- Email: [email protected]
STAT3 signaling pathway
Biomedicine & Pharmacotherapy 125 (2020) 109922
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Quercetin promotes the survival of granulocytic myeloid-derived suppressor cells via the ESR2/STAT3 signaling pathway
T
Zhanchuan Maa,b,1, Yan Xiac,1, Cong Hua,b, Miaomiao Yua,b, Huanfa Yia,b,* a
Central Laboratory, The First Hospital of Jilin University, Changchun, Jilin, 130031, China Key Laboratory of Organ Regeneration and Transplantation, Ministry of Education, Changchun, Jilin, 130021, China c Department of Gastroenterology, The First Hospital of Jilin University, Changchun, Jilin 130021, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Quercetin Myeloid-derived suppressor cell Estrogen receptors Cell survival
Quercetin is a natural product that has been shown to induce tumor apoptosis and necrosis through multiple mechanisms. Tumor-induced myeloid-derived suppressor cell (MDSC) expansion negatively regulates the immune response by inhibiting T cell function through signal transducer and activator of transcription 3 (STAT3) activation, thereby facilitating tumor escape from host immune surveillance. Thus MDSC is an attractive target for cancer immunotherapy to enhance cytotoxic T cell responses. However, the effects of quercetin on MDSC are poorly understood. Here, we demonstrate that quercetin treatment enhanced mouse- and human- derived granulocytic-myeloid-derived suppressor cells (G-MDSC) survival and promoted the secretion of T cell-suppressive factors in vitro. Bioinformatics analysis further showed that quercetin was highly correlated with the estrogen receptor signaling pathway, which was confirmed by quantitative reverse transcription-polymerase chain reaction and flow cytometric analysis. These findings highlight the potential advantages and feasibility of quercetin in reinforcing the suppressive property of G-MDSC. Thus impact of G-MDSC should be taken into consideration when quercetin is applied to tumor therapy.
1. Introduction Cancer therapy remains an active research topic owing to the continuous rise in cancer diagnoses worldwide, imposing a heavy burden on society and a serious threat to human health [1]. Numerous studies have focused on immune-modulating cells during cancer development, which play key roles in regulating tumor progression and metabolism [2]. In this regard, myeloid-derived suppressor cells (MDSC) have recently attracted interest with respect to their capacity to modulate immune response in the tumor microenvironment [3–5], represe-nting a potential target for a new immunotherapy strategy in cancer treatment. MDSC is a population of immature myeloid cells that pathologically recruit and accumulate at inflammatory sites and in tumor, consequently modulating the immune response. MDSC represents a heterogeneous cell population consisting of subsets of the
precursor of neutrophils, monocytes, and dendritic cells that suppress T cell proliferation via different mechanisms [6]. In general, two subpopulations of MDSC are recognized in mice: CD11b+Gr-1+Ly6G+ granulocytic-myeloid-derived suppressor cells (G-MDSC) and CD11b+Gr-1+Ly6C+ monocytic-myeloid-derived suppressor cells (MMDSC), corresponding to human CD11b+HLA-DR-CD33+CD66b+ (or CD15+) and CD11b+HLA-DR-CD33+CD14+ cells, respectively [7–9]. MDSC mechanically suppresses the proliferation and function of T cells by secreting nitric oxide synthase 2 (NOS2), arginase-1 (Arg-1), and reactive oxygen species (ROS). NOS2 and ROS directly induce cell apoptosis and DNA damage to disturb the repair of damaged DNA [10–12]. Whereas Arg-1 catalyzes its substrate arginine into urea and Lornithine, which is crucial to CD3ζ chain synthesis [13]. Accumulation of MDSC in patients and tumor models impedes the clearance of tumor cells by blocking the function of cytotoxic T cells in cancer [3,14]. A high level of MDSC was also shown to promote tumor
Abbreviations: Arg-1, arginase-1; BM, bone marrow; CBMC, cord blood mononuclear cells; CD, database coremine database; CT, database comparative toxicogenomics database; E2, 17beta-estradiol; ESR, estrogen signaling receptor; G-MDSC, granulocyte myeloid-derived suppressor cell; MDSC, myeloid-derived suppressor cell; NOS2, nitric oxide synthase 2; M-MDSC, monocyte myeloid-derived suppressor cell; PM database, pharmmapper database; ROS, reactive oxygen species; SOD1, superoxide dismutase 1; STAT3, signal transducer and activator of transcription 3 ⁎ Corresponding author at: Central Laboratory, The First Hospital of Jilin University, Changchun, Jilin, 130031, China. E-mail address: [email protected] (H. Yi). 1 Equal contribution. https://doi.org/10.1016/j.biopha.2020.109922 Received 10 September 2019; Received in revised form 9 December 2019; Accepted 13 December 2019 0753-3322/ © 2020 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
properties of quercetin are as follows: MW, AlogP, TPSA, Hdon, and Hacc (Lipinski’s rule of five) of 302.238, 1.50, 131.36, 5, and 7, respectively; oral bioavailability, 46.43 %; drug-likeness, 0.28; Cacao-2 cell permeability, 0.05; blood-brain barrier permeability, -0.77; RBN, 1; and HL, 14.40, as reported in the Traditional Chinese Medicine Systems Pharmacology database (http://lsp.nwu.edu.cn/index.php). 2.2. Potential targets prediction Comparative toxicogenomics database (CTD, http://ctdbase.org/), coremine database (CD, http://www.coremine.com/medical/#search) and pharmmapper database (PD, http://lilab.ecust.edu.cn/ pharmmapper/) was used to study interaction between target molecules and potential proteins. Predicted genes will be automatically listed and ordered by correlation coefficient. Top 10 potential target genes were screened by Venn diagram (http://bioinformatics.psb. ugent.be/webtools/Venn/) to solidify reliability of the analysis results.
Fig. 1. Chemical structure of quercetin. Chemical structure of quercetin was downloaded from the PubChem database CID:5280343.
2.3. GO and pathway analysis
angiogenesis to facilitate tumor growth [2]. Therefore, targeting MDSC has emerged as a potential strategy to inhibit tumor progression and prolong the survival of cancer patients [15,16]. Toward this end, it is necessary to identify or develop a compound that can safely and effectively target MDSC and the factors that influence their survival and proliferation. Natural products extracted from the stems, seeds, and leaves of plants, or from animals and microorganisms have multiple pharmacological and biological activities [17], and have been used to develop cancer chemotherapy for decades [18]. Quercetin widely exists in natural substances like fruits, leaves, seeds of plants that facilitate in antitumor studies [19–21]. The two-dimensional structure of quercetin is shown in Fig. 1. The potent cytotoxic properties of natural products have contributed to treatment for solid tumors and leukemia [18,22]. Quercetin inhibited phosphatidylinositol 3-kinase (PI3K)/Akt phosphorylation to induce the apoptosis of tumor cells [21,23,24]The protective role of quercetin has been proven in clinical trials [25,26], and shows anti-tumor properties [19–21]. However, the ability of quercetin to promote the proliferation or influence the secretion of suppressive factors of MDSC remains unclear. Therefore, in the present study, we evaluated the effect of quercetin treatment on the survival of MDSC and the underlying mechanism. To determine whether quercetin influences the survival of MDSC, myeloid cells were isolated from BM and spleen of mice or cord blood of parturient puerperae and treated with different concentrations of quercetin. To further analyze the mechanism underlying the established anti-tumor activity of quercetin, we conducted bioinformatics analysis of reported quercetin-regulated genes and the protein-protein interaction network of genes expressed under quercetin treatment in MDSC [26,27]. Since estradiol (E2) treatment was previously reported to activate ESR signaling in human and mouse-derived MDSC, and to promote the proliferation and enhance the suppressive properties of MDSC via STAT3 phosphorylation [28,29], we hypothesized that elevated ESR/pSTAT3 levels after quercetin stimulation may also improve the suppressive activity of MDSC, which was confirmed by in vitro experiments. These findings can offer a novel perspective for applications of quercetin in anti-tumor treatment, highlighting a bidirectional effect of quercetin in cancer therapy.
The Molecule Annotation System 3.0 (MAS 3.0), a web-based software toolkit, can be used to help understand relationships within gene expression data and provide systematic and visual information on the gene of interest. Potential targets were uploaded to the MAS 3.0 server (http://bioinfo.capitalbio.com/mas3/) following the online instructions, and GO and KEGG pathway information for related genes was generated and collected. For a deeper understanding of the complex relationships among compounds, targets and diseases, networks were constructed and analyzed by Cytoscape 3.0. Software. 2.4. Cell isolation Cord blood obtained from the First Hospital of Jilin University. Cord blood mononuclear cells (CBMC) were isolated by Ficoll–Hypaque gradient centrifugation. All the women with cesarean section at term signed the informed consent before cord blood collection, and all procedures in this study were approved by the ethics committee of the First Hospital of Jilin University. 6∼8 weeks male C57BL/6 mice maintained under specific pathogen-free (SPF) conditions. RM-1 cell lines were cultured in Dulbecco’s modified Eagle’s (Gibco) medium contains 10 % fetal bovine serum (Gibco), 100 U/ml penicillin and 100 ug/ml streptomycin in humidified 5 % CO2 incubators. RM1 cells (2 × 105 cells in 100 μl PBS) were injected subcutaneously in the flank of the C57BL/6 mouse. After two weeks spleen and bone marrow was obtained from tumor-bearing mice. Single cell suspensions of spleen and bone marrow were generated as described previously [30]. Briefly, BM was flushed by cold PBS from tibias and femurs of mice. Single cell suspension of BM and spleen was generated and passed through a 70 u M strainer after lysed red blood cells. Then CBMC, splenic cells and bone marrow cells suspended with 1640 medium contains 10 % fetal bovine serum (Gibco), 100 U/ml penicillin and 100ug/ml streptomycin. 2.5. Cell sorting To sort G-MDSC from mouse, 2 × 105 RM-1 cells were injected subcutaneously in the flank of the C57BL/6 mouse. After two weeks spleen was obtained from tumor-bearing mice. Single cell suspensions of spleen was generated and passed through a 70 u M strainer after lysed red blood cells. Anti-mouse CD11b apccy7 (M1/70, Biolegend), Ly 6C pecy7 (AL-21, Biolegend), Ly 6G FITC (RB6-8C5, Biolegend) antibodies were added to splenic cell suspension at 4℃ for 20 min, then washed twice with cold PBS. CD11b+Ly 6C-Ly 6G+ cells were sorted with not lower than 95 % purity for further study.
2. Materials and methods 2.1. Structure and basic properties of quercetin Structure and basic information of subunit of DSS was obtained from the web (https://pubchem.ncbi.nlm.nih.gov/). The basal 2
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 2. Quercetin facilitated BM CD11b+Gr-1+Ly6G+ cell maintenances. BM cells isolated from naive B6 mice and red blood cells were lysed. Different concentration of quercetin was added to BM cells for 48 h. Then CD11b+Gr-1+ cells were analyzed by flow cytometry. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. (A) Staining profiles of CD11b+Gr-1+ cells in BM after treated with vehicle or quercetin for 48 h. (B) Percentage of CD11b+Gr-1+ cells in BM after treated with vehicle or quercetin for 48 h. (C) Ly6C+ and Ly6G+ cells gated on CD11b+Gr-1+ cells were analyzed by flow cytometry. (D) Percentage of Ly6C+ and Ly6G+ cells gated on CD11b+Gr-1+ cells after treated with vehicle or quercetin for 48 h.
penicillin and 100ug/ml streptomycin. Cells were plated in 96 well plates and treated with quercetin (20 μM, 40 μM, 80 μM) for 24 h, 48 h or 72 h.
2.6. Drug treatment Quercetin was purchased from Shanghai Aladdin, dissolved with dimethylsulfoxide upon received. Stock solution (1 mM) stored aliquots at -80℃ under sterile conditions. 2 × 105 indicated cells were cultured in 1640 medium contains 10 % fetal bovine serum (Gibco), 100 U/ml 3
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 3. Quercetin enhanced mice derived MDSC survival. Splenic cells were obtained from tumor-bearing B6 mice and red blood cells were lysed. Cells were treated with vehicle or quercetin (80 μM) for 48 h. Then MDSC were stained (CD11b+Gr-1+) and analyzed by FCM. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. (A) Staining profiles of splenic MDSC from tumor-bearing B6 mice. (B) Percentage of splenic MDSC, with or without quercetin treatment. (C G-MDSC (CD11b+Gr-1+Ly6G+) gated on CD11b+Gr-1+ cells were analyzed by flow cytometry. (D) Percentage of splenic G-MDSC, with or without quercetin treatment.
4
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 4. Quercetin enhanced human derived MDSC survival. CBMC were obtained from women with cesarean section. Cells were treated with vehicle or quercetin (80 μM) for 48 h. Then MDSC were stained (CD11b+HLA-DR-) and analyzed by FCM. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. (A) Staining profiles of MDSC (CD11b+HLA-DR-) from CBMC. (B) Percentage of MDSC in CBMC, treated with vehicle or quercetin for 48 h. (C) Subpopulation of MDSC in CBMC was analyzed by FCM, gated on CD11b+HLA-DR- cells. (D) Percentage of M-MDSC (CD11b+HLA-DR-CD14+) and G-MDSC (CD11b+HLA-DR-CD66b+) in CBMC, treated with vehicle or quercetin for 48 h.
