor NT-3 neurotrophin-3 PCR polymerase chain reaction PDGF platelet-derived growth factor pSTAT3 phosphorylated STAT3 pSTAT3i Phosphorylated STAT3 inhibitor qPCR quantitative-PCR ROCK rho-associated protein kinase TEER Trans-endothelial electronic resistance VEGF vascular endothelial growth factor ZO-1 zonula occludens-1 References Bahn, C.F., Falls, H.F., Varley, G.A., Meyer, R.F., Edelhauser, H.F., Bourne, W.M., 1984. Classification of corneal endothelial disorders based on neural crest origin. Ophthalmology 91, 558–563. Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K., Dalton, S., 2005. LIF/ STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development 132, 885–896. Chen, Y.Y., Huang, K., Nakatsu, M.N., Xue, Z.G., Deng, S.X., Fan, G.P., 2013. Identification of novel molecular markers through transcriptomic analysis in human fetal and adult corneal endothelial cells. Hum. Mol. Genet. 22, 1271–1279. Curnow, S.J., Falciani, F., Durrani, O.M., Cheung, C.M., Ross, E.J., Wloka, K., Rauz, S., Wallace, G.R., Salmon, M., Murray, P.I., 2005. Multiplex bead immunoassay analysis of aqueous humor reveals distinct cytokine profiles in uveitis. Invest. Ophthalmol.
140
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
bullous keratopathy and low endothelial cell density. Invest. Ophthalmol. Vis. Sci. 57, 5954–5962. Yang, J.W., Ham, D.S., Kim, H.W., Lee, S.G., Park, S.K., Seo, S.K., 2012. Expression of Stat3 and indoleamine 2, 3-dioxygenase in cornea keratocytes as factor of ocular immune privilege. Graefes Arch. Clin. Exp. Ophthalmol. 250, 25–31. Yazu, H., Yamaguchi, T., Aketa, N., Higa, K., Suzuki, T., Yagi-Yaguchi, Y., Satake, Y., Abe, T., Tsubota, K., Shimazaki, J., 2018. Preoperative aqueous cytokine levels are associated with endothelial cell loss after descemet's stripping automated endothelial keratoplasty. Invest. Ophthalmol. Vis. Sci. 59, 612–620. Yoshihara, M., Hara, S., Tsujikawa, M., Kawasaki, S., Hayashizaki, Y., Itoh, M., Kawaji, H., Nishida, K., 2017. Restricted presence of POU6F2 in human corneal endothelial cells uncovered by extension of the promoter-level expression atlas. EBioMedicine 25, 175–186. Yoshihara, M., Ohmiya, H., Hara, S., Kawasaki, S., Hayashizaki, Y., Itoh, M., Kawaji, H., Tsujikawa, M., Nishida, K., 2015. Discovery of molecular markers to discriminate corneal endothelial cells in the human body. PloS One 10, e0117581. Yu, H., Kortylewski, M., Pardoll, D., 2007. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat. Rev. Immunol. 7, 41–51. Yu, H., Pardoll, D., Jove, R., 2009. STATs in cancer inflammation and immunity: a leading role for STAT3. Nat. Rev. Canc. 9, 798–809. Zhang, K., Pang, K., Wu, X., 2014. Isolation and transplantation of corneal endothelial cell-like cells derived from in-vitro-differentiated human embryonic stem cells. Stem Cell. Dev. 23, 1340–1354.
intestinal mucosal barrier and prevent bacterial translocation. Inflamm. Bowel Dis. 21, 1894–1907. Watanabe, R., Hayashi, R., Kimura, Y., Tanaka, Y., Kageyama, T., Hara, S., Tabata, Y., Nishida, K., 2011. A novel gelatin hydrogel Carrier sheet for corneal endothelial transplantation. Tissue Eng. 17, 2213–2219. Willott, E., Balda, M.S., Fanning, A.S., Jameson, B., Van Itallie, C., Anderson, J.M., 1993. The tight junction protein ZO-1 is homologous to the Drosophila discs-large tumor suppressor protein of septate junctions. Proc. Natl. Acad. Sci. U. S. A. 90, 7834–7838. Wittkopf, N., Pickert, G., Billmeier, U., Mahapatro, M., Wirtz, S., Martini, E., Leppkes, M., Neurath, M.F., Becker, C., 2015. Activation of intestinal epithelial Stat3 orchestrates tissue defense during gastrointestinal infection. PloS One 10, e0118401. Yagi-Yaguchi, Y., Yamaguchi, T., Higa, K., Suzuki, T., Aketa, N., Dogru, M., Satake, Y., Shimazaki, J., 2017a. Association between corneal endothelial cell densities and elevated cytokine levels in the aqueous humor. Sci. Rep.-Uk 7. Yagi-Yaguchi, Y., Yamaguchi, T., Higa, K., Suzuki, T., Yazu, H., Aketa, N., Satake, Y., Tsubota, K., Shimazaki, J., 2017b. Preoperative aqueous cytokine levels are associated with a rapid reduction in endothelial cells after penetrating keratoplasty. Am. J. Ophthalmol. 181, 166–173. Yamagami, H., Yamagami, S., Inoki, T., Amano, S., Miyata, K., 2003. The effects of proinflammatory cytokines on cytokine-chemokine gene expression profiles in the human corneal endothelium. Invest. Ophthalmol. Vis. Sci. 44, 514–520. Yamaguchi, T., Higa, K., Suzuki, T., Nakayama, N., Yagi-Yaguchi, Y., Dogru, M., Satake, Y., Shimazaki, J., 2016. Elevated cytokine levels in the aqueous humor of eyes with
141
Contents lists available at ScienceDirect
Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer
STAT3 signaling maintains homeostasis through a barrier function and cell survival in corneal endothelial cells
T
Susumu Haraa,b,∗, Motokazu Tsujikawab,c, Kazuichi Maruyamab,d, Kohji Nishidab,∗∗ a
Department of Stem Cells and Applied Medicine, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan Department of Ophthalmology, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan c Division of Health Sciences Area of Medical Technology and Science, Department of Biomedical Informatics, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan d Department of Innovative Visual Science, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan b
A R T I C LE I N FO
A B S T R A C T
Keywords: Cornea Corneal endothelial cells Barrier function ZO-1 STAT3 LIF
The cornea protects the eye from inflammation, which is one of the leading causes of blindness. Severe inflammation in the anterior chamber disrupts the barrier function of corneal endothelial cells (CECs) leading to severe visual loss. However, the mechanism by which such inflammation affects CEC function and survival is unknown. Activation of STAT3 signaling regulates various intracellular responses through inflammation and generally mediates expression of the barrier function marker zonula occludens-1 (ZO-1). In this study, we investigated the relationship between the corneal endothelial barrier function and activation of STAT3 signaling through a variety of cytokines in human CECs. Phosphorylated STAT3 (pSTAT3) was expressed in human and mouse CECs. Inhibition of pSTAT3 remarkably decreased the expression of the ZO-1 protein, reduced the transendothelial electric resistance, and induced cell apoptosis. The expression level of ZO-1 mRNA was correlated with that of STAT3 mRNA in the human corneal endothelium. pSTAT3 was increased with the addition of LIF, IL6, and IFN-γ. LIF expressed in CECs suppressed pSTAT3 activation as observed experimentally using an anti-LIF antibody. Promoter regions of ZO-1 and SOCS3 were directly regulated by transcriptional activation of STAT3. These findings suggest that regulation of the STAT3 pathway is essential for corneal endothelial homeostasis via barrier function and may protect from various inflammatory factors.
