STMN1 as a candidate gene associated with atypical meningioma progression

Accepted Manuscript Title: STMN1 as a candidate gene associated with atypical meningioma progression Authors: Haiyu Liu, Ye Li, Yunbo Li, Lixiang Zhou, Li Bie PII: DOI: Reference:

S0303-8467(17)30169-5 http://dx.doi.org/doi:10.1016/j.clineuro.2017.06.003 CLINEU 4715

To appear in:

Clinical Neurology and Neurosurgery

Received date: Revised date: Accepted date:

5-4-2017 1-6-2017 5-6-2017

Please cite this article as: Liu Haiyu, Li Ye, Li Yunbo, Zhou Lixiang, Bie Li.STMN1 as a candidate gene associated with atypical meningioma progression.Clinical Neurology and Neurosurgery http://dx.doi.