Biolegend), anti-mouse CD11b apccy7 (M1/70, Biolegend), Gr-1 percpcy5.5 (RB6-8C5, Biolegend), Ly 6C pecy7 (AL-21, Biolegend), Ly 6G FITC (RB6-8C5, Biolegend). Then cells were analyzed on a FACSAria II (BD Biosciences).
2.7. Flow cytometric analysis After treated with quercetin, cells were collected and fluorochromeconjugated mAbs were used to detect MDSC. Antibodies were listed as follow: anti-human HLA-DR PE (G46-6, BD), CD11b APC CY7 (ICRF44, BD), CD14 FITC (63D3, Biolegend), CD66b percpcy5.5 (G10F5,
5
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
2.8. Quantitative real-time PCR
3.3. Quercetin activated human-derived G-MDSC
Total RNA was extracted from cells stimulated with 40 u M quercetin for 48 h with Trizol (Invitrogen) regent. Then cDNA was synthesized using TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech). qRT-PCR was performed with an ABI StepOnePlus system (Applied Biosystems) with a SYBR Green Kit (TransGen Biotech). The expression level was normalized against the β-actin. Relative mRNA expression was calculated using the 2 −ΔΔCT method. The primer sequence sets used for NOS2, ESR2 and β-actin was listed as follows:
Next we focused on if quercetin could influence survival and function of human-derived MDSC. Cord blood was collected and CBMC was treated with different concentration of quercetin for 48 h. E2 was used as positive control, for powerful promote MDSC proliferation effect of E2 has been reported previously [28]. The percentage of cord bloodderived CD11b+HLA-DR- MDSC increased significantly after 48 h of treatment with quercetin compared with that of the vehicle control (Fig. 4A, B). Similar to the mouse results, quercetin promoted the survival of CD11b+HLA-DR-CD66b+ G-MDSC but not CD11b+HLA-DRCD14+ M-MDSC (Fig. 4C, D). These results suggested that quercetin likely activates a downstream signaling pathway of G-MDSC by binding to a specific receptor.
Primer name h/m-actin h-NOS2 h-ESR2 m-NOS2 m-ESR2
Primer sequence F:5’ TTCAACACCCCAGCCATG 3’ R:5’ CCTCGTAGATGGGCACAGT 3’ F:5’ TGGCCACCTTGTTCAGCTACG 3 R:5’ GCCAAGGCCAAACACAGCATAC 3’ F:5’ TCCATCGCCAGTTATCACATCT 3’ R:5’ CTGGACCAGTAACAGGGCTG 3’ F:5’ TGGCCACCTTGTTCAGCTACG 3’ R:5’ GCCAAGGCCAAACACAGCATAC 3’ F:5’ GTAGAGAGCCGTCACGAATACT 3’ R:5’ GGTTCTGCATAGAGAAGCGATG 3’
3.4. Identification of target genes stimulated by quercetin The complex interactions and relations between quercetin-associated genes has been a challenge in the research and application of quercetin along with other natural products [32]. Bioinformatics analysis is an effective method to study the biological function of natural products systematically. To determine the protein-protein interactions induced by quercetin in MDSC, we screened three databases (comparative toxicogenomics database, coremine database, pharmmapper database) to search for quercetin-related genes, which identified 4092, 1995, and 682 genes, respectively. Comparative toxicogenomics database and coremine database can predict potential genes and proteins associated with diseases or non-disease-term biological events, while PD emphasizes prediction of pharmacologically binding sites of drugs. The Venn diagram in Fig. 5A shows the 35 genes that overlap among the database indicating a strong influence by quercetin. We chose the top 10 genes (NOS2, CDK2, CSNK2A1, APAF1, INSR, AKT1, HSPA8, ESR1, ESR2, and MMP9) to construct protein-protein interaction networks of quercetin-related genes with Cytoscape software (Fig. 5B). Among these 10 genes, NOS2 and ESR are directly related to the suppressive function of MDSC; therefore, we further focused on these genes to understand the suppressive mechanism of quercetin.
2.9. Statistical analysis All data are shown as mean ± SD except for otherwise indicated. All experiments were performed three times. Significance was determined with Mann-Whitney U-test analysis. A P value of < 0.05 was considered significant. Statistical analyses were performed on GraphPad Prism 5.0 software. 3. Results 3.1. Quercetin promoted the survival of BM-derived CD11b+Gr-1+ Ly6G+cells Quercetin (20 μM, 40 μM, 80 μM) was added to BM-derived CD11b+Gr-1+ Ly6G+cells for 24 h, 48 h or 72 h. The results showed that percentage of target cells increased significantly after quercetin treatment. 80 μM quercetin treatment efficiently promoted survival of BM-derived CD11b+Gr-1+ Ly6G+cells (Figure S1 C). Unless otherwise specified, cells were treated with 80 μM quercetin for 48 h in following experiments. Quercetin enhanced the survival of CD11b + Gr-1+ cells in a concentration-dependent manner with 48-h stimulation (Fig. 2A, B). However, the percentage of CD11b+Gr-1+Ly6G+ cells increased after 48 h stimulation, whereas CD11b+Gr-1+Ly6C+ cells showed apoptosis after treatment (Fig. 2C, D), indicating that different signal pathways might be activated in the two subsets of cells in response to quercetin treatment.
3.5. Gene Ontology and pathway enrichment analysis Gene Ontology (GO) and pathway analysis identified the top 10 enrichment terms associated with quercetin treatment (Fig. 6A,B: peptidyl-serine phosphorylation GO:0018105, cellular response to insulin stimulus GO:0032869, positive regulation of transcription, DNAtemplate GO:0045893, signal transduction GO:0007165, and response to estrogen GO:0043627 were enriched biological processes associated with the quercetin-regulated genes; protein kinase activity GO:0004672, ATP binding GO:0005524, RNA polymerase II transcription factor activity, ligand-activated sequence-specific DNA binding GO:0004879, protein serine/threonine kinase activity GO:0004674, and kinase activity GO:0016301 were the enriched molecular functions Fig. 6A). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis showed that estrogen signaling pathway (hsa04915) was the most significantly enriched pathway among genes regulated by quercetin (Fig. 6B). Other significantly enriched pathways included VEGF signaling pathway (hsa04370), prolactin signaling pathway (hsa04917), HIF-1 signaling pathway (hsa04066), adherens junction (hsa04520), hepatitis B (hsa05161), progesterone-mediated oocyte maturation (hsa04914), tuberculosis (hsa05152), proteoglycans in cancer (hsa05205), and toxoplasmosis (hsa05145) (Fig. 6B).
3.2. Quercetin activated mouse-derived G-MDSC As CD11b+Gr-1+ immature cells isolated from the femur and tibia of naive mice are generally not defined as MDSC due to their lack of or only weak suppressive capacity [31], we induced splenic MDSC expansion by subcutaneous injection of prostate cancer RM-1 cells in the flanks of male C57BL/6 mouse. Results showed that the percentages of splenic MDSC from tumor-bearing mouse increased after treatment with different concentrations of quercetin in a dose-dependent manner (Fig. 3A, B). Flow cytometric analysis showed that percentage of CD11b+Gr-1+Ly6G+ G-MDSC expanded while CD11b+Gr-1+Ly6C+ M-MDSC immediately underwent apoptosis under exposure to quercetin (Fig. 3C, D). Thus, quercetin treatment enhanced the survival of G-MDSC in mouse.
3.6. Quercetin facilitated MDSC survival and function by activating ESR2 Given the results of the bioinformatic analysis, and previous findings show that quercetin promoted the growth of estrogen receptor6
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 5. Genomic feature of quercetin regulated proteins. (A) Venn diagram analysis of multiple genes from three databases. (B) PPI networks construction within quercetin regulation. The nodes represent chemical (ellipse) or genes (rectangle).
mouse, and then treated with quercetin for 48 h. The results showed that G-MDSC expressed high level of ESR2 after quercetin treatment (Fig. 7C). Since up-regulation of ESR2 expression was reported to activate STAT3 to improve the expansion and activation of MDSC during pregnancy [29], we detected the levels of phosphorylated STAT3 (pSTAT3) in human and mouse-derived MDSC after quercetin
positive cell lines through ESR [33], similar to the effects of E2 [28,29], we next investigated whether quercetin regulates MDSC via ESR. qRTPCR showed that quercetin treatment up-regulated the mRNA level of ESR2 in human-derived MDSC (Fig. 7A) and splenic cells from tumorbearing mouse (Fig. 7B). As ESR2 is not specifically expressed by GMDSC, G-MDSC were purified from splenic cells of tumor-bearing
Fig. 6. GO and pathway analysis of quercetin regulated genes. (A) GO enrichment analysis of genes regulated by quercetin. (B) KEGG pathway analysis of genes regulated by quercetin. 7
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 7. Quercetin enhanced MDSC suppressive function via activating ESR2/STAT3. Splenic cells and sorted G-MDSC from tumor-bearing mouse, or CBMC were cultured for 48 h, with or without quercetin treatment. Then cells were collected for qRTPCR assay or stained and analyzed by FCM. Gray, isotype; dotted, vehicle treatment; solid, quercetin treatment. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. qRT-PCR analysis of ESR2 in human (A) or mice splenic cells (B) or sorted G-MDSC (C), treated with vehicle or quercetin for 48 h. pSTAT3 in human (D) or mice (E) derived MDSC, cells were treated with vehicle or quercetin for 48 h. pSTAT3 in mice derived G-MDSC (F) or M-MDSC (G), treated with vehicle or quercetin for 48 h.
3.7. ESR2/pSTAT3 activation improved suppressive factors secretion in MDSC
treatment. The results showed elevated pSTAT3 levels in both MDSC (Fig. 7D, E). In addition, the pSTAT3 level was significantly up-regulated in G-MDSC (Fig. 7F), but not in M-MDSC (Fig. 7G) in mice. These results demonstrated that quercetin activated MDSC via ESR2/pSTAT3 signaling.
NOS2 is a key protein secreted by MDSC that inhibits T cell proliferation by exhausting L-arginine and producing nitric oxide [34]. Recently, Nikolaos and colleagues demonstrated that ESR signal activation promoted the proliferation of MDSC and enhanced their suppressive function through the STAT3 pathway [28]. Here we found that 8
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 8. Quercetin enhanced MDSC suppressive factors secretion. Tumor-bearing mouse splenic cells, sorted GMDSC from tumor-bearing mouse and CBMC were cultured for 48 h, with or without quercetin treatment. Then cells were collected for qRT-PCR assay. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. qRT-PCR analysis of NOS2 (A) and SOD1 (B) expression in splenic cells, sorted G-MDSC (C, D), or NOS2 (E) and SOD1 (F) in human-derived MDSC, treated with vehicle or quercetin for 48 h.
[28,29].