1. Introduction The cornea is a tissue composed of three layers (epithelium, stroma, and endothelium). Corneal endothelium is located on the anterior chamber side and functions as a barrier and pump (ZO-1 and Na+/K+ATPase) preventing water outflow from the anterior chamber to the corneal stroma (Maurice, 1972). Corneal endothelial cells (CECs) have poor proliferative capacity; thus, damage from excessive inflammation can lead to loss of sight. The corneal endothelium notably consists of less antigen presenting cells, and the endothelial side of the cornea is exposed to aqueous humor associated immune deviation (ACAID) to maintain transparency (Streilein, 2003). CECs possess immune modulation-related molecules such as PD-1 to suppress immune reactions or induction of regulatory T cells (Streilein, 2003). Therefore, infiltration of inflammatory cells into the cornea is regulated by various immunosuppressive factors in the
eye, especially CECs. To prevent this situation, the anterior segment facing the CEC shows immune privilege, and thus inflammation is selfregulated to protect the CEC function. When the immune privilege disrupts visual acuity, the most important function of the eye may be affected negatively. This is why rejection of corneal transplants are lower as compared to other tissues or organs. Corneal transplantation for corneal endothelial dysfunction in Fuchs’ corneal dystrophy and Bullous keratopathy is generally performed using penetrating keratoplasty, Descemet stripping automated endothelial keratoplasty, and Descemet membrane endothelial keratoplasty. However, the density of the transplanted corneal endothelium gradually decreases in the long term (Goldich et al., 2015; Hamzaoglu et al., 2015). A recent study measuring the levels of various cytokines in the aqueous humor revealed an increase in the levels of inflammatory cytokines, which may reduce corneal endothelial density (Yagi-Yaguchi et al., 2017b; Yazu et al., 2018).
∗
Corresponding author. Department of Stem Cells and Applied Medicine, Osaka University Graduate School of Medicine, 2-2 Yamadaoka, Suita, Osaka, 565-0871, Japan. ∗∗ Corresponding author. E-mail addresses: [email protected] (S. Hara), [email protected] (K. Nishida). https://doi.org/10.1016/j.exer.2018.11.008 Received 23 July 2018; Received in revised form 9 October 2018; Accepted 8 November 2018 Available online 12 November 2018 0014-4835/ © 2018 Elsevier Ltd. All rights reserved.
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
anti-STAT3 antibodies were purchased from Cell Signaling Technology. Anti-pSTAT3 (goat polyclonal) and anti-SOCS3 antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), and the anti-βactin (Actin) antibody was purchased from Millipore Sigma. The antiNa+/K+-ATPase antibody was purchased from Millipore. The anti-ZO1 antibody was purchased from Thermo Fisher Scientific (Waltham, MA), and the anti-LIF antibody was purchased from R&D Systems.
Tight junction proteins through intracellular barriers in cell-cell junctions offer protection from immune cells (Dejana, 2004). ZO-1 proteins have a major barrier function in CECs, and are present in the vicinity of the cell membrane and retain the barrier structure (Willott et al., 1993). Similar to the barrier function, the pump function is also one of the important physiological functions of the corneal endothelium. Na+/K+-ATPase is one of the important pump molecules in the corneal endothelium. During inflammation, Tumor Necrosis Factor (TNF)-α reduces the barrier function through ZO-1 in CECs (Rajashekhar et al., 2014), whereas Interferon (IFN)-γ, Interleukin (IL)1β, and TGF-β regulate the expression and activity of Na+/K+-ATPase in epithelial cells (Hamacher et al., 2017), though there are few reports of inflammation in the corneal endothelium. It is unclear how the regulation of corneal endothelial physiological function in homeostasis is maintained in a steady-state and an inflammation-state in CECs. Corneal endothelium receives intracellular signals including various inflammatory factors from the aqueous humor or the corneal stromal layer side (Yamagami et al., 2003). Among them, we focused on STAT3, because it is the most expressed member of the STAT family in the corneal endothelium (Yoshihara et al., 2017). STAT3 is one of the important molecules in the intracellular transduction for inflammation, development, differentiation, and cell proliferation (Yu et al., 2007). In the activation of STAT3 through cytokines, STAT3 proteins are phosphorylated by Janus kinase (JAK) family members comprising JAK1, JAK2, and JAK3; they form a homodimer, and are present in the nucleus. STAT3 protein activity is suppressed through a negative-feedback loop of SOCS3 proteins (Murray, 2007; Yu et al., 2009). The mechanism of STAT3 transcriptional regulation in CECs has been rarely reported. In many reports on regenerative medicine by cell-based therapy of CECs, ZO-1 and Na+/K+-ATPase are used as functional markers of CEC culture (Hara et al., 2014; Okumura et al., 2009; Watanabe et al., 2011; Zhang et al., 2014). Thus, transcriptional regulation of corneal endothelial functional markers (ZO-1 and Na+/K+-ATPase) is poorly understood. It is important to clarify the transcriptional regulation of such physiological function markers in both the normal and inflammation state to maintain homeostasis. In this study, we focused on the relationship between the corneal endothelial functional marker and inflammatory transcription factor STAT3 and investigated the roles of STAT3 activation in CECs.
2.3. Immunoblotting Cells or tissues were lysed with Laemmli sample buffer containing βmercaptoethanol, sonicated using a Q500 sonicator (QSONICA, Newtown, CT) and boiled at 95 °C for 5 min. The lysates were centrifuged at 15000×g for 5 min at 4 °C. The samples were then loaded on to 4–12% NuPAGE gels (Thermo Fisher Scientific) and were transferred to polyvinylidene difluoride membranes. The membranes were blocked with 5% skim milk-TBST and incubated with the following primary antibodies: pSTAT3 (1:2000), STAT3 (1:2000), ZO-1 (1:1000), Na+/ K+-ATPase (1:1000), and Actin (1:20,000). For pSTAT3 detection, 50 mM sodium fluoride (phosphatase inhibitor) was added to the blocking and primary antibody dilution buffer (Hara et al., 2013). The membranes were further incubated with horseradish peroxidase-conjugated-anti-mouse or rabbit or goat antibody (1:5000; Jackson ImmunoResearch Laboratories, West Grove, USA), detected using ECL Prime (GE Healthcare; Pittsburgh, PA), and observed using a ChemiDocXRS system (BIO-RAD, Hercules, CA). The band density was measured using Image Lab software (BIO-RAD). 2.4. Immunostaining Cultured cells and tissues were fixed with 4% paraformaldehyde at RT for 30 min or with cold-methanol at −30 °C for 30 min and treated with TBS containing 0.3% Triton X100 and 5% normal donkey serum. Primary antibodies were: pSTAT3 (1:100), STAT3 (1:100), ZO-1 (1:100), and Na+/K+-ATPase (1:100). After incubation, the samples were stained with Alexa Fluor −488, −568, or −647 conjugated antidonkey IgG secondary antibodies (Thermo Fisher), and counterstained with Hoechst 33342. The samples were observed under a confocal microscope (LSM710, Carl Zeiss, Jena, Germany) or a fluorescence microscope (Carl Zeiss).