quercetin treatment resulted in the up-regulation of NOS2 expression in spleen of tumor-bearing mouse (Fig. 8A). Also, G-MDSC were purified from tumor-bearing mouse to analysis the NOS2 and SOD1 level. Results showed that ESR2 level elevated in G-MDSC after quercetin treatment (Fig. 8C). The same results were also observed in humanderived MDSC (Fig. 8E). Indeed, activation of STAT3 increases NOS2 expression and thus generates nitric oxide in several types of cells [35,36]. However, there was no significant change in the SOD1 expression levels in mouse- and human-derived MDSC after quercetin stimulation (Fig. 8B, D, F). This likely reflects the fact that quercetin stimulation activates different intracellular signaling pathways in these two cell types: the antioxidant activity of quercetin in macrophages is mainly exerted via the PI3K/Akt/Nrf2 signal pathway [37], whereas ESR activation in MDSC depends on the STAT3 signaling pathway
4. Discussion Quercetin is a natural product ubiquitously present in vegetables and other plants [26]. Previous studies demonstrated that quercetin induced tumor cell necrosis by enhancing ROS via activating caspase-3 [19]. Antitumor activity of quercetin in prostate cancer [38], cervical cancer [39], lung cancer [40], colonic cancer [41], gastric cancer [42], liver cancer [43] and breast cancer [44] has been reported in vitro and in vivo [45]. Quercetin can also impact immune response in tumor microenvironment through multiple ways. Quercetin impacts a range of gene expressions profiles in monocytes, which associated with nucleic acid metabolism, apoptosis and O-glycan biosynthesis and immune 9
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
proliferation by exhausting L-arginine and producing nitric oxide [34]. Recently, Nikolaos and colleagues demonstrated that ESR signal activation promoted the proliferation of MDSC and enhanced their suppressive function through the STAT3 pathway [28], supporting that MDSC are modulated by quercetin by binding to ESR. In addition, ESRs can promote cancer-associated fibroblasts to secrete stromal-derived factor-1, recruit MDSC to the tumor microenvironment, and promote tumor progression [54]. Two ESRs have been identified to date: ESR1 and ESR2. ESR1 is mainly expressed in the ovary, endometrium, hypothalamus, breast, liver, and kidney, whereas ESR2 is prominently expressed in the ovary, central nervous system, bone, intestinal mucosa, prostate, and endothelial cells [55]. ESR1 and ESR2 share most of their homologous sequences in the DNA-binding domain, belonging to one of three functional domains of ESRs, with lower homology in the NH2terminal domain. Both E2 and quercetin can bind to ESR1 and ESR2 and influence cell function, differentiation, and proliferation [33,55,56]. The estrogen signaling pathway was strongly associated with the genes regulated by quercetin. Indeed, quercetin was reported to promote estrogen receptor-positive cell proliferation by binding to ESR, and both ESR1 and ESR2 are capable of binding to quercetin with different stimulation effects [33]. Activation of ESR1 and ESR2 by quercetin is 1.7-fold and 4.5-fold higher than by E2, respectively [33]. We also observed the up-regulation of ESR2 in mouse- and human- derived MDSC after quercetin stimulation, indicating that G-MDSC proliferation was mainly influenced by the ESR2 signaling pathway. ESR1 and ESR2 activation involves different signaling pathways. ESR1 mainly participates in cell growth via activating ERK/MAPK and PI3K/AKT signaling, whereas ESR2 modulates cell cycle-related genes and apoptosis by phosphorylating p38/MAPK [57,58]. Gene and transcripts analyses showed that more than 1400 genes are regulated by ESR1 after E2 stimulation; among these altered genes, ESR2 activation inhibited the expression of 998 genes [59]. The opposite pathway activation by ESR1 or ESR2 may account for the survival of G-MDSC and the apoptosis of M-MDSC after quercetin treatment in the present study. Along with up-regulating NOS2 secretion, quercetin shows potential as a natural product for strengthening the suppressive function of MDSC. Although previous studies showed that the antioxidant property of quercetin was mediated by SOD1 activation in macrophages [60,61], we did not detect any changes in SOD1 in MDSC. This likely reflects the fact that quercetin stimulation activates different intracellular signaling pathways in these two cell types: the antioxidant activity of quercetin in macrophages is mainly exerted via the PI3K/Akt/Nrf2 signal pathway [37], whereas ESR activation in MDSC depends on the STAT3 signaling pathway [28,29]. Indeed, we detected increased expression levels of pSTAT3 in MDSC after quercetin treatment. Quercetin-treated MDSC could acquire potent suppressive activity to significantly inhibit T cell proliferation. pSTAT3 in MDSC was previously shown to induce angiogenesis in the tumor microenvironment and promoted tumor progression [62]. pSTAT3 has also been directly related with the suppressive function of MDSC: STAT3 activation increased the NADPH oxidase level in tumor-bearing mice, which induced high ROS generation by MDSC [10]. Moreover, MDSC isolated from the livers of tumorbearing mice expressed more IDO and PD-L1 after STAT3 activation [63]. In patients with ankylosing spondylitis, a high percentage of MDSC suppressed T cell proliferation by exhausting L-arginine in a manner dependent on STAT3 phosphorylation [64]. Here, we showed that pSTAT3 elevation in MDSC leads to the up-regulation of NOS2 after stimulated with quercetin.
responses [46]. Administration of quercetin reduced percentage of circulating plasmacytoid DCs in vivo [47]. Quercetin can also decrease reactive oxygen species level in macrophages and inhibit LPS-induced DC activation by reducing the production of proinflammatory cytokines/chemokines section [47,48]. Most recently, different groups identified the effect of quercetin on the polarization of anti-inflammatory macrophages [49,50]. Dietary quercetin ameliorates collagen-induced arthritis in rats by remodeling the Th17/Treg balance via a heme oxygenase-1-dependent pathway [51]. However, as a critical element in modulating immune response during cancer progression, there has been no research on the effects of quercetin to MDSC until now. Here, we demonstrate a novel role of quercetin in promoting MDSC survival by activating ESR and increasing STAT3 phosphorylation. We found that quercetin stimulation enhanced the survival of BMderived CD11b+Gr-1+ cells, and human- and mouse-derived MDSC. Bioinformatics analysis identified 10 core genes associated with these effects of quercetin, including NOS2, ESR1, and ESR2, which are directly related to MDSC. In vitro experiments confirmed that quercetin enhanced the suppressive function of MDSC by up-regulating the mRNA level of NOS2 via activating ESR2. We also found that STAT3 phosphorylation is involved in NOS2 secretion. Thus, this study provides the first evidence that the natural product quercetin promoted MDSC survival and suppressive factors secretion by binding to ESR2 and increasing STAT3 phosphorylation. These findings highlight highlights dichotomous function of quercetin in antitumor therapy. Prolonged survival and enhanced suppressive factors secretion of G-MDSC may lead to impaired antitumor effect of quercetin and attenuate immune response during antitumor therapy consequently. Thus offer novel insight into the roles of quercetin during tumor therapy. MDSC have been reported to contribute to tumor growth and metastatic progression [52]. Accumulation of MDSC in patients attenuated anti–CTLA-4 and anti–PD-1-mediated immune responses in tumor therapy, which was associated with a poor prognosis; thus, targeting MDSC could enhance the anti-tumor therapeutic effect [5]. Although the anti-tumor effect of quercetin has been reported [53], this is the first demonstration to describe the relationship between quercetin and MDSC. As CD11b+Gr-1+ immature cells isolated from the femur and tibia of naive mice are generally not defined as MDSC due to their lack of or only weak suppressive capacity [31], we induced splenic MDSC expansion by subcutaneous injection of prostate cancer RM-1 cells in the flanks of male mice. Results showed that quercetin promotes the survival of BM myeloid cells, splenic MDSC from tumor-bearing mice, and MDSC from human cord blood myeloid cells. Further analysis showed that quercetin promotes the survival of G-MDSC but not MMDSC, indicating that different signaling pathways might activate these subpopulations. The complex interactions and relations between quercetin-associated genes has been a challenge in the research and application of quercetin along with other natural products [32]. Bioinformatics analysis is an effective method to study the biological function of natural products systematically. Here, we found over 6000 genes associated with quercetin by searching genes in three different databases (comparative toxicogenomics database, coremine database, pharmmapper database), and further focused on NOS2 and ESR. The online software Stitch was then used to predict interactions between quercetin and each of these genes. The chemical-genes network showed direct interactions between quercetin and ESR and NOS2 in addition to Rb1, APAF1, PARP1, and PTPN1 that modulate cell apoptosis and proliferation in an indirect manner. GO analysis revealed survival gene regulation GO:0045884 as one of the most significantly related functions of quercetin, indicating its proliferation modulation property. KEGG pathway analysis further indicated that the ESR signal hsa04915 was one of the most significantly related signal pathways related to quercetin, supporting the previous finding that quercetin promotes estrogen receptor-positive cell proliferation [33]. NOS2 is a key protein secreted by MDSC that inhibits T cell
5. Conclusion In conclusion, through in vitro experiments and bioinformatics analysis, we showed that quercetin promotes the survival and suppressive property of G-MDSC by up-regulating NOS2 secretion through activating ESR2 and STAT3. Thus impact of G-MDSC should be taken 10
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
into consideration when quercetin is applied to tumor therapy. Our results highlight the bidirectional function of quercetin in anti-tumor therapy; this ability to enhance the G-MDSC suppressive property provides a novel insight for therapeutic intervention in clinical trials.
[20] Z. Zhang, S. Xu, Y. Wang, Y. Yu, F. Li, H. Zhu, Y. Shen, S. Huang, S. Guo, Nearinfrared triggered co-delivery of doxorubicin and quercetin by using gold nanocages with tetradecanol to maximize anti-tumor effects on MCF-7/ADR cells, J. Colloid Interface Sci. 509 (2018) 47–57. [21] S. Sun, F. Gong, P. Liu, Q. Miao, Metformin combined with quercetin synergistically repressed prostate cancer cells via inhibition of VEGF/PI3K/Akt signaling pathway, Gene 664 (2018) 50–57. [22] H. Yuan, Q. Ma, L. Ye, G. Piao, The traditional medicine and modern medicine from natural products, Molecules 21 (5) (2016). [23] H.S. Choi, M.K. Kim, Y.K. Choi, Y.C. Shin, S.G. Cho, S.G. Ko, Rhus verniciflua Stokes (RVS) and butein induce apoptosis of paclitaxel-resistant SKOV-3/PAX ovarian cancer cells through inhibition of AKT phosphorylation, BMC Complement. Altern. Med. 16 (2016) 122. [24] Z.M, L.B. Si, Q. Han, J.N. Huang, X. Long, F. Long, R.C. Zhao, J.Z. Huang, Z.F. Liu, R. Zhao, H.L. Zhang, X.J. Wang, Sensitization of keloid fibroblasts by quercetin through the PI3K/Akt pathway is dependent on regulation of HIF-1α, Am. J. Transl. Res. (2018). [25] S.L. Miles, M. McFarland, R.M. Niles, Molecular and physiological actions of quercetin: need for clinical trials to assess its benefits in human disease, Nutr. Rev. 72 (11) (2014) 720–734. [26] Y. Li, J. Yao, C. Han, J. Yang, M.T. Chaudhry, S. Wang, H. Liu, Y. Yin, Quercetin, inflammation and immunity, Nutrients 8 (3) (2016) 167. [27] R. Kleemann, L. Verschuren, M. Morrison, S. Zadelaar, M.J. van Erk, P.Y. Wielinga, T. Kooistra, Anti-inflammatory, anti-proliferative and anti-atherosclerotic effects of quercetin in human in vitro and in vivo models, Atherosclerosis 218 (1) (2011) 44–52. [28] N. Svoronos, A. Perales-Puchalt, M.J. Allegrezza, M.R. Rutkowski, K.K. Payne, A.J. Tesone, J.M. Nguyen, T.J. Curiel, M.G. Cadungog, S. Singhal, E.B. Eruslanov, P. Zhang, J. Tchou, R. Zhang, J.R. Conejo-Garcia, Tumor cell-independent estrogen signaling drives disease progression through mobilization of myeloid-derived suppressor cells, Cancer Discov. 7 (1) (2017) 72–85. [29] L.Z.T. Pan, S. Wu, Q.Y.Y. Cao, Z. Cai, X. Cai, N.M.W. Zhao, W. Zhang, H.Z. Zhou, 17b-Oestradiol enhances the expansion and activation of myeloid-derived suppressor cells via signal transducer and activator of transcription (STAT)23 signalling in human pregnancy, Clin. Exp. Immunol. (2016). [30] H. Wu, Y. Zhen, Z. Ma, H. Li, J. Yu, Z.G. Xu, X.Y. Wang, H. Yi, Y.G. Yang, Arginase1-dependent promotion of TH17 differentiation and disease progression by MDSCs in systemic lupus erythematosus, Sci. Transl. Med. 8 (331) (2016) 331ra40. [31] K.H. Parker, D.W. Beury, S. Ostrand-Rosenberg, Myeloid-derived suppressor cells: critical cells driving immune suppression in the tumor microenvironment, Adv. Cancer Res. 128 (2015) 95–139. [32] Y. Chen, C. de Bruyn Kops, J. Kirchmair, Data resources for the computer-guided discovery of bioactive natural products, J. Chem. Inf. Model. 