2. Materials and methods 2.5. Cell culture 2.1. Human and mouse tissues The HCEC-B4G12 cell line (Valtink et al., 2008) and primary CECs (Hara et al., 2014) were maintained in DMEM supplemented with 10% FBS (Thermo Fisher Scientific), 2 ng/ml bFGF, 100 U/ml penicillin, and 100 μg/ml streptomycin (Thermo Fisher Scientific) on cell culture plates or inserts coated with 100 ng/cm2 Laminin-511E8 (Nippi Inc, Tokyo, Japan). For ex vivo experiments, the tissue was cultivated in a serum-free medium containing DMEM:nutrient mixture F-12, 10% knockout serum-replacement, insulin-transferrin-selenium (Thermo Fisher Scientific), 4 ng/ml bFGF, 10 ng/ml LIF, 100 U/ml penicillin, and 100 μg/ml streptomycin (Liu et al., 2015). Human corneal endothelial progenitor cells (CEPs) were cultured in serum-free medium according to a previous report (Hara et al., 2014). After 2 days, the conditioned medium (CM) was collected in a conical tube, centrifuged at 3000×g for 10 min and stored at −80 °C. For the STAT3 phosphorylation assay, cells were provided with new medium 2 h prior to the assay, treated with the respective cytokine, and the reaction was stopped using the Laemmli sample buffer. For neutralization of LIF protein, samples were treated with anti-LIF antibody for 2 h at RT.
Human corneas were obtained from the SightLife of US eye bank, and were handled in accordance with the tenets of the Declaration of Helsinki. Normal ICR mice and pregnant ICR mice were obtained from Japan SLC, Inc. The animals were cared for in accordance with the Association for Research in Vision and Ophthalmology (ARVO). The Institutional Animal Care and Use Committee of Osaka University approved this study (#25-096-002). All animal experiments were performed according to the protocol approved by the committee. 2.2. Chemicals, cytokines, and antibodies Stattic (STAT3 inhibitory compound) was purchased from Millipore Sigma (Darmstadt, Germany). Basic fibroblast growth factor (bFGF) and epidermal growth factor (EGF) were purchased from FUJIFILM Wako Pure Chemical Co, (Osaka, Japan). Leukemia Inhibitory Factor (LIF), IL6, ciliary neurotrophic factor (CNTF), TNF-α, IFN-γ, bone morphogenetic protein (BMP)-2, BMP-7, TGF-β1, TGF-β2, Wnt3a, dickkopf1 (DKK1), nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3), platelet-derived growth factor (PDGF), and vascular endothelial growth factor (VEGF) were purchased from R& D Systems (Minneapolis, MN). Anti-pSTAT3 (rabbit polyclonal) and
2.6. Trans-endothelial electronic resistance (TEER) B4G12-HCECs were cultured in a 6-well insert (BD). TEER was measured in the confluent cell culture either in the presence or absence 133
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 1. Localization of STAT3 in ocular tissues. (A) Immunoblotting of human corneal endothelial tissues. (B) In mouse development, pSTAT3 is not expressed in the periocular mesenchyme (PM) at E12.5. Expression of pSTAT3 and ZO-1 was localized in the corneal endothelium (CE) at E18.5 and in adult mouse eyes. The arrows indicate co-localization of pSTAT3 and ZO-1 proteins. (C–H): Immunostaining of pSTAT3 in human ocular tissues. pSTAT3 was distributed to the corneal endothelium (C–D), but not to the trabecular meshwork (E), corneal stroma (F), sclera (G), and corneal epithelium (H). Immunostaining with isotype controls was performed as a control in the corneal endothelium (I), TM (J), and Sclera (K). Hoechst 33342 (Hoechst) was used as a counterstaining reagent. Scale bar: 20 μm. CS, LV, TZ, and CE indicate corneal stroma, lens vehicle, transition zone, and corneal endothelium, respectively.
primer: 5′- taccgtcgactgcagGGAGGGAATTCAACTCGGACAAA -3′, SOCS3 forward primer: 5′- cgagctcaagcttcgGCTCCACACTCGCGTCAGG GTTG -3′, and SOCS3 reverse primer: 5′- taccgtcgactgcagCGGAGCAG GGAGTCCAAGTCGGA -3′. The lower-case letters in the primers indicate the homologous sequences used for vector construction. In order to generate a luciferase stable cell line, the HCEC-B4G12 cells (DSMZ, Braunschweig, Germany) were transfected using Lipofectamine 3000 reagent (Thermo Fisher Scientific) according to a standard protocol. After 2 days, the cells were subjected to medium containing 50–100 μg/ ml G418 for 2–4 weeks. The cells with LIF and/or Stattic were grown to confluence prior to performing the luciferase assay with Ready-To-Glo secreted luciferase reporter assay kit (Takara Bio). Luminescence was measured using the ARVO X4 system (Perkin Elmer).
of a STAT3 inhibitor using EVOM2 (WPI, Sarasota, USA). 2.7. TUNEL TUNEL assay was performed to assess apoptosis using an in situ cell death detection kit (Millipore Sigma), following the manufacturer's instructions. Image and data analyses were performed using Operetta (Perkin–Elmer, Hamburg, Germany). 2.8. Luciferase assay The promoter region of human ZO-1 and SOCS3 was sub-cloned in pMetLuc-Basic vector (Takara Bio, Shiga, Japan) using the In-Fusion cloning kit (Takara Bio). The primers used are: ZO-1 forward primer: 5′cgagctcaagcttcgGCAGCTTGACCCGTTCGGTCAAC -3′, ZO-1 reverse 134
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 2. Inhibition by pSTAT3 inhibitor in the CECs. (A): pSTAT3 inhibitor (pSTAT3i), 10 μM stattic-treated human corneal endothelial tissues ex vivo were blocked from expressing pSTAT3 and ZO-1 for 2 days, but not Na+/K+ATPase. (B): HCEC-B4G12 cell line also showed decreased pSTAT3 levels when treated with pSTAT3 inhibitor. (C): Immunostaining images for pSTAT3 in 5 μM pSTAT3itreated HCEC-B4G12 cells and vehicle-control cells. (D): Immunoblotting images f pSTAT3, total STAT3, ZO-1, and Na/K-ATPase with pSTAT3 inhibitor in HCEC-B4G12 cells. Actin (beta-actin) was used as a loading control in the immunoblot analysis. Trans-endothelial electric resistance (TEER, E) and cell viability (F) of HCEC-B4G12 cells was decreased with the addition of pSTAT3 inhibitor (n = 4) in a dose-dependent manner. (G): B4G12-HCEC cells showed increased apoptosis by the pSTAT3 inhibitor (n = 4) as seen in the TUNEL assay. Dimethyl sulfoxide (DMSO) was used as a solvent (control) for the pSTAT3 inhibitor studies. The data are shown as mean ± SD, *p < 0.05, **p < 0.01 and ***p < 0.001. Scale bars: 20 μm (A), 200 μm (B).
used to perform qPCR with TaqMan FAST master mix on a QuantStudio 12K Flex real-time PCR system (Thermo Fisher). TaqMan probes were purchased from Thermo Fisher (STAT3: Hs01047580_m1, ZO-1: Hs00268480_m1, Na+/K+-ATPase: Hs00167556_m1, and GAPDH: Hs99999905_m1).
2.9. Chromatin immunoprecipitation (ChIP)- quantitative-PCR (qPCR) ChIP was carried out using a SimpleChIP chromatin IP kit (Cell signaling technology, Beverly, MA) according to the manufacturer's protocol. Cells were treated with or without 10 mM stattic and 10 ng/ ml LIF for 120 min. Formaldehyde (final concentration of 1%) was added and incubated for 10 min prior to quenching with glycine solution. DNA-protein fragments were prepared using an ultrasonicator (Covaris Inc., Massachusetts, USA) and were incubated overnight with anti-STAT3 antibody and control IgG at 4 °C following which Protein G conjugated magnetic beads were added. Effects of STAT3 on target genes was assessed by qPCR using the specific primers (ZO-1-forward primer: 5′- GGGAAGTTACGTGGCGAAG -3′, ZO-1-reverse primer: 5′GGGAATTCAACTCGGACAAA -3′, SOCS3-forward primer: 5′- GCTGCG AGTAGTGACTAAAC -3′, SOCS3- reverse: 5′- CAGGGAGTCCAAGTC GGA -3′) and SYBR Premix DimerEraser (Takara Bio).
2.11. Statistical analysis The data are shown as mean ± SD and were analyzed using Spearman's rank correlation coefficient or paired t-test. All statistical analyses were performed using JMP Pro 14.0.0 software (SAS Institute Japan, Tokyo, Japan). A p value less than 0.05 was considered statistically significant. 3. Results
2.10. Reverse transcription PCR and qPCR
3.1. Expression of phosphorylated STAT3 (pSTAT3) and corneal endothelial functional marker in ocular tissues
The cDNA of the human corneal endothelial tissue samples was prepared as previously reported by Yoshihara et al., 2015, 2017 was
Despite STAT3 being an immunologically important transcriptional regulator, its analysis in corneal endothelium is inadequate. Therefore, 135
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
we first investigated the expression of pSTAT3 and ZO-1, an important CEC functional marker. Based on immunoblotting results, we observed localization of pSTAT3 in the corneal endothelium (Fig. 1A). The corneal endothelium is derived through the periocular mesenchyme through the neural crest (Bahn et al., 1984). We also confirmed pSTAT3 and ZO-1 expression in a series of mouse embryos and adult eyes by immunostaining. The expression of pSTAT3 was not evident at E12.5 in the periocular mesenchyme but was observed in the corneal endothelium from E18.5 to the adult eye tissue, which later matched with the expression of ZO-1 (Fig. 1B). Next, to test the localization of pSTAT3 and ZO-1 proteins in human sclerocorneal tissue, we studied their expression by whole-mount immunostaining experiments. The expression level of pSTAT3 was extremely high in CECs compared with that in the other anterior segments (Fig. 1C–D). Moreover, pSTAT3 shows nuclear localization. However, the pSTAT3 signal was clearly observed in the trabecular meshwork, corneal stroma, sclera, and corneal epithelium, but its subcellular localization was different (Fig. 1E–H). We confirmed the specificity of each antibody using isotype controls (Fig. 1I–K). These data suggested that pSTAT3 is highly expressed in CECs and has transcriptional activity.
from the immunoblotting studies (Fig. 3C). Stable induction of pSTAT3 was observed only with the addition of LIF. In contrast, upon addition of IFN-γ, pSTAT3, and SOCS3 showed reduced the expression at 7 days. We then checked the viability of CECs after addition of these three cytokines via STAT3 signaling. The cell numbers in the high-dosage LIF treatment were lower compared to the untreated cells and those treated with a lower dose (Fig. 3D). This suggests that over-activation of pSTAT3 via inflammation may be toxic to CECs, even when the signal itself is necessary for survival. There was no significant difference in the number of cells when treated with IL-6 (Fig. 3D). Cells treated with IFNγ were also reduced dramatically and in a dose-dependent manner (Fig. 3D). These data revealed that cytokines including the inflammatory cytokines LIF, IL-6, and IFN-γ are involved in the pSTAT3 signaling of the corneal endothelium. 3.4. LIF and STAT3 in CECs The presence and roles of inflammatory cytokines IL-6 and IFN-γ in corneal endothelium is well-known (Lahdou et al., 2014; Sagoo et al., 2004; Yagi-Yaguchi et al., 2017a). Specifically, one study reported the involvement of LIF in the proliferation of CECs in serum-free medium, acting through the JAK-STAT3 pathway (Liu et al., 2015). However, STAT3 signaling via LIF in a physiologically steady-state of CECs is unknown. We focused on the LIF protein as a cytokine for the activation of STAT3. CECs might be exposed to inflammatory signaling both from the basal (corneal stromal side) and apical (aqueous humor side) sides. As the CEC faces the anterior chamber on its apical side for maintaining ACAID, the signal from the apical side might be important. To determine whether LIF stimulated the pSTAT3 signal from the apical or basal side, the cell culture insert system was used (Fig. 4A). LIF was added to the cells on the apical and basal side of the insert. We observed increased expression of pSTAT3 via stimulation of both apical and basal sides in a dose-dependent manner with LIF (Fig. 4B), but such effects could be neutralized with an anti-LIF antibody (Fig. 4C). In transcriptome analysis by Cap analysis of gene expression in corneal endothelial tissue, CECs and CEPs revealed LIF expression (Yoshihara et al., 2017). To further examine the autocrine secretion of LIF from primary CECs and CEPs, we collected the conditioned media (CM) of CECs and CEPs. We found that pSTAT3 levels in cells with CEC-CM and CEP-CM were dramatically reduced by the addition of an anti-LIF neutralizing antibody compared to that with control IgG (Fig. 4D and E). These data suggest that STAT3 may be activated by LIF molecules secreted from the anterior chamber and the corneal endothelium itself.