57 (9) (2017) 2099–2111. [33] H. van der Woude, M.G. Ter Veld, N. Jacobs, P.T. van der Saag, A.J. Murk, I.M. Rietjens, The stimulation of cell proliferation by quercetin is mediated by the estrogen receptor, Mol. Nutr. Food Res. 49 (8) (2005) 763–771. [34] H.F. A.D. Peñaloza, N. Muñoz-Durango, B.M. Schultz, P.A. González, A.M. Kalergis, S.M. Bueno, The role of myeloid-derived suppressor cells in chronic infectious diseases and the current methodology available for their study, J. Leukoc. Biol. (2018). [35] H.C. Chong, J.S. Chan, C.Q. Goh, N.V. Gounko, B. Luo, X. Wang, S. Foo, M.T. Wong, C. Choong, S. Kersten, N.S. Tan, Angiopoietin-like 4 stimulates STAT3-mediated iNOS expression and enhances angiogenesis to accelerate wound healing in diabetic mice, Mol. Ther. 22 (9) (2014) 1593–1604. [36] T. Condamine, D.I. Gabrilovich, Molecular mechanisms regulating myeloid-derived suppressor cell differentiation and function, Trends Immunol. 32 (1) (2011) 19–25. [37] G.J. Shi, Y. Li, Q.H. Cao, H.X. Wu, X.Y. Tang, X.H. Gao, J.Q. Yu, Z. Chen, Y. Yang, In vitro and in vivo evidence that quercetin protects against diabetes and its complications: a systematic review of the literature, Biomed. Pharmacother. 109 (2019) 1085–1099. [38] R. Tummala, W. Lou, A.C. Gao, N. Nadiminty, Quercetin targets hnRNPA1 to overcome enzalutamide resistance in prostate cancer cells, Mol. Cancer Ther. 16 (12) (2017) 2770–2779. [39] T.H. Lin, W.H. Hsu, P.H. Tsai, Y.T. Huang, C.W. Lin, K.C. Chen, I.H. Tsai, C.C. Kandaswami, C.J. Huang, G.D. Chang, M.T. Lee, C.H. Cheng, Dietary flavonoids, luteolin and quercetin, inhibit invasion of cervical cancer by reduction of UBE2S through epithelial-mesenchymal transition signaling, Food Funct. 8 (4) (2017) 1558–1568. [40] Z. Xingyu, M. Peijie, P. Dan, W. Youg, W. Daojun, C. Xinzheng, Z. Xijun, S. Yangrong, Quercetin suppresses lung cancer growth by targeting Aurora B kinase, Cancer Med. 5 (11) (2016) 3156–3165. [41] S.B. Raja, V. Rajendiran, N.K. Kasinathan, A.P.S. Venkatabalasubramanian, M.R. Murali, H. Devaraj, S.N. Devaraj, Differential cytotoxic activity of Quercetin on colonic cancer cells depends on ROS generation through COX-2 expression, Food Chem. Toxicol. 106 (Pt A) (2017) 92–106. [42] H.S. Shang, H.F. Lu, C.H. Lee, H.S. Chiang, Y.L. Chu, A. Chen, Y.F. Lin, J.G. Chung, Quercetin induced cell apoptosis and altered gene expression in AGS human gastric cancer cells, Environ. Toxicol. 33 (11) (2018) 1168–1181. [43] K.W. Ren, Y.H. Li, G. Wu, J.Z. Ren, H.B. Lu, Z.M. Li, X.W. Han, Quercetin nanoparticles display antitumor activity via proliferation inhibition and apoptosis induction in liver cancer cells, Int. J. Oncol. 50 (4) (2017) 1299–1311. [44] L. Jia, S. Huang, X. Yin, Y. Zan, Y. Guo, L. Han, Quercetin suppresses the mobility of breast cancer by suppressing glycolysis through Akt-mTOR pathway mediated autophagy induction, Life Sci. 208 (2018) 123–130. [45] M. Hashemzaei, A. Delarami Far, A. Yari, R.E. Heravi, K. Tabrizian, S.M. Taghdisi,
Funding This work was supported by the grants from the National Natural Science Foundation of China (81671592 to H.Y); Science and Technology Department of Jilin Province (20190201140JC to H.Y.) Declaration of Competing Interest The authors declare no competing interests. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2020.109922. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2) (2015) 87–108. [2] P. Qu, L.Z. Wang, P.C. Lin, Expansion and functions of myeloid-derived suppressor cells in the tumor microenvironment, Cancer Lett. 380 (1) (2016) 253–256. [3] J.E. Talmadge, D.I. Gabrilovich, History of myeloid-derived suppressor cells, Nat. Rev. Cancer 13 (10) (2013) 739–752. [4] K.R. Jordan, R.N. Amaria, O. Ramirez, E.B. Callihan, D. Gao, M. Borakove, E. Manthey, V.F. Borges, M.D. McCarter, Myeloid-derived suppressor cells are associated with disease progression and decreased overall survival in advanced-stage melanoma patients, Cancer Immunol. Immunother. CII 62 (11) (2013) 1711–1722. [5] J.A. Chesney, R.A. Mitchell, K. Yaddanapudi, Myeloid-derived suppressor cells-a new therapeutic target to overcome resistance to cancer immunotherapy, J. Leukoc. Biol. 102 (3) (2017) 727–740. [6] K. Ohl, K. Tenbrock, Reactive oxygen species as regulators of MDSC-Mediated immune suppression, Front. Immunol. 9 (2018) 2499. [7] D.D. Patel, V.K. Kuchroo, Th17 cell pathway in human immunity: lessons from genetics and therapeutic interventions, Immunity 43 (6) (2015) 1040–1051. [8] A. Pastaki Khoshbin, M. Eskian, M. Keshavarz-Fathi, N. Rezaei, Roles of myeloidderived suppressor cells in Cancer metastasis: immunosuppression and beyond, Archivum Immunologiae et Therapiae Experimentalis (2018). [9] M. Vlkova, Z. Chovancova, J. Nechvatalova, A.N. Connelly, M.D. Davis, P. Slanina, L. Travnickova, M. Litzman, T. Grymova, P. Soucek, T. Freiberger, J. Litzman, Z. Hel, Neutrophil and granulocytic myeloid-derived suppressor cell-mediated T cell suppression significantly contributes to immune dysregulation in common variable immunodeficiency disorders, J. Immunol. (2018). [10] C.A. Corzo, M.J. Cotter, P. Cheng, F. Cheng, S. Kusmartsev, E. Sotomayor, T. Padhya, T.V. McCaffrey, J.C. McCaffrey, D.I. Gabrilovich, Mechanism regulating reactive oxygen species in tumor-induced myeloid-derived suppressor cells, J. Immunol. 182 (9) (2009) 5693–5701. [11] M. Szwed, K.D. Kania, Z. Jozwiak, Molecular damage caused by generation of reactive oxygen species in the redox cycle of doxorubicin-transferrin conjugate in human leukemia cell lines, Leuk. Lymphoma 56 (5) (2015) 1475–1483. [12] P.L. Raber, P. Thevenot, R. Sierra, D. Wyczechowska, D. Halle, M.E. Ramirez, A.C. Ochoa, M. Fletcher, C. Velasco, A. Wilk, K. Reiss, P.C. Rodriguez, Subpopulations of myeloid-derived suppressor cells impair T cell responses through independent nitric oxide-related pathways, Int. J. Cancer 134 (12) (2014) 2853–2864. [13] S. Solito, I. Marigo, L. Pinton, V. Damuzzo, S. Mandruzzato, V. Bronte, Myeloidderived suppressor cell heterogeneity in human cancers, Ann. N. Y. Acad. Sci. 1319 (2014) 47–65. [14] E. Tcyganov, J. Mastio, E. Chen, D.I. Gabrilovich, Plasticity of myeloid-derived suppressor cells in cancer, Curr. Opin. Immunol. 51 (2018) 76–82. [15] A. Heine, C. Flores, H. Gevensleben, L. Diehl, M. Heikenwalder, M. Ringelhan, K.P. Janssen, U. Nitsche, N. Garbi, P. Brossart, P.A. Knolle, C. Kurts, B. Hochst, Targeting myeloid derived suppressor cells with all-trans retinoic acid is highly time-dependent in therapeutic tumor vaccination, Oncoimmunology 6 (8) (2017) e1338995. [16] R. Weber, V. Fleming, X. Hu, V. Nagibin, C. Groth, P. Altevogt, J. Utikal, V. Umansky, Myeloid-derived suppressor cells hinder the anti-cancer activity of immune checkpoint inhibitors, Front. Immunol. 9 (2018) 1310. [17] T. Xie, S. Song, S. Li, L. Ouyang, L. Xia, J. Huang, Review of natural product databases, Cell Prolif. 48 (4) (2015) 398–404. [18] A.L. Demain, P. Vaishnav, Natural products for cancer chemotherapy, Microb. Biotechnol. 4 (6) (2011) 687–699. [19] S.T. Chan, C.H. Chuang, Y.C. Lin, J.W. Liao, C.K. Lii, S.L. Yeh, Quercetin enhances the antitumor effect of trichostatin A and suppresses muscle wasting in tumorbearing mice, Food Funct. 9 (2) (2018) 871–879.
11
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
accumulation of MDSCs in the tumor microenvironment, Sci. Rep. 6 (2016) 39541. [55] M. Jia, K. Dahlman-Wright, J.A. Gustafsson, Estrogen receptor alpha and beta in health and disease, best practice & research, Clin. Endocrinol. Metab. 29 (4) (2015) 557–568. [56] J.M. Hall, J.F. Couse, K.S. Korach, The multifaceted mechanisms of estradiol and estrogen receptor signaling, J. Biol. Chem. 276 (40) (2001) 36869–36872. [57] Y. Liang, H. Xie, J. Wu, D. Liu, S. Yao, Villainous role of estrogen in macrophagenerve interaction in endometriosis, Reprod. Biol. Endocrinol. 16 (1) (2018) 122. [58] F. Acconcia, P. Totta, S. Ogawa, I. Cardillo, S. Inoue, S. Leone, A. Trentalance, M. Muramatsu, M. Marino, Survival versus apoptotic 17beta-estradiol effect: role of ER alpha and ER beta activated non-genomic signaling, J. Cell. Physiol. 203 (1) (2005) 193–201. [59] C. Williams, K. Edvardsson, S.A. Lewandowski, A. Strom, J.A. Gustafsson, A genome-wide study of the repressive effects of estrogen receptor beta on estrogen receptor alpha signaling in breast cancer cells, Oncogene 27 (7) (2008) 1019–1032. [60] B. Nambooppha, K. Photichai, K. Wongsawan, P. Chuammitri, Quercetin manipulates the expression of genes involved in the reactive oxygen species (ROS) process in chicken heterophils, J. Vet. Med. Sci. 80 (8) (2018) 1204–1211. [61] K. Min, S.E. Ebeler, Quercetin inhibits hydrogen peroxide-induced DNA damage and enhances DNA repair in Caco-2 cells, Food Chem. Toxicol. 47 (11) (2009) 2716–2722. [62] M. Kujawski, M. Kortylewski, H. Lee, A. Herrmann, H. Kay, H. Yu, Stat3 mediates myeloid cell-dependent tumor angiogenesis in mice, J. Clin. Invest. 118 (10) (2008) 3367–3377. [63] M. Thorn, P. Guha, M. Cunetta, N.J. Espat, G. Miller, R.P. Junghans, S.C. Katz, Tumor-associated GM-CSF overexpression induces immunoinhibitory molecules via STAT3 in myeloid-suppressor cells infiltrating liver metastases, Cancer Gene Ther. 23 (6) (2016) 188–198. [64] Y.F. Liu, K.H. Zhuang, B. Chen, P.W. Li, X. Zhou, H. Jiang, L.M. Zhong, F.B. Liu, Expansion and activation of monocytic-myeloid-derived suppressor cell via STAT3/ arginase-I signaling in patients with ankylosing spondylitis, Arthritis Res. Ther. 20 (1) (2018) 168.
S.E. Sadegh, K. Tsarouhas, D. Kouretas, G. Tzanakakis, D. Nikitovic, N.Y. Anisimov, D.A. Spandidos, A.M. Tsatsakis, R. Rezaee, Anticancer and apoptosisinducing effects of quercetin in vitro and in vivo, Oncol. Rep. 38 (2) (2017) 819–828. I. Boomgaarden, S. Egert, G. Rimbach, S. Wolffram, M.J. Muller, F. Doring, Quercetin supplementation and its effect on human monocyte gene expression profiles in vivo, Br. J. Nutr. 104 (3) (2010) 336–345. T. Nickel, H. Hanssen, Z. Sisic, S. Pfeiler, C. Summo, D. Schmauss, E. Hoster, M. Weis, Immunoregulatory effects of the flavonol quercetin in vitro and in vivo, Eur. J. Nutr. 50 (3) (2011) 163–172. R.Y. Huang, Y.L. Yu, W.C. Cheng, C.N. OuYang, E. Fu, C.L. Chu, Immunosuppressive effect of quercetin on dendritic cell activation and function, J. Immunol. 184 (12) (2010) 6815–6821. Z.P. Li, H.B. Liu, Q.W. Zhang, L.F. Li, W.R. Bao, D.L. Ma, C.H. Leung, Z.X. Bian, A.P. Lu, Q.B. Han, Interference of quercetin on Astragalus polysaccharide-Induced macrophage activation, Molecules 23 (7) (2018). H. Lu, L. Wu, L. Liu, Q. Ruan, X. Zhang, W. Hong, S. Wu, G. Jin, Y. Bai, Quercetin ameliorates kidney injury and fibrosis by modulating M1/M2 macrophage polarization, Biochem. Pharmacol. 154 (2018) 203–212. Y. Yang, X. Zhang, M. Xu, X. Wu, F. Zhao, C. Zhao, Quercetin attenuates collageninduced arthritis by restoration of Th17/Treg balance and activation of Heme Oxygenase 1-mediated anti-inflammatory effect, Int. Immunopharmacol. 54 (2018) 153–162. V. Kumar, S. Patel, E. Tcyganov, D.I. Gabrilovich, The nature of myeloid-derived suppressor cells in the tumor microenvironment, Trends Immunol. 37 (3) (2016) 208–220. L. Yi, Y. Zongyuan, G. Cheng, Z. Lingyun, Y. Guilian, G. Wei, Quercetin enhances apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in ovarian cancer cells through reactive oxygen species (ROS) mediated CCAAT enhancer-binding protein homologous protein (CHOP)-death receptor 5 pathway, Cancer Sci. 105 (5) (2014) 520–527. L. Ouyang, W. Chang, B. Fang, J. Qin, X. Qu, F. Cheng, Estrogen-induced SDF1alpha production promotes the progression of ER-negative breast cancer via the
12
Contents lists available at ScienceDirect
Biomedicine & Pharmacotherapy journal homepage: www.elsevier.com/locate/biopha
Quercetin promotes the survival of granulocytic myeloid-derived suppressor cells via the ESR2/STAT3 signaling pathway
T
Zhanchuan Maa,b,1, Yan Xiac,1, Cong Hua,b, Miaomiao Yua,b, Huanfa Yia,b,* a
Central Laboratory, The First Hospital of Jilin University, Changchun, Jilin, 130031, China Key Laboratory of Organ Regeneration and Transplantation, Ministry of Education, Changchun, Jilin, 130021, China c Department of Gastroenterology, The First Hospital of Jilin University, Changchun, Jilin 130021, China b
A R T I C LE I N FO
A B S T R A C T
Keywords: Quercetin Myeloid-derived suppressor cell Estrogen receptors Cell survival
Quercetin is a natural product that has been shown to induce tumor apoptosis and necrosis through multiple mechanisms. Tumor-induced myeloid-derived suppressor cell (MDSC) expansion negatively regulates the immune response by inhibiting T cell function through signal transducer and activator of transcription 3 (STAT3) activation, thereby facilitating tumor escape from host immune surveillance. Thus MDSC is an attractive target for cancer immunotherapy to enhance cytotoxic T cell responses. However, the effects of quercetin on MDSC are poorly understood. Here, we demonstrate that quercetin treatment enhanced mouse- and human- derived granulocytic-myeloid-derived suppressor cells (G-MDSC) survival and promoted the secretion of T cell-suppressive factors in vitro. Bioinformatics analysis further showed that quercetin was highly correlated with the estrogen receptor signaling pathway, which was confirmed by quantitative reverse transcription-polymerase chain reaction and flow cytometric analysis. These findings highlight the potential advantages and feasibility of quercetin in reinforcing the suppressive property of G-MDSC. Thus impact of G-MDSC should be taken into consideration when quercetin is applied to tumor therapy.