3.2. Inhibition of STAT3 signal in CECs STAT3 signaling may be important for many functions in CECs. We examined two important functional markers of CECs, ZO-1 and Na+/ K+-ATPase. ZO-1 is a key component of the tight-junction barrier function protecting CECs, whereas Na+/K+-ATPase is a key component of the pump function under the suppression of STAT3 signaling. The pSTAT3 inhibitor, static, disrupted both ZO-1 localization and expression, but had no effect on Na+/K+-ATPase expression (Fig. 2A). For further confirmation, we used the HCEC-B4G12 cell line expressing the corneal endothelial function markers, ZO-1 and Na+/K+-ATPase. These cells died in a dose-dependent manner upon adding the inhibitor (Fig. 2B). Furthermore, a decrease in the nuclear localization of pSTAT3 was observed by the inhibitor using immunostaining studies (Fig. 2C). Expression of ZO-1 in the pSTAT3 inhibitor-treated CEC cell line was also remarkably decreased in a dose dependent manner, but did not alter the expression levels of Na+/K+-ATPase (Fig. 2D). These immunohistological results indicate that STAT3 signaling is important for the barrier function. Functional analysis by TEER also confirmed this hypothesis. Suppression of pSTAT3 significantly reduced the barrier function in a dose dependent manner (Fig. 2E). Moreover, suppression of pSTAT3 affects the survival of CECs (Fig. 2F). TUNEL analysis showed that the cell number reduction by pSTAT3 inhibitor was due to apoptosis of CECs (Fig. 2G). We also used another STAT3 inhibitor (WP1066), and found reduced ZO-1 expression and cell survival of CECs (Supplementary Fig. 1A-D). Collectively, these data indicate that STAT3 signaling is essential for the barrier function and survival of CECs.
3.5. Regulation of ZO-1 and SOCS3 by STAT3 As the DNA binding motif of STAT3 is known (Wang et al., 2015), we identified and characterized the binding motif of STAT3 in the promoter region of ZO-1 (TJP1) and SOCS3 by performing ChIP-qPCR and luciferase assays. The expression of ZO-1 was decreased when treated with Stattic but was increased with the addition of high concentrations of LIF (Fig. 5A–C). However, the activity of the ZO-1 promoter in cells treated with stattic was increased and showed LIF-dosedependency (Fig. 5A–C). These findings suggest that the expression of ZO-1 and SOCS3 was directly regulated by STAT3 activation of in the CECs.
3.3. Moderator of STAT3 signaling To determine the candidate cytokines that moderate STAT3, we analyzed pSTAT3 levels in HCEC-B4G12 cells using immunoblotting. We found that cytokines of the IL-6 family, LIF, IL-6, and IFN-γ increased the levels of pSTAT3 in CECs (Fig. 3A). Activation of STAT3 in various tissues through these inflammatory cytokines has been reported, but the involvement of these cytokines and STAT3 in CECs during inflammation is still not known. Induction peaks of pSTAT3 due to these three cytokines were observed at 30 min intervals (Fig. 3B) Interestingly, the level of pSTAT3 induced by IFN-γ began to decline after 4 h. Incubation with LIF for 7 days increased the expression of ZO1 and SOCS3 (2.1- and 1.7-fold, relative ratio of ZO-1/Actin and SOCS3/Actin, control cells vs 50 ng/ml LIF-treated cells, respectively), whereas IL-6 and IFN-γ decreased the levels of ZO-1 protein as evident
3.6. STAT3 and corneal endothelial function markers in human CECs tissue Our results suggest a correlation between STAT3 and CEC function via ZO-1 expression. To investigate the relationship between corneal endothelial function markers and STAT3, we examined the gene expression in human corneal endothelial tissue using quantitative PCR. The donor details applicable to the expression analysis in human corneal endothelial tissues are as follows: 23 eyes from 16 donors; donors’ age, 68.6 ± 11.6 years. The expression levels of STAT3 were 136
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 3. Activator of STAT3 in CECs. (A): Immunoblotting data of pSTAT3 and STAT3 with various cytokines (concentration: 10 ng/ml) for 30 min in HCECB4G12 cells. Actin (beta-actin) was used as a loading control. (B): Time course analysis of STAT3 activation with LIF, IL-6, and IFN-γ. (C): Immunoblot image of pSTAT3, ZO-1, and SOCS3 in a dose-dependent manner with LIF, IL-6, and IFN-γ treatment for 7 days. (D): Number of cytokine-treated cells after 7 days (n = 4). The data are shown as mean ± SD and *p < 0.05, ***p < 0.001. Scale bar: 100 μm (A).
significantly correlated with those of ZO-1, but not those of Na+/K+ATPase (Fig. 6A–B). We found an approximately 4-fold increase in STAT3 expression in each human corneal endothelial tissue. Furthermore, the expression of STAT3 and ZO-1 showed a positive correlation in human corneal endothelial tissue. There was no significant correlation between these genes and age (ZO-1 vs. age: p = 0.5951, ATP1A1 vs. age: p = 0.1460 and STAT3 vs. age: p = 0.2052). This suggests the roles of STAT3 signaling in controlling CEC function in vivo.
4. Discussion We identified that cytokines LIF, IL-6, and IFN-γ activate STAT3 in CECs; the effects of IL-6 and IFN-γ on the corneal endothelium have been previously reported. IFN-γ induces apoptosis through nitric oxideinduced activation of NF-κB, p38, and STAT1 in CECs (Lahdou et al., 2014; Sagoo et al., 2004). Yagi-Yaguchi and colleagues reported the increase of IL-6 in the aqueous humor to be negatively correlated with 137
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
Fig. 4. LIF is expressed by CECs and activates the STAT3 protein as an autocrine factor. (A): Corneal endothelial model of the culture insert system. (apical side: anterior chamber, basal side: corneal stroma side). (B): Immunoblot images of cells treated with 0.1–10 ng/ml LIF on each side for 30 min. STAT3 is phosphorylated on both the apical and basal sides in a dose-dependent manner with LIF. (C): Neutralization of LIF (C), CECs-CM (D) and CEPs-CM (E) using an anti-LIF antibody decreased the pSTAT3 expression levels.
Fig. 5. Transcriptional regulation of ZO-1 and SOCS3 gene by pSTAT3. (A, D): Schema of human ZO-1 and SOCS3 gene. The asterisks in the figure highlight the candidate STAT3 binding motif. (B, E): ChIP-qPCR of HCEC-B4G12 cells with or without 5 μM stattic (pSTAT3i) and 10 ng/ml LIF for 2 h (C, F): Promoter analysis using luciferase activity. The cells were incubated with LIF with or without pSTAT3i for 24 h, and the luciferase assay was performed (n = 4). The data are shown as mean ± SD and *p < 0.05. 138
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
A
B Relative expression Na+/K+-ATPase (ATP1A1)
Relative expression ZO-1 (TJP1)
10 8 6 4 2 0
r = 0.6344 P = 0.0011 0
0.5
1
1.5
Relative expression STAT3
2
Fig. 6. Expression of STAT3 and corneal endothelial marker in human CECs in vivo. Expression data by quantitative PCR in human corneal endothelial tissues. Graphs show the relationship between the expression levels of STAT3 mRNA and corneal endothelial functional marker genes, ZO-1 (A) and Na+/K+-ATPase (B) (n = 23). r: correlation coefficient, P: Spearman's rank correlation coefficient.