1. Introduction Cancer therapy remains an active research topic owing to the continuous rise in cancer diagnoses worldwide, imposing a heavy burden on society and a serious threat to human health [1]. Numerous studies have focused on immune-modulating cells during cancer development, which play key roles in regulating tumor progression and metabolism [2]. In this regard, myeloid-derived suppressor cells (MDSC) have recently attracted interest with respect to their capacity to modulate immune response in the tumor microenvironment [3–5], represe-nting a potential target for a new immunotherapy strategy in cancer treatment. MDSC is a population of immature myeloid cells that pathologically recruit and accumulate at inflammatory sites and in tumor, consequently modulating the immune response. MDSC represents a heterogeneous cell population consisting of subsets of the
precursor of neutrophils, monocytes, and dendritic cells that suppress T cell proliferation via different mechanisms [6]. In general, two subpopulations of MDSC are recognized in mice: CD11b+Gr-1+Ly6G+ granulocytic-myeloid-derived suppressor cells (G-MDSC) and CD11b+Gr-1+Ly6C+ monocytic-myeloid-derived suppressor cells (MMDSC), corresponding to human CD11b+HLA-DR-CD33+CD66b+ (or CD15+) and CD11b+HLA-DR-CD33+CD14+ cells, respectively [7–9]. MDSC mechanically suppresses the proliferation and function of T cells by secreting nitric oxide synthase 2 (NOS2), arginase-1 (Arg-1), and reactive oxygen species (ROS). NOS2 and ROS directly induce cell apoptosis and DNA damage to disturb the repair of damaged DNA [10–12]. Whereas Arg-1 catalyzes its substrate arginine into urea and Lornithine, which is crucial to CD3ζ chain synthesis [13]. Accumulation of MDSC in patients and tumor models impedes the clearance of tumor cells by blocking the function of cytotoxic T cells in cancer [3,14]. A high level of MDSC was also shown to promote tumor
Abbreviations: Arg-1, arginase-1; BM, bone marrow; CBMC, cord blood mononuclear cells; CD, database coremine database; CT, database comparative toxicogenomics database; E2, 17beta-estradiol; ESR, estrogen signaling receptor; G-MDSC, granulocyte myeloid-derived suppressor cell; MDSC, myeloid-derived suppressor cell; NOS2, nitric oxide synthase 2; M-MDSC, monocyte myeloid-derived suppressor cell; PM database, pharmmapper database; ROS, reactive oxygen species; SOD1, superoxide dismutase 1; STAT3, signal transducer and activator of transcription 3 ⁎ Corresponding author at: Central Laboratory, The First Hospital of Jilin University, Changchun, Jilin, 130031, China. E-mail address: [email protected] (H. Yi). 1 Equal contribution. https://doi.org/10.1016/j.biopha.2020.109922 Received 10 September 2019; Received in revised form 9 December 2019; Accepted 13 December 2019 0753-3322/ © 2020 The Authors. Published by Elsevier Masson SAS. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
properties of quercetin are as follows: MW, AlogP, TPSA, Hdon, and Hacc (Lipinski’s rule of five) of 302.238, 1.50, 131.36, 5, and 7, respectively; oral bioavailability, 46.43 %; drug-likeness, 0.28; Cacao-2 cell permeability, 0.05; blood-brain barrier permeability, -0.77; RBN, 1; and HL, 14.40, as reported in the Traditional Chinese Medicine Systems Pharmacology database (http://lsp.nwu.edu.cn/index.php). 2.2. Potential targets prediction Comparative toxicogenomics database (CTD, http://ctdbase.org/), coremine database (CD, http://www.coremine.com/medical/#search) and pharmmapper database (PD, http://lilab.ecust.edu.cn/ pharmmapper/) was used to study interaction between target molecules and potential proteins. Predicted genes will be automatically listed and ordered by correlation coefficient. Top 10 potential target genes were screened by Venn diagram (http://bioinformatics.psb. ugent.be/webtools/Venn/) to solidify reliability of the analysis results.
Fig. 1. Chemical structure of quercetin. Chemical structure of quercetin was downloaded from the PubChem database CID:5280343.
2.3. GO and pathway analysis
angiogenesis to facilitate tumor growth [2]. Therefore, targeting MDSC has emerged as a potential strategy to inhibit tumor progression and prolong the survival of cancer patients [15,16]. Toward this end, it is necessary to identify or develop a compound that can safely and effectively target MDSC and the factors that influence their survival and proliferation. Natural products extracted from the stems, seeds, and leaves of plants, or from animals and microorganisms have multiple pharmacological and biological activities [17], and have been used to develop cancer chemotherapy for decades [18]. Quercetin widely exists in natural substances like fruits, leaves, seeds of plants that facilitate in antitumor studies [19–21]. The two-dimensional structure of quercetin is shown in Fig. 1. The potent cytotoxic properties of natural products have contributed to treatment for solid tumors and leukemia [18,22]. Quercetin inhibited phosphatidylinositol 3-kinase (PI3K)/Akt phosphorylation to induce the apoptosis of tumor cells [21,23,24]The protective role of quercetin has been proven in clinical trials [25,26], and shows anti-tumor properties [19–21]. However, the ability of quercetin to promote the proliferation or influence the secretion of suppressive factors of MDSC remains unclear. Therefore, in the present study, we evaluated the effect of quercetin treatment on the survival of MDSC and the underlying mechanism. To determine whether quercetin influences the survival of MDSC, myeloid cells were isolated from BM and spleen of mice or cord blood of parturient puerperae and treated with different concentrations of quercetin. To further analyze the mechanism underlying the established anti-tumor activity of quercetin, we conducted bioinformatics analysis of reported quercetin-regulated genes and the protein-protein interaction network of genes expressed under quercetin treatment in MDSC [26,27]. Since estradiol (E2) treatment was previously reported to activate ESR signaling in human and mouse-derived MDSC, and to promote the proliferation and enhance the suppressive properties of MDSC via STAT3 phosphorylation [28,29], we hypothesized that elevated ESR/pSTAT3 levels after quercetin stimulation may also improve the suppressive activity of MDSC, which was confirmed by in vitro experiments. These findings can offer a novel perspective for applications of quercetin in anti-tumor treatment, highlighting a bidirectional effect of quercetin in cancer therapy.
The Molecule Annotation System 3.0 (MAS 3.0), a web-based software toolkit, can be used to help understand relationships within gene expression data and provide systematic and visual information on the gene of interest. Potential targets were uploaded to the MAS 3.0 server (http://bioinfo.capitalbio.com/mas3/) following the online instructions, and GO and KEGG pathway information for related genes was generated and collected. For a deeper understanding of the complex relationships among compounds, targets and diseases, networks were constructed and analyzed by Cytoscape 3.0. Software. 2.4. Cell isolation Cord blood obtained from the First Hospital of Jilin University. Cord blood mononuclear cells (CBMC) were isolated by Ficoll–Hypaque gradient centrifugation. All the women with cesarean section at term signed the informed consent before cord blood collection, and all procedures in this study were approved by the ethics committee of the First Hospital of Jilin University. 6∼8 weeks male C57BL/6 mice maintained under specific pathogen-free (SPF) conditions. RM-1 cell lines were cultured in Dulbecco’s modified Eagle’s (Gibco) medium contains 10 % fetal bovine serum (Gibco), 100 U/ml penicillin and 100 ug/ml streptomycin in humidified 5 % CO2 incubators. RM1 cells (2 × 105 cells in 100 μl PBS) were injected subcutaneously in the flank of the C57BL/6 mouse. After two weeks spleen and bone marrow was obtained from tumor-bearing mice. Single cell suspensions of spleen and bone marrow were generated as described previously [30]. Briefly, BM was flushed by cold PBS from tibias and femurs of mice. Single cell suspension of BM and spleen was generated and passed through a 70 u M strainer after lysed red blood cells. Then CBMC, splenic cells and bone marrow cells suspended with 1640 medium contains 10 % fetal bovine serum (Gibco), 100 U/ml penicillin and 100ug/ml streptomycin. 2.5. Cell sorting To sort G-MDSC from mouse, 2 × 105 RM-1 cells were injected subcutaneously in the flank of the C57BL/6 mouse. After two weeks spleen was obtained from tumor-bearing mice. Single cell suspensions of spleen was generated and passed through a 70 u M strainer after lysed red blood cells. Anti-mouse CD11b apccy7 (M1/70, Biolegend), Ly 6C pecy7 (AL-21, Biolegend), Ly 6G FITC (RB6-8C5, Biolegend) antibodies were added to splenic cell suspension at 4℃ for 20 min, then washed twice with cold PBS. CD11b+Ly 6C-Ly 6G+ cells were sorted with not lower than 95 % purity for further study.
2. Materials and methods 2.1. Structure and basic properties of quercetin Structure and basic information of subunit of DSS was obtained from the web (https://pubchem.ncbi.nlm.nih.gov/). The basal 2
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 2. Quercetin facilitated BM CD11b+Gr-1+Ly6G+ cell maintenances. BM cells isolated from naive B6 mice and red blood cells were lysed. Different concentration of quercetin was added to BM cells for 48 h. Then CD11b+Gr-1+ cells were analyzed by flow cytometry. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. (A) Staining profiles of CD11b+Gr-1+ cells in BM after treated with vehicle or quercetin for 48 h. (B) Percentage of CD11b+Gr-1+ cells in BM after treated with vehicle or quercetin for 48 h. (C) Ly6C+ and Ly6G+ cells gated on CD11b+Gr-1+ cells were analyzed by flow cytometry. (D) Percentage of Ly6C+ and Ly6G+ cells gated on CD11b+Gr-1+ cells after treated with vehicle or quercetin for 48 h.
penicillin and 100ug/ml streptomycin. Cells were plated in 96 well plates and treated with quercetin (20 μM, 40 μM, 80 μM) for 24 h, 48 h or 72 h.
2.6. Drug treatment Quercetin was purchased from Shanghai Aladdin, dissolved with dimethylsulfoxide upon received. Stock solution (1 mM) stored aliquots at -80℃ under sterile conditions. 2 × 105 indicated cells were cultured in 1640 medium contains 10 % fetal bovine serum (Gibco), 100 U/ml 3
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 3. Quercetin enhanced mice derived MDSC survival. Splenic cells were obtained from tumor-bearing B6 mice and red blood cells were lysed. Cells were treated with vehicle or quercetin (80 μM) for 48 h. Then MDSC were stained (CD11b+Gr-1+) and analyzed by FCM. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. (A) Staining profiles of splenic MDSC from tumor-bearing B6 mice. (B) Percentage of splenic MDSC, with or without quercetin treatment. (C G-MDSC (CD11b+Gr-1+Ly6G+) gated on CD11b+Gr-1+ cells were analyzed by flow cytometry. (D) Percentage of splenic G-MDSC, with or without quercetin treatment.
4
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 4. Quercetin enhanced human derived MDSC survival. CBMC were obtained from women with cesarean section. Cells were treated with vehicle or quercetin (80 μM) for 48 h. Then MDSC were stained (CD11b+HLA-DR-) and analyzed by FCM. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. (A) Staining profiles of MDSC (CD11b+HLA-DR-) from CBMC. (B) Percentage of MDSC in CBMC, treated with vehicle or quercetin for 48 h. (C) Subpopulation of MDSC in CBMC was analyzed by FCM, gated on CD11b+HLA-DR- cells. (D) Percentage of M-MDSC (CD11b+HLA-DR-CD14+) and G-MDSC (CD11b+HLA-DR-CD66b+) in CBMC, treated with vehicle or quercetin for 48 h.