30 25 20 15
10
r = 0.3340 P = 0.1193
5 0
0
0.5
1
1.5
2
Relative expression STAT3
Although the LIF-STAT3 signaling pathway is widely known in various cells including stem cells (Cartwright et al., 2005), we also found that the transcriptional activities of ZO-1 and SOCS3 genes are enhanced through the LIF-STAT3 pathway in CECs. STAT3 activation through LIF increased the expression of ZO-1 proteins in a dose-dependent manner, but the survival rate of CECs was gradually decreased. Furthermore, suppression of the LIF-STAT3 signaling pathway also reduced cell viability. We found that excessive activation of STAT3 through LIF reduced the CEC density and thus, maintenance of an optimal LIF concentration is vital to maintain corneal endothelial homeostasis. Interestingly, these data suggest that STAT3 activation is regulated by the autocrine system via LIF secretion from the CECs, and that the corneal endothelial barrier function and survival were possible through the LIF-STAT3 signaling pathway. We demonstrated that LIF was present in the CEC-CM as well as in the CEP-CM and activated the STAT3 proteins in the CECs. Furthermore, the expression of ZO-1 and pSTAT3 co-localized at the corneal endothelium during the late ocular developmental stage (E18.5) of mouse embryos. The barrier function of CECs may thus be formed at the late stage of corneal endothelial development and become immune privileged at the time. Thus, pSTAT3 may be a necessary transcription factor upon commitment to the phenotype of the corneal endothelium. Although we were unable to identify the cytokines involved in STAT3 activation in vivo, these data suggest that LIF is an autocrine factor and may regulate the differentiation of corneal endothelium by activating the LIF-STAT3 signaling pathway and inducing ZO-1 expression. To date, there have been several reports of immune privilege in corneal tissues (Niederkorn, 2003; Streilein, 2003), and its underlying mechanism is being understood. TGF-β, an immunosuppressive molecule is abundantly present in the eye and is known to be involved in immune privilege (Green and Ferguson, 2001; Ohta et al., 2000), but activation of STAT3 through TGF-β has not been observed. Here, we showed the potential of STAT3 as one of the key immune factors via barrier function through LIF in the CECs. The concentration of proinflammatory cytokines in human aqueous humor has been studied using multiplex cytokine analysis (Curnow et al., 2005; Takai et al., 2012; Yagi-Yaguchi et al., 2017a; Yamaguchi et al., 2016), although very few reports focus on LIF. Recently, cell-based therapy using cultured human CECs with a rho-associated protein kinase (ROCK) inhibitor was reported in the regenerative medicine of human CECs (Kinoshita et al., 2018). The ROCK inhibitors show an effect of suppressing inflammation and inhibition of infiltration of macrophages in the ocular tissues (Nourinia et al., 2017; Uchida et al., 2017). Several studies have also reported that STAT3 modulates phosphorylation by the ROCK inhibitor (Lingor et al., 2008; Pernet et al., 2013). It is thus necessary to further analyze the immune privilege mechanism in CECs via STAT3 and ROCK. In the future, identifying the molecular regulation of immune
corneal endothelial cell density (Yagi-Yaguchi et al., 2017a). A few reports on the transcription factor STAT3 in each corneal layer are available (Nakamura et al., 2014; Yang et al., 2012). Activation of STAT3 in corneal epithelial cells reproduces the pathological phenotypes in the corneal epithelium of Lrig1-knockout mouse (Nakamura et al., 2014). In the corneal stroma, activation of STAT3 by IFN-γ in human keratocytes and the expression of indoleamine 2,3-dioxygenase are remarkably enhanced; consequently, the inflammatory response may be enhanced (Yang et al., 2012). Even though STAT3 in CECs is known to be a growth marker of cultured CECs (Liu et al., 2015), its effect on the steady-state in CECs is not clear. Here, we demonstrate that through regulation of STAT3 expression levels it is possible to control the corneal endothelial barrier function through ZO1 and the survival of CECs. In terms of immune privilege, the corneal endothelium is known to have higher immune tolerance among all corneal tissues (Hori et al., 2007). Although the corneal endothelium is activated in the steady-state, corneal epithelial cells and keratocytes show very little activation of STAT3 in normal corneas. These cells may induce an immune response through STAT3 activation. Our findings suggest that STAT3 may be one of the transcriptional factors playing a role in the immune privilege in corneal endothelium. We demonstrated that the transcriptional factor STAT3 is involved in the barrier function and cell survival in the corneal endothelium. Promoter analysis using ChIP and luciferase assay showed that ZO-1 proteins are transcriptionally regulated by the direct binding of STAT3 to the regions upstream of these genes. Interestingly, activation of STAT3 is also implicated in the transcriptional regulation of ZO-1 in intestinal epithelial cells and in defense during gastrointestinal infections (Wang et al., 2015; Wittkopf et al., 2015). Intestinal epithelial cells show immune tolerance from oral intake of antigens (Peterson and Artis, 2014). Hence, intestinal epithelial cells and CECs may protect tissues by a common regulatory mechanism of immune tolerance through the barrier function via STAT3 activation. Chen and colleagues analyzed the transcriptome data of fetal and adult corneal endothelial cells (Chen et al., 2013), and found that the expression levels of STAT3 and ZO-1 in adult CECs are higher when compared to those in fetal CECs. We have also previously succeeded in identifying a few comprehensive human corneal endothelium-specific transcription factors based on transcriptome analysis (Yoshihara et al., 2017). In this study, we found that STAT3 was correlated with ZO-1 by gene expression analysis. The amounts of pSTAT3 depend on the expression level of STAT3 in CECs. In fact, STAT3 has been reported to enhance its own transcription activity (He et al., 2005; Onishi and Zandstra, 2015), and may perhaps be controlling the expression of ZO-1 in CECs in the steady state. There is no report describing the expression of transcription factors and corneal endothelial function markers of human corneal endothelial tissue and this is the first report clarifying the relationship between ZO-1 and STAT3. 139
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
privilege in the corneal endothelium involving STAT3 signaling may be important to improve the prognosis of corneal endothelial transplantation and regenerative medicine. In conclusion, inhibition of pSTAT3 significantly decreased the expression of the ZO-1 protein and the cell viability in CECs. pSTAT3 was increased in the presence of LIF, IL-6, and IFN-γ. Regulation of the STAT3 pathway is thus essential for corneal endothelial homeostasis via barrier function and may be protected from various inflammatory factors.