Biolegend), anti-mouse CD11b apccy7 (M1/70, Biolegend), Gr-1 percpcy5.5 (RB6-8C5, Biolegend), Ly 6C pecy7 (AL-21, Biolegend), Ly 6G FITC (RB6-8C5, Biolegend). Then cells were analyzed on a FACSAria II (BD Biosciences).
2.7. Flow cytometric analysis After treated with quercetin, cells were collected and fluorochromeconjugated mAbs were used to detect MDSC. Antibodies were listed as follow: anti-human HLA-DR PE (G46-6, BD), CD11b APC CY7 (ICRF44, BD), CD14 FITC (63D3, Biolegend), CD66b percpcy5.5 (G10F5,
5
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
2.8. Quantitative real-time PCR
3.3. Quercetin activated human-derived G-MDSC
Total RNA was extracted from cells stimulated with 40 u M quercetin for 48 h with Trizol (Invitrogen) regent. Then cDNA was synthesized using TransScript First-Strand cDNA Synthesis SuperMix (TransGen Biotech). qRT-PCR was performed with an ABI StepOnePlus system (Applied Biosystems) with a SYBR Green Kit (TransGen Biotech). The expression level was normalized against the β-actin. Relative mRNA expression was calculated using the 2 −ΔΔCT method. The primer sequence sets used for NOS2, ESR2 and β-actin was listed as follows:
Next we focused on if quercetin could influence survival and function of human-derived MDSC. Cord blood was collected and CBMC was treated with different concentration of quercetin for 48 h. E2 was used as positive control, for powerful promote MDSC proliferation effect of E2 has been reported previously [28]. The percentage of cord bloodderived CD11b+HLA-DR- MDSC increased significantly after 48 h of treatment with quercetin compared with that of the vehicle control (Fig. 4A, B). Similar to the mouse results, quercetin promoted the survival of CD11b+HLA-DR-CD66b+ G-MDSC but not CD11b+HLA-DRCD14+ M-MDSC (Fig. 4C, D). These results suggested that quercetin likely activates a downstream signaling pathway of G-MDSC by binding to a specific receptor.
Primer name h/m-actin h-NOS2 h-ESR2 m-NOS2 m-ESR2
Primer sequence F:5’ TTCAACACCCCAGCCATG 3’ R:5’ CCTCGTAGATGGGCACAGT 3’ F:5’ TGGCCACCTTGTTCAGCTACG 3 R:5’ GCCAAGGCCAAACACAGCATAC 3’ F:5’ TCCATCGCCAGTTATCACATCT 3’ R:5’ CTGGACCAGTAACAGGGCTG 3’ F:5’ TGGCCACCTTGTTCAGCTACG 3’ R:5’ GCCAAGGCCAAACACAGCATAC 3’ F:5’ GTAGAGAGCCGTCACGAATACT 3’ R:5’ GGTTCTGCATAGAGAAGCGATG 3’
3.4. Identification of target genes stimulated by quercetin The complex interactions and relations between quercetin-associated genes has been a challenge in the research and application of quercetin along with other natural products [32]. Bioinformatics analysis is an effective method to study the biological function of natural products systematically. To determine the protein-protein interactions induced by quercetin in MDSC, we screened three databases (comparative toxicogenomics database, coremine database, pharmmapper database) to search for quercetin-related genes, which identified 4092, 1995, and 682 genes, respectively. Comparative toxicogenomics database and coremine database can predict potential genes and proteins associated with diseases or non-disease-term biological events, while PD emphasizes prediction of pharmacologically binding sites of drugs. The Venn diagram in Fig. 5A shows the 35 genes that overlap among the database indicating a strong influence by quercetin. We chose the top 10 genes (NOS2, CDK2, CSNK2A1, APAF1, INSR, AKT1, HSPA8, ESR1, ESR2, and MMP9) to construct protein-protein interaction networks of quercetin-related genes with Cytoscape software (Fig. 5B). Among these 10 genes, NOS2 and ESR are directly related to the suppressive function of MDSC; therefore, we further focused on these genes to understand the suppressive mechanism of quercetin.
2.9. Statistical analysis All data are shown as mean ± SD except for otherwise indicated. All experiments were performed three times. Significance was determined with Mann-Whitney U-test analysis. A P value of < 0.05 was considered significant. Statistical analyses were performed on GraphPad Prism 5.0 software. 3. Results 3.1. Quercetin promoted the survival of BM-derived CD11b+Gr-1+ Ly6G+cells Quercetin (20 μM, 40 μM, 80 μM) was added to BM-derived CD11b+Gr-1+ Ly6G+cells for 24 h, 48 h or 72 h. The results showed that percentage of target cells increased significantly after quercetin treatment. 80 μM quercetin treatment efficiently promoted survival of BM-derived CD11b+Gr-1+ Ly6G+cells (Figure S1 C). Unless otherwise specified, cells were treated with 80 μM quercetin for 48 h in following experiments. Quercetin enhanced the survival of CD11b + Gr-1+ cells in a concentration-dependent manner with 48-h stimulation (Fig. 2A, B). However, the percentage of CD11b+Gr-1+Ly6G+ cells increased after 48 h stimulation, whereas CD11b+Gr-1+Ly6C+ cells showed apoptosis after treatment (Fig. 2C, D), indicating that different signal pathways might be activated in the two subsets of cells in response to quercetin treatment.
3.5. Gene Ontology and pathway enrichment analysis Gene Ontology (GO) and pathway analysis identified the top 10 enrichment terms associated with quercetin treatment (Fig. 6A,B: peptidyl-serine phosphorylation GO:0018105, cellular response to insulin stimulus GO:0032869, positive regulation of transcription, DNAtemplate GO:0045893, signal transduction GO:0007165, and response to estrogen GO:0043627 were enriched biological processes associated with the quercetin-regulated genes; protein kinase activity GO:0004672, ATP binding GO:0005524, RNA polymerase II transcription factor activity, ligand-activated sequence-specific DNA binding GO:0004879, protein serine/threonine kinase activity GO:0004674, and kinase activity GO:0016301 were the enriched molecular functions Fig. 6A). Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis showed that estrogen signaling pathway (hsa04915) was the most significantly enriched pathway among genes regulated by quercetin (Fig. 6B). Other significantly enriched pathways included VEGF signaling pathway (hsa04370), prolactin signaling pathway (hsa04917), HIF-1 signaling pathway (hsa04066), adherens junction (hsa04520), hepatitis B (hsa05161), progesterone-mediated oocyte maturation (hsa04914), tuberculosis (hsa05152), proteoglycans in cancer (hsa05205), and toxoplasmosis (hsa05145) (Fig. 6B).
3.2. Quercetin activated mouse-derived G-MDSC As CD11b+Gr-1+ immature cells isolated from the femur and tibia of naive mice are generally not defined as MDSC due to their lack of or only weak suppressive capacity [31], we induced splenic MDSC expansion by subcutaneous injection of prostate cancer RM-1 cells in the flanks of male C57BL/6 mouse. Results showed that the percentages of splenic MDSC from tumor-bearing mouse increased after treatment with different concentrations of quercetin in a dose-dependent manner (Fig. 3A, B). Flow cytometric analysis showed that percentage of CD11b+Gr-1+Ly6G+ G-MDSC expanded while CD11b+Gr-1+Ly6C+ M-MDSC immediately underwent apoptosis under exposure to quercetin (Fig. 3C, D). Thus, quercetin treatment enhanced the survival of G-MDSC in mouse.
3.6. Quercetin facilitated MDSC survival and function by activating ESR2 Given the results of the bioinformatic analysis, and previous findings show that quercetin promoted the growth of estrogen receptor6
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 5. Genomic feature of quercetin regulated proteins. (A) Venn diagram analysis of multiple genes from three databases. (B) PPI networks construction within quercetin regulation. The nodes represent chemical (ellipse) or genes (rectangle).
mouse, and then treated with quercetin for 48 h. The results showed that G-MDSC expressed high level of ESR2 after quercetin treatment (Fig. 7C). Since up-regulation of ESR2 expression was reported to activate STAT3 to improve the expansion and activation of MDSC during pregnancy [29], we detected the levels of phosphorylated STAT3 (pSTAT3) in human and mouse-derived MDSC after quercetin
positive cell lines through ESR [33], similar to the effects of E2 [28,29], we next investigated whether quercetin regulates MDSC via ESR. qRTPCR showed that quercetin treatment up-regulated the mRNA level of ESR2 in human-derived MDSC (Fig. 7A) and splenic cells from tumorbearing mouse (Fig. 7B). As ESR2 is not specifically expressed by GMDSC, G-MDSC were purified from splenic cells of tumor-bearing
Fig. 6. GO and pathway analysis of quercetin regulated genes. (A) GO enrichment analysis of genes regulated by quercetin. (B) KEGG pathway analysis of genes regulated by quercetin. 7
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 7. Quercetin enhanced MDSC suppressive function via activating ESR2/STAT3. Splenic cells and sorted G-MDSC from tumor-bearing mouse, or CBMC were cultured for 48 h, with or without quercetin treatment. Then cells were collected for qRTPCR assay or stained and analyzed by FCM. Gray, isotype; dotted, vehicle treatment; solid, quercetin treatment. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. qRT-PCR analysis of ESR2 in human (A) or mice splenic cells (B) or sorted G-MDSC (C), treated with vehicle or quercetin for 48 h. pSTAT3 in human (D) or mice (E) derived MDSC, cells were treated with vehicle or quercetin for 48 h. pSTAT3 in mice derived G-MDSC (F) or M-MDSC (G), treated with vehicle or quercetin for 48 h.
3.7. ESR2/pSTAT3 activation improved suppressive factors secretion in MDSC
treatment. The results showed elevated pSTAT3 levels in both MDSC (Fig. 7D, E). In addition, the pSTAT3 level was significantly up-regulated in G-MDSC (Fig. 7F), but not in M-MDSC (Fig. 7G) in mice. These results demonstrated that quercetin activated MDSC via ESR2/pSTAT3 signaling.
NOS2 is a key protein secreted by MDSC that inhibits T cell proliferation by exhausting L-arginine and producing nitric oxide [34]. Recently, Nikolaos and colleagues demonstrated that ESR signal activation promoted the proliferation of MDSC and enhanced their suppressive function through the STAT3 pathway [28]. Here we found that 8
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
Fig. 8. Quercetin enhanced MDSC suppressive factors secretion. Tumor-bearing mouse splenic cells, sorted GMDSC from tumor-bearing mouse and CBMC were cultured for 48 h, with or without quercetin treatment. Then cells were collected for qRT-PCR assay. Three parallel samples were performed in each group and the data in figures represent results from a combination from all three experiments. Quantification of signal was shown in bar graphs and error bars represent mean ± SD. qRT-PCR analysis of NOS2 (A) and SOD1 (B) expression in splenic cells, sorted G-MDSC (C, D), or NOS2 (E) and SOD1 (F) in human-derived MDSC, treated with vehicle or quercetin for 48 h.
[28,29].