Vis. Sci. 46, 4251–4259. Dejana, E., 2004. Endothelial cell-cell junctions: happy together. Nat. Rev. Mol. Cell Biol. 5, 261–270. Goldich, Y., Showail, M., Avni-Zauberman, N., Perez, M., Ulate, R., Elbaz, U., Rootman, D.S., 2015. Contralateral eye comparison of descemet membrane endothelial keratoplasty and descemet stripping automated endothelial keratoplasty. Am. J. Ophthalmol. 159, 155–159 e151. Green, D.R., Ferguson, T.A., 2001. The role of Fas ligand in immune privilege. Nat. Rev. Mol. Cell Biol. 2, 917–924. Hamacher, J., Hadizamani, Y., Borgmann, M., Mohaupt, M., Mannel, D.N., Moehrlen, U., Lucas, R., Stammberger, U., 2017. Cytokine-ion channel interactions in pulmonary inflammation. Front. Immunol. 8, 1644. Hamzaoglu, E.C., Straiko, M.D., Mayko, Z.M., Sales, C.S., Terry, M.A., 2015. The first 100 eyes of standardized descemet stripping automated endothelial keratoplasty versus standardized descemet membrane endothelial keratoplasty. Ophthalmology 122, 2193–2199. Hara, S., Arawaka, S., Sato, H., Machiya, Y., Cui, C., Sasaki, A., Koyama, S., Kato, T., 2013. Serine 129 phosphorylation of membrane-associated alpha-synuclein modulates dopamine transporter function in a G protein-coupled receptor kinase-dependent manner. Mol. Biol. Cell 24, 1649–1660 S1641-1643. Hara, S., Hayashi, R., Soma, T., Kageyama, T., Duncan, T., Tsujikawa, M., Nishida, K., 2014. Identification and potential application of human corneal endothelial progenitor cells. Stem Cell. Dev. 23, 2190–2201. He, F., Ge, W., Martinowich, K., Becker-Catania, S., Coskun, V., Zhu, W., Wu, H., Castro, D., Guillemot, F., Fan, G., de Vellis, J., Sun, Y.E., 2005. A positive autoregulatory loop of Jak-STAT signaling controls the onset of astrogliogenesis. Nat. Neurosci. 8, 616–625. Hori, J., Joyce, N.C., Streilein, J.W., 2007. Immune privilege and immunogenicity reside among different layers of the mouse cornea. 2000. Ocul. Immunol. Inflamm. 15, 225–239. Kinoshita, S., Koizumi, N., Ueno, M., Okumura, N., Imai, K., Tanaka, H., Yamamoto, Y., Nakamura, T., Inatomi, T., Bush, J., Toda, M., Hagiya, M., Yokota, I., Teramukai, S., Sotozono, C., Hamuro, J., 2018. Injection of cultured cells with a ROCK inhibitor for bullous keratopathy. N. Engl. J. Med. 378, 995–1003. Lahdou, I., Engler, C., Mehrle, S., Daniel, V., Sadeghi, M., Opelz, G., Terness, P., 2014. Role of human corneal endothelial cells in T-cell-mediated alloimmune attack in vitro. Invest. Ophthalmol. Vis. Sci. 55, 1213–1221. Lingor, P., Tonges, L., Pieper, N., Bermel, C., Barski, E., Planchamp, V., Bahr, M., 2008. ROCK inhibition and CNTF interact on intrinsic signalling pathways and differentially regulate survival and regeneration in retinal ganglion cells. Brain 131, 250–263. Liu, X., Tseng, S.C., Zhang, M.C., Chen, S.Y., Tighe, S., Lu, W.J., Zhu, Y.T., 2015. LIFJAK1-STAT3 signaling delays contact inhibition of human corneal endothelial cells. Cell Cycle 14, 1197–1206. Maurice, D.M., 1972. The location of the fluid pump in the cornea. J. Physiol. 221, 43–54. Murray, P.J., 2007. The JAK-STAT signaling pathway: input and output integration. J. Immunol. 178, 2623–2629. Nakamura, T., Hamuro, J., Takaishi, M., Simmons, S., Maruyama, K., Zaffalon, A., Bentley, A.J., Kawasaki, S., Nagata-Takaoka, M., Fullwood, N.J., Itami, S., Sano, S., Ishii, M., Barrandon, Y., Kinoshita, S., 2014. LRIG1 inhibits STAT3-dependent inflammation to maintain corneal homeostasis. J. Clin. Invest. 124, 385–397. Niederkorn, J.Y., 2003. The immune privilege of corneal grafts. J. Leukoc. Biol. 74, 167–171. Nourinia, R., Nakao, S., Zandi, S., Safi, S., Hafezi-Moghadam, A., Ahmadieh, H., 2017. ROCK inhibitors for the treatment of ocular diseases. Br. J. Ophthalmol (in press). Ohta, K., Yamagami, S., Taylor, A.W., Streilein, J.W., 2000. IL-6 antagonizes TGF-beta and abolishes immune privilege in eyes with endotoxin-induced uveitis. Invest. Ophthalmol. Vis. Sci. 41, 2591–2599. Okumura, N., Ueno, M., Koizumi, N., Sakamoto, Y., Hirata, K., Hamuro, J., Kinoshita, S., 2009. Enhancement on primate corneal endothelial cell survival in vitro by a ROCK inhibitor. Invest. Ophthalmol. Vis. Sci. 50, 3680–3687. Onishi, K., Zandstra, P.W., 2015. LIF signaling in stem cells and development. Development 142, 2230–2236. Pernet, V., Joly, S., Jordi, N., Dalkara, D., Guzik-Kornacka, A., Flannery, J.G., Schwab, M.E., 2013. Misguidance and modulation of axonal regeneration by Stat3 and Rho/ ROCK signaling in the transparent optic nerve. Cell Death Dis. 4, e734. Peterson, L.W., Artis, D., 2014. Intestinal epithelial cells: regulators of barrier function and immune homeostasis. Nat. Rev. Immunol. 14, 141–153. Rajashekhar, G., Shivanna, M., Kompella, U.B., Wang, Y., Srinivas, S.P., 2014. Role of MMP-9 in the breakdown of barrier integrity of the corneal endothelium in response to TNF-alpha. Exp. Eye Res. 122, 77–85. Sagoo, P., Chan, G.L., Larkin, D.F.R., George, A.J.T., 2004. Inflammatory cytokines induce apoptosis of corneal endothelium through nitric oxide. Invest. Ophthalmol. Vis. Sci. 45, 3964–3973. Streilein, J.W., 2003. Ocular immune privilege: therapeutic opportunities from an experiment of nature. Nat. Rev. Immunol. 3, 879–889. Takai, Y., Tanito, M., Ohira, A., 2012. Multiplex cytokine analysis of aqueous humor in eyes with primary open-angle glaucoma, exfoliation glaucoma, and cataract. Invest. Ophthalmol. Vis. Sci. 53, 241–247. Uchida, T., Honjo, M., Yamagishi, R., Aihara, M., 2017. The anti-inflammatory effect of ripasudil (K-115), a rho kinase (ROCK) inhibitor, on endotoxin-induced uveitis in rats. Invest. Ophthalmol. Vis. Sci. 58, 5584–5593. Valtink, M., Gruschwitz, R., Funk, R.H.W., Engelmann, K., 2008. Two clonal cell lines of immortalized human corneal endothelial cells show either differentiated or precursor cell characteristics. Cells Tissues Organs 187, 286–294. Wang, Z., Li, R., Tan, J., Peng, L., Wang, P., Liu, J., Xiong, H., Jiang, B., Chen, Y., 2015. Syndecan-1 acts in synergy with tight junction through Stat3 signaling to maintain
Conflicts of interest No conflict of interest exists for any author. Funding source This work was supported by JSPS KAKENHI Grant Number JP 17K169680 and JP 17K11448. Acknowledgments We thank Ms. Yuka Takada for technical assistance and support. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.exer.2018.11.008. Abbreviations ACAID associated immune deviation BDNF brain-derived neurotrophic factor bFGF basic fibroblast growth factor BMP bone morphogenetic protein CECs corneal endothelial cells CEPs corneal endothelial progenitor cells ChIP Chromatin immunoprecipitation CM conditioned medium CNTF ciliary neurotrophic factor DKK1 dickkopf1 EGF epidermal growth factor Na+/K + -ATPase sodium/potassium ATPase NGF nerve growth factor NT-3 neurotrophin-3 PCR polymerase chain reaction PDGF platelet-derived growth factor pSTAT3 phosphorylated STAT3 pSTAT3i Phosphorylated STAT3 inhibitor qPCR quantitative-PCR ROCK rho-associated protein kinase TEER Trans-endothelial electronic resistance VEGF vascular endothelial growth factor ZO-1 zonula occludens-1 References Bahn, C.F., Falls, H.F., Varley, G.A., Meyer, R.F., Edelhauser, H.F., Bourne, W.M., 1984. Classification of corneal endothelial disorders based on neural crest origin. Ophthalmology 91, 558–563. Cartwright, P., McLean, C., Sheppard, A., Rivett, D., Jones, K., Dalton, S., 2005. LIF/ STAT3 controls ES cell self-renewal and pluripotency by a Myc-dependent mechanism. Development 132, 885–896. Chen, Y.Y., Huang, K., Nakatsu, M.N., Xue, Z.G., Deng, S.X., Fan, G.P., 2013. Identification of novel molecular markers through transcriptomic analysis in human fetal and adult corneal endothelial cells. Hum. Mol. Genet. 22, 1271–1279. Curnow, S.J., Falciani, F., Durrani, O.M., Cheung, C.M., Ross, E.J., Wloka, K., Rauz, S., Wallace, G.R., Salmon, M., Murray, P.I., 2005. Multiplex bead immunoassay analysis of aqueous humor reveals distinct cytokine profiles in uveitis. Invest. Ophthalmol.
140
Experimental Eye Research 179 (2019) 132–141
S. Hara et al.
bullous keratopathy and low endothelial cell density. Invest. Ophthalmol. Vis. Sci. 57, 5954–5962. Yang, J.W., Ham, D.S., Kim, H.W., Lee, S.G., Park, S.K., Seo, S.K., 2012. Expression of Stat3 and indoleamine 2, 3-dioxygenase in cornea keratocytes as factor of ocular immune privilege. Graefes Arch. Clin. Exp. Ophthalmol. 250, 25–31. Yazu, H., Yamaguchi, T., Aketa, N., Higa, K., Suzuki, T., Yagi-Yaguchi, Y., Satake, Y., Abe, T., Tsubota, K., Shimazaki, J., 2018. Preoperative aqueous cytokine levels are associated with endothelial cell loss after descemet's stripping automated endothelial keratoplasty. Invest. Ophthalmol. Vis. Sci. 59, 612–620. Yoshihara, M., Hara, S., Tsujikawa, M., Kawasaki, S., Hayashizaki, Y., Itoh, M., Kawaji, H., Nishida, K., 2017. Restricted presence of POU6F2 in human corneal endothelial cells uncovered by extension of the promoter-level expression atlas. EBioMedicine 25, 175–186. Yoshihara, M., Ohmiya, H., Hara, S., Kawasaki, S., Hayashizaki, Y., Itoh, M., Kawaji, H., Tsujikawa, M., Nishida, K., 2015. Discovery of molecular markers to discriminate corneal endothelial cells in the human body. PloS One 10, e0117581. Yu, H., Kortylewski, M., Pardoll, D., 2007. Crosstalk between cancer and immune cells: role of STAT3 in the tumour microenvironment. Nat. Rev. Immunol. 7, 41–51. Yu, H., Pardoll, D., Jove, R., 2009. STATs in cancer inflammation and immunity: a leading role for STAT3. Nat. Rev. Canc. 9, 798–809. Zhang, K., Pang, K., Wu, X., 2014. Isolation and transplantation of corneal endothelial cell-like cells derived from in-vitro-differentiated human embryonic stem cells. Stem Cell. Dev. 23, 1340–1354.
intestinal mucosal barrier and prevent bacterial translocation. Inflamm. Bowel Dis. 21, 1894–1907. Watanabe, R., Hayashi, R., Kimura, Y., Tanaka, Y., Kageyama, T., Hara, S., Tabata, Y., Nishida, K., 2011. A novel gelatin hydrogel Carrier sheet for corneal endothelial transplantation. Tissue Eng. 17, 2213–2219. Willott, E., Balda, M.S., Fanning, A.S., Jameson, B., Van Itallie, C., Anderson, J.M., 1993. The tight junction protein ZO-1 is homologous to the Drosophila discs-large tumor suppressor protein of septate junctions. Proc. Natl. Acad. Sci. U. S. A. 90, 7834–7838. Wittkopf, N., Pickert, G., Billmeier, U., Mahapatro, M., Wirtz, S., Martini, E., Leppkes, M., Neurath, M.F., Becker, C., 2015. Activation of intestinal epithelial Stat3 orchestrates tissue defense during gastrointestinal infection. PloS One 10, e0118401. Yagi-Yaguchi, Y., Yamaguchi, T., Higa, K., Suzuki, T., Aketa, N., Dogru, M., Satake, Y., Shimazaki, J., 2017a. Association between corneal endothelial cell densities and elevated cytokine levels in the aqueous humor. Sci. Rep.-Uk 7. Yagi-Yaguchi, Y., Yamaguchi, T., Higa, K., Suzuki, T., Yazu, H., Aketa, N., Satake, Y., Tsubota, K., Shimazaki, J., 2017b. Preoperative aqueous cytokine levels are associated with a rapid reduction in endothelial cells after penetrating keratoplasty. Am. J. Ophthalmol. 181, 166–173. Yamagami, H., Yamagami, S., Inoki, T., Amano, S., Miyata, K., 2003. The effects of proinflammatory cytokines on cytokine-chemokine gene expression profiles in the human corneal endothelium. Invest. Ophthalmol. Vis. Sci. 44, 514–520. Yamaguchi, T., Higa, K., Suzuki, T., Nakayama, N., Yagi-Yaguchi, Y., Dogru, M., Satake, Y., Shimazaki, J., 2016. Elevated cytokine levels in the aqueous humor of eyes with
141