quercetin treatment resulted in the up-regulation of NOS2 expression in spleen of tumor-bearing mouse (Fig. 8A). Also, G-MDSC were purified from tumor-bearing mouse to analysis the NOS2 and SOD1 level. Results showed that ESR2 level elevated in G-MDSC after quercetin treatment (Fig. 8C). The same results were also observed in humanderived MDSC (Fig. 8E). Indeed, activation of STAT3 increases NOS2 expression and thus generates nitric oxide in several types of cells [35,36]. However, there was no significant change in the SOD1 expression levels in mouse- and human-derived MDSC after quercetin stimulation (Fig. 8B, D, F). This likely reflects the fact that quercetin stimulation activates different intracellular signaling pathways in these two cell types: the antioxidant activity of quercetin in macrophages is mainly exerted via the PI3K/Akt/Nrf2 signal pathway [37], whereas ESR activation in MDSC depends on the STAT3 signaling pathway
4. Discussion Quercetin is a natural product ubiquitously present in vegetables and other plants [26]. Previous studies demonstrated that quercetin induced tumor cell necrosis by enhancing ROS via activating caspase-3 [19]. Antitumor activity of quercetin in prostate cancer [38], cervical cancer [39], lung cancer [40], colonic cancer [41], gastric cancer [42], liver cancer [43] and breast cancer [44] has been reported in vitro and in vivo [45]. Quercetin can also impact immune response in tumor microenvironment through multiple ways. Quercetin impacts a range of gene expressions profiles in monocytes, which associated with nucleic acid metabolism, apoptosis and O-glycan biosynthesis and immune 9
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
proliferation by exhausting L-arginine and producing nitric oxide [34]. Recently, Nikolaos and colleagues demonstrated that ESR signal activation promoted the proliferation of MDSC and enhanced their suppressive function through the STAT3 pathway [28], supporting that MDSC are modulated by quercetin by binding to ESR. In addition, ESRs can promote cancer-associated fibroblasts to secrete stromal-derived factor-1, recruit MDSC to the tumor microenvironment, and promote tumor progression [54]. Two ESRs have been identified to date: ESR1 and ESR2. ESR1 is mainly expressed in the ovary, endometrium, hypothalamus, breast, liver, and kidney, whereas ESR2 is prominently expressed in the ovary, central nervous system, bone, intestinal mucosa, prostate, and endothelial cells [55]. ESR1 and ESR2 share most of their homologous sequences in the DNA-binding domain, belonging to one of three functional domains of ESRs, with lower homology in the NH2terminal domain. Both E2 and quercetin can bind to ESR1 and ESR2 and influence cell function, differentiation, and proliferation [33,55,56]. The estrogen signaling pathway was strongly associated with the genes regulated by quercetin. Indeed, quercetin was reported to promote estrogen receptor-positive cell proliferation by binding to ESR, and both ESR1 and ESR2 are capable of binding to quercetin with different stimulation effects [33]. Activation of ESR1 and ESR2 by quercetin is 1.7-fold and 4.5-fold higher than by E2, respectively [33]. We also observed the up-regulation of ESR2 in mouse- and human- derived MDSC after quercetin stimulation, indicating that G-MDSC proliferation was mainly influenced by the ESR2 signaling pathway. ESR1 and ESR2 activation involves different signaling pathways. ESR1 mainly participates in cell growth via activating ERK/MAPK and PI3K/AKT signaling, whereas ESR2 modulates cell cycle-related genes and apoptosis by phosphorylating p38/MAPK [57,58]. Gene and transcripts analyses showed that more than 1400 genes are regulated by ESR1 after E2 stimulation; among these altered genes, ESR2 activation inhibited the expression of 998 genes [59]. The opposite pathway activation by ESR1 or ESR2 may account for the survival of G-MDSC and the apoptosis of M-MDSC after quercetin treatment in the present study. Along with up-regulating NOS2 secretion, quercetin shows potential as a natural product for strengthening the suppressive function of MDSC. Although previous studies showed that the antioxidant property of quercetin was mediated by SOD1 activation in macrophages [60,61], we did not detect any changes in SOD1 in MDSC. This likely reflects the fact that quercetin stimulation activates different intracellular signaling pathways in these two cell types: the antioxidant activity of quercetin in macrophages is mainly exerted via the PI3K/Akt/Nrf2 signal pathway [37], whereas ESR activation in MDSC depends on the STAT3 signaling pathway [28,29]. Indeed, we detected increased expression levels of pSTAT3 in MDSC after quercetin treatment. Quercetin-treated MDSC could acquire potent suppressive activity to significantly inhibit T cell proliferation. pSTAT3 in MDSC was previously shown to induce angiogenesis in the tumor microenvironment and promoted tumor progression [62]. pSTAT3 has also been directly related with the suppressive function of MDSC: STAT3 activation increased the NADPH oxidase level in tumor-bearing mice, which induced high ROS generation by MDSC [10]. Moreover, MDSC isolated from the livers of tumorbearing mice expressed more IDO and PD-L1 after STAT3 activation [63]. In patients with ankylosing spondylitis, a high percentage of MDSC suppressed T cell proliferation by exhausting L-arginine in a manner dependent on STAT3 phosphorylation [64]. Here, we showed that pSTAT3 elevation in MDSC leads to the up-regulation of NOS2 after stimulated with quercetin.
responses [46]. Administration of quercetin reduced percentage of circulating plasmacytoid DCs in vivo [47]. Quercetin can also decrease reactive oxygen species level in macrophages and inhibit LPS-induced DC activation by reducing the production of proinflammatory cytokines/chemokines section [47,48]. Most recently, different groups identified the effect of quercetin on the polarization of anti-inflammatory macrophages [49,50]. Dietary quercetin ameliorates collagen-induced arthritis in rats by remodeling the Th17/Treg balance via a heme oxygenase-1-dependent pathway [51]. However, as a critical element in modulating immune response during cancer progression, there has been no research on the effects of quercetin to MDSC until now. Here, we demonstrate a novel role of quercetin in promoting MDSC survival by activating ESR and increasing STAT3 phosphorylation. We found that quercetin stimulation enhanced the survival of BMderived CD11b+Gr-1+ cells, and human- and mouse-derived MDSC. Bioinformatics analysis identified 10 core genes associated with these effects of quercetin, including NOS2, ESR1, and ESR2, which are directly related to MDSC. In vitro experiments confirmed that quercetin enhanced the suppressive function of MDSC by up-regulating the mRNA level of NOS2 via activating ESR2. We also found that STAT3 phosphorylation is involved in NOS2 secretion. Thus, this study provides the first evidence that the natural product quercetin promoted MDSC survival and suppressive factors secretion by binding to ESR2 and increasing STAT3 phosphorylation. These findings highlight highlights dichotomous function of quercetin in antitumor therapy. Prolonged survival and enhanced suppressive factors secretion of G-MDSC may lead to impaired antitumor effect of quercetin and attenuate immune response during antitumor therapy consequently. Thus offer novel insight into the roles of quercetin during tumor therapy. MDSC have been reported to contribute to tumor growth and metastatic progression [52]. Accumulation of MDSC in patients attenuated anti–CTLA-4 and anti–PD-1-mediated immune responses in tumor therapy, which was associated with a poor prognosis; thus, targeting MDSC could enhance the anti-tumor therapeutic effect [5]. Although the anti-tumor effect of quercetin has been reported [53], this is the first demonstration to describe the relationship between quercetin and MDSC. As CD11b+Gr-1+ immature cells isolated from the femur and tibia of naive mice are generally not defined as MDSC due to their lack of or only weak suppressive capacity [31], we induced splenic MDSC expansion by subcutaneous injection of prostate cancer RM-1 cells in the flanks of male mice. Results showed that quercetin promotes the survival of BM myeloid cells, splenic MDSC from tumor-bearing mice, and MDSC from human cord blood myeloid cells. Further analysis showed that quercetin promotes the survival of G-MDSC but not MMDSC, indicating that different signaling pathways might activate these subpopulations. The complex interactions and relations between quercetin-associated genes has been a challenge in the research and application of quercetin along with other natural products [32]. Bioinformatics analysis is an effective method to study the biological function of natural products systematically. Here, we found over 6000 genes associated with quercetin by searching genes in three different databases (comparative toxicogenomics database, coremine database, pharmmapper database), and further focused on NOS2 and ESR. The online software Stitch was then used to predict interactions between quercetin and each of these genes. The chemical-genes network showed direct interactions between quercetin and ESR and NOS2 in addition to Rb1, APAF1, PARP1, and PTPN1 that modulate cell apoptosis and proliferation in an indirect manner. GO analysis revealed survival gene regulation GO:0045884 as one of the most significantly related functions of quercetin, indicating its proliferation modulation property. KEGG pathway analysis further indicated that the ESR signal hsa04915 was one of the most significantly related signal pathways related to quercetin, supporting the previous finding that quercetin promotes estrogen receptor-positive cell proliferation [33]. NOS2 is a key protein secreted by MDSC that inhibits T cell
5. Conclusion In conclusion, through in vitro experiments and bioinformatics analysis, we showed that quercetin promotes the survival and suppressive property of G-MDSC by up-regulating NOS2 secretion through activating ESR2 and STAT3. Thus impact of G-MDSC should be taken 10
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
into consideration when quercetin is applied to tumor therapy. Our results highlight the bidirectional function of quercetin in anti-tumor therapy; this ability to enhance the G-MDSC suppressive property provides a novel insight for therapeutic intervention in clinical trials.
[20] Z. Zhang, S. Xu, Y. Wang, Y. Yu, F. Li, H. Zhu, Y. Shen, S. Huang, S. Guo, Nearinfrared triggered co-delivery of doxorubicin and quercetin by using gold nanocages with tetradecanol to maximize anti-tumor effects on MCF-7/ADR cells, J. Colloid Interface Sci. 509 (2018) 47–57. [21] S. Sun, F. Gong, P. Liu, Q. Miao, Metformin combined with quercetin synergistically repressed prostate cancer cells via inhibition of VEGF/PI3K/Akt signaling pathway, Gene 664 (2018) 50–57. [22] H. Yuan, Q. Ma, L. Ye, G. Piao, The traditional medicine and modern medicine from natural products, Molecules 21 (5) (2016). [23] H.S. Choi, M.K. Kim, Y.K. Choi, Y.C. Shin, S.G. Cho, S.G. Ko, Rhus verniciflua Stokes (RVS) and butein induce apoptosis of paclitaxel-resistant SKOV-3/PAX ovarian cancer cells through inhibition of AKT phosphorylation, BMC Complement. Altern. Med. 16 (2016) 122. [24] Z.M, L.B. Si, Q. Han, J.N. Huang, X. Long, F. Long, R.C. Zhao, J.Z. Huang, Z.F. Liu, R. Zhao, H.L. Zhang, X.J. Wang, Sensitization of keloid fibroblasts by quercetin through the PI3K/Akt pathway is dependent on regulation of HIF-1α, Am. J. Transl. Res. (2018). [25] S.L. Miles, M. McFarland, R.M. Niles, Molecular and physiological actions of quercetin: need for clinical trials to assess its benefits in human disease, Nutr. Rev. 72 (11) (2014) 720–734. [26] Y. Li, J. Yao, C. Han, J. Yang, M.T. Chaudhry, S. Wang, H. Liu, Y. Yin, Quercetin, inflammation and immunity, Nutrients 8 (3) (2016) 167. [27] R. Kleemann, L. Verschuren, M. Morrison, S. Zadelaar, M.J. van Erk, P.Y. Wielinga, T. Kooistra, Anti-inflammatory, anti-proliferative and anti-atherosclerotic effects of quercetin in human in vitro and in vivo models, Atherosclerosis 218 (1) (2011) 44–52. [28] N. Svoronos, A. Perales-Puchalt, M.J. Allegrezza, M.R. Rutkowski, K.K. Payne, A.J. Tesone, J.M. Nguyen, T.J. Curiel, M.G. Cadungog, S. Singhal, E.B. Eruslanov, P. Zhang, J. Tchou, R. Zhang, J.R. Conejo-Garcia, Tumor cell-independent estrogen signaling drives disease progression through mobilization of myeloid-derived suppressor cells, Cancer Discov. 7 (1) (2017) 72–85. [29] L.Z.T. Pan, S. Wu, Q.Y.Y. Cao, Z. Cai, X. Cai, N.M.W. Zhao, W. Zhang, H.Z. Zhou, 17b-Oestradiol enhances the expansion and activation of myeloid-derived suppressor cells via signal transducer and activator of transcription (STAT)23 signalling in human pregnancy, Clin. Exp. Immunol. (2016). [30] H. Wu, Y. Zhen, Z. Ma, H. Li, J. Yu, Z.G. Xu, X.Y. Wang, H. Yi, Y.G. Yang, Arginase1-dependent promotion of TH17 differentiation and disease progression by MDSCs in systemic lupus erythematosus, Sci. Transl. Med. 8 (331) (2016) 331ra40. [31] K.H. Parker, D.W. Beury, S. Ostrand-Rosenberg, Myeloid-derived suppressor cells: critical cells driving immune suppression in the tumor microenvironment, Adv. Cancer Res. 128 (2015) 95–139. [32] Y. Chen, C. de Bruyn Kops, J. Kirchmair, Data resources for the computer-guided discovery of bioactive natural products, J. Chem. Inf. Model. 57 (9) (2017) 2099–2111. [33] H. van der Woude, M.G. Ter Veld, N. Jacobs, P.T. van der Saag, A.J. Murk, I.M. Rietjens, The stimulation of cell proliferation by quercetin is mediated by the estrogen receptor, Mol. Nutr. Food Res. 49 (8) (2005) 763–771. [34] H.F. A.D. Peñaloza, N. Muñoz-Durango, B.M. Schultz, P.A. González, A.M. Kalergis, S.M. Bueno, The role of myeloid-derived suppressor cells in chronic infectious diseases and the current methodology available for their study, J. Leukoc. Biol. (2018). [35] H.C. Chong, J.S. Chan, C.Q. Goh, N.V. Gounko, B. Luo, X. Wang, S. Foo, M.T. Wong, C. Choong, S. Kersten, N.S. Tan, Angiopoietin-like 4 stimulates STAT3-mediated iNOS expression and enhances angiogenesis to accelerate wound healing in diabetic mice, Mol. Ther. 22 (9) (2014) 1593–1604. [36] T. Condamine, D.I. Gabrilovich, Molecular mechanisms regulating myeloid-derived suppressor cell differentiation and function, Trends Immunol. 32 (1) (2011) 19–25. [37] G.J. Shi, Y. Li, Q.H. Cao, H.X. Wu, X.Y. Tang, X.H. Gao, J.Q. Yu, Z. Chen, Y. Yang, In vitro and in vivo evidence that quercetin protects against diabetes and its complications: a systematic review of the literature, Biomed. Pharmacother. 109 (2019) 1085–1099. [38] R. Tummala, W. Lou, A.C. Gao, N. Nadiminty, Quercetin targets hnRNPA1 to overcome enzalutamide resistance in prostate cancer cells, Mol. Cancer Ther. 16 (12) (2017) 2770–2779. [39] T.H. Lin, W.H. Hsu, P.H. Tsai, Y.T. Huang, C.W. Lin, K.C. Chen, I.H. Tsai, C.C. Kandaswami, C.J. Huang, G.D. Chang, M.T. Lee, C.H. Cheng, Dietary flavonoids, luteolin and quercetin, inhibit invasion of cervical cancer by reduction of UBE2S through epithelial-mesenchymal transition signaling, Food Funct. 8 (4) (2017) 1558–1568. [40] Z. Xingyu, M. Peijie, P. Dan, W. Youg, W. Daojun, C. Xinzheng, Z. Xijun, S. Yangrong, Quercetin suppresses lung cancer growth by targeting Aurora B kinase, Cancer Med. 5 (11) (2016) 3156–3165. [41] S.B. Raja, V. Rajendiran, N.K. Kasinathan, A.P.S. Venkatabalasubramanian, M.R. Murali, H. Devaraj, S.N. Devaraj, Differential cytotoxic activity of Quercetin on colonic cancer cells depends on ROS generation through COX-2 expression, Food Chem. Toxicol. 106 (Pt A) (2017) 92–106. [42] H.S. Shang, H.F. Lu, C.H. Lee, H.S. Chiang, Y.L. Chu, A. Chen, Y.F. Lin, J.G. Chung, Quercetin induced cell apoptosis and altered gene expression in AGS human gastric cancer cells, Environ. Toxicol. 33 (11) (2018) 1168–1181. [43] K.W. Ren, Y.H. Li, G. Wu, J.Z. Ren, H.B. Lu, Z.M. Li, X.W. Han, Quercetin nanoparticles display antitumor activity via proliferation inhibition and apoptosis induction in liver cancer cells, Int. J. Oncol. 50 (4) (2017) 1299–1311. [44] L. Jia, S. Huang, X. Yin, Y. Zan, Y. Guo, L. Han, Quercetin suppresses the mobility of breast cancer by suppressing glycolysis through Akt-mTOR pathway mediated autophagy induction, Life Sci. 208 (2018) 123–130. [45] M. Hashemzaei, A. Delarami Far, A. Yari, R.E. Heravi, K. Tabrizian, S.M. Taghdisi,
Funding This work was supported by the grants from the National Natural Science Foundation of China (81671592 to H.Y); Science and Technology Department of Jilin Province (20190201140JC to H.Y.) Declaration of Competing Interest The authors declare no competing interests. Appendix A. Supplementary data Supplementary material related to this article can be found, in the online version, at doi:https://doi.org/10.1016/j.biopha.2020.109922. References [1] L.A. Torre, F. Bray, R.L. Siegel, J. Ferlay, J. Lortet-Tieulent, A. Jemal, Global cancer statistics, 2012, CA Cancer J. Clin. 65 (2) (2015) 87–108. [2] P. Qu, L.Z. Wang, P.C. Lin, Expansion and functions of myeloid-derived suppressor cells in the tumor microenvironment, Cancer Lett. 380 (1) (2016) 253–256. [3] J.E. Talmadge, D.I. Gabrilovich, History of myeloid-derived suppressor cells, Nat. Rev. Cancer 13 (10) (2013) 739–752. [4] K.R. Jordan, R.N. Amaria, O. Ramirez, E.B. Callihan, D. Gao, M. Borakove, E. Manthey, V.F. Borges, M.D. McCarter, Myeloid-derived suppressor cells are associated with disease progression and decreased overall survival in advanced-stage melanoma patients, Cancer Immunol. Immunother. CII 62 (11) (2013) 1711–1722. [5] J.A. Chesney, R.A. Mitchell, K. Yaddanapudi, Myeloid-derived suppressor cells-a new therapeutic target to overcome resistance to cancer immunotherapy, J. Leukoc. Biol. 102 (3) (2017) 727–740. [6] K. Ohl, K. Tenbrock, Reactive oxygen species as regulators of MDSC-Mediated immune suppression, Front. Immunol. 9 (2018) 2499. [7] D.D. Patel, V.K. Kuchroo, Th17 cell pathway in human immunity: lessons from genetics and therapeutic interventions, Immunity 43 (6) (2015) 1040–1051. [8] A. Pastaki Khoshbin, M. Eskian, M. Keshavarz-Fathi, N. Rezaei, Roles of myeloidderived suppressor cells in Cancer metastasis: immunosuppression and beyond, Archivum Immunologiae et Therapiae Experimentalis (2018). [9] M. Vlkova, Z. Chovancova, J. Nechvatalova, A.N. Connelly, M.D. Davis, P. Slanina, L. Travnickova, M. Litzman, T. Grymova, P. Soucek, T. Freiberger, J. Litzman, Z. Hel, Neutrophil and granulocytic myeloid-derived suppressor cell-mediated T cell suppression significantly contributes to immune dysregulation in common variable immunodeficiency disorders, J. Immunol. (2018). [10] C.A. Corzo, M.J. Cotter, P. Cheng, F. Cheng, S. Kusmartsev, E. Sotomayor, T. Padhya, T.V. McCaffrey, J.C. McCaffrey, D.I. Gabrilovich, Mechanism regulating reactive oxygen species in tumor-induced myeloid-derived suppressor cells, J. Immunol. 182 (9) (2009) 5693–5701. [11] M. Szwed, K.D. Kania, Z. Jozwiak, Molecular damage caused by generation of reactive oxygen species in the redox cycle of doxorubicin-transferrin conjugate in human leukemia cell lines, Leuk. Lymphoma 56 (5) (2015) 1475–1483. [12] P.L. Raber, P. Thevenot, R. Sierra, D. Wyczechowska, D. Halle, M.E. Ramirez, A.C. Ochoa, M. Fletcher, C. Velasco, A. Wilk, K. Reiss, P.C. Rodriguez, Subpopulations of myeloid-derived suppressor cells impair T cell responses through independent nitric oxide-related pathways, Int. J. Cancer 134 (12) (2014) 2853–2864. [13] S. Solito, I. Marigo, L. Pinton, V. Damuzzo, S. Mandruzzato, V. Bronte, Myeloidderived suppressor cell heterogeneity in human cancers, Ann. N. Y. Acad. Sci. 1319 (2014) 47–65. [14] E. Tcyganov, J. Mastio, E. Chen, D.I. Gabrilovich, Plasticity of myeloid-derived suppressor cells in cancer, Curr. Opin. Immunol. 51 (2018) 76–82. [15] A. Heine, C. Flores, H. Gevensleben, L. Diehl, M. Heikenwalder, M. Ringelhan, K.P. Janssen, U. Nitsche, N. Garbi, P. Brossart, P.A. Knolle, C. Kurts, B. Hochst, Targeting myeloid derived suppressor cells with all-trans retinoic acid is highly time-dependent in therapeutic tumor vaccination, Oncoimmunology 6 (8) (2017) e1338995. [16] R. Weber, V. Fleming, X. Hu, V. Nagibin, C. Groth, P. Altevogt, J. Utikal, V. Umansky, Myeloid-derived suppressor cells hinder the anti-cancer activity of immune checkpoint inhibitors, Front. Immunol. 9 (2018) 1310. [17] T. Xie, S. Song, S. Li, L. Ouyang, L. Xia, J. Huang, Review of natural product databases, Cell Prolif. 48 (4) (2015) 398–404. [18] A.L. Demain, P. Vaishnav, Natural products for cancer chemotherapy, Microb. Biotechnol. 4 (6) (2011) 687–699. [19] S.T. Chan, C.H. Chuang, Y.C. Lin, J.W. Liao, C.K. Lii, S.L. Yeh, Quercetin enhances the antitumor effect of trichostatin A and suppresses muscle wasting in tumorbearing mice, Food Funct. 9 (2) (2018) 871–879.
11
Biomedicine & Pharmacotherapy 125 (2020) 109922
Z. Ma, et al.
[46]
[47]
[48]
[49]
[50]
[51]
[52]
[53]
[54]
accumulation of MDSCs in the tumor microenvironment, Sci. Rep. 6 (2016) 39541. [55] M. Jia, K. Dahlman-Wright, J.A. Gustafsson, Estrogen receptor alpha and beta in health and disease, best practice & research, Clin. Endocrinol. Metab. 29 (4) (2015) 557–568. [56] J.M. Hall, J.F. Couse, K.S. Korach, The multifaceted mechanisms of estradiol and estrogen receptor signaling, J. Biol. Chem. 276 (40) (2001) 36869–36872. [57] Y. Liang, H. Xie, J. Wu, D. Liu, S. Yao, Villainous role of estrogen in macrophagenerve interaction in endometriosis, Reprod. Biol. Endocrinol. 16 (1) (2018) 122. [58] F. Acconcia, P. Totta, S. Ogawa, I. Cardillo, S. Inoue, S. Leone, A. Trentalance, M. Muramatsu, M. Marino, Survival versus apoptotic 17beta-estradiol effect: role of ER alpha and ER beta activated non-genomic signaling, J. Cell. Physiol. 203 (1) (2005) 193–201. [59] C. Williams, K. Edvardsson, S.A. Lewandowski, A. Strom, J.A. Gustafsson, A genome-wide study of the repressive effects of estrogen receptor beta on estrogen receptor alpha signaling in breast cancer cells, Oncogene 27 (7) (2008) 1019–1032. [60] B. Nambooppha, K. Photichai, K. Wongsawan, P. Chuammitri, Quercetin manipulates the expression of genes involved in the reactive oxygen species (ROS) process in chicken heterophils, J. Vet. Med. Sci. 80 (8) (2018) 1204–1211. [61] K. Min, S.E. Ebeler, Quercetin inhibits hydrogen peroxide-induced DNA damage and enhances DNA repair in Caco-2 cells, Food Chem. Toxicol. 47 (11) (2009) 2716–2722. [62] M. Kujawski, M. Kortylewski, H. Lee, A. Herrmann, H. Kay, H. Yu, Stat3 mediates myeloid cell-dependent tumor angiogenesis in mice, J. Clin. Invest. 118 (10) (2008) 3367–3377. [63] M. Thorn, P. Guha, M. Cunetta, N.J. Espat, G. Miller, R.P. Junghans, S.C. Katz, Tumor-associated GM-CSF overexpression induces immunoinhibitory molecules via STAT3 in myeloid-suppressor cells infiltrating liver metastases, Cancer Gene Ther. 23 (6) (2016) 188–198. [64] Y.F. Liu, K.H. Zhuang, B. Chen, P.W. Li, X. Zhou, H. Jiang, L.M. Zhong, F.B. Liu, Expansion and activation of monocytic-myeloid-derived suppressor cell via STAT3/ arginase-I signaling in patients with ankylosing spondylitis, Arthritis Res. Ther. 20 (1) (2018) 168.
S.E. Sadegh, K. Tsarouhas, D. Kouretas, G. Tzanakakis, D. Nikitovic, N.Y. Anisimov, D.A. Spandidos, A.M. Tsatsakis, R. Rezaee, Anticancer and apoptosisinducing effects of quercetin in vitro and in vivo, Oncol. Rep. 38 (2) (2017) 819–828. I. Boomgaarden, S. Egert, G. Rimbach, S. Wolffram, M.J. Muller, F. Doring, Quercetin supplementation and its effect on human monocyte gene expression profiles in vivo, Br. J. Nutr. 104 (3) (2010) 336–345. T. Nickel, H. Hanssen, Z. Sisic, S. Pfeiler, C. Summo, D. Schmauss, E. Hoster, M. Weis, Immunoregulatory effects of the flavonol quercetin in vitro and in vivo, Eur. J. Nutr. 50 (3) (2011) 163–172. R.Y. Huang, Y.L. Yu, W.C. Cheng, C.N. OuYang, E. Fu, C.L. Chu, Immunosuppressive effect of quercetin on dendritic cell activation and function, J. Immunol. 184 (12) (2010) 6815–6821. Z.P. Li, H.B. Liu, Q.W. Zhang, L.F. Li, W.R. Bao, D.L. Ma, C.H. Leung, Z.X. Bian, A.P. Lu, Q.B. Han, Interference of quercetin on Astragalus polysaccharide-Induced macrophage activation, Molecules 23 (7) (2018). H. Lu, L. Wu, L. Liu, Q. Ruan, X. Zhang, W. Hong, S. Wu, G. Jin, Y. Bai, Quercetin ameliorates kidney injury and fibrosis by modulating M1/M2 macrophage polarization, Biochem. Pharmacol. 154 (2018) 203–212. Y. Yang, X. Zhang, M. Xu, X. Wu, F. Zhao, C. Zhao, Quercetin attenuates collageninduced arthritis by restoration of Th17/Treg balance and activation of Heme Oxygenase 1-mediated anti-inflammatory effect, Int. Immunopharmacol. 54 (2018) 153–162. V. Kumar, S. Patel, E. Tcyganov, D.I. Gabrilovich, The nature of myeloid-derived suppressor cells in the tumor microenvironment, Trends Immunol. 37 (3) (2016) 208–220. L. Yi, Y. Zongyuan, G. Cheng, Z. Lingyun, Y. Guilian, G. Wei, Quercetin enhances apoptotic effect of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) in ovarian cancer cells through reactive oxygen species (ROS) mediated CCAAT enhancer-binding protein homologous protein (CHOP)-death receptor 5 pathway, Cancer Sci. 105 (5) (2014) 520–527. L. Ouyang, W. Chang, B. Fang, J. Qin, X. Qu, F. Cheng, Estrogen-induced SDF1alpha production promotes the progression of ER-negative breast cancer via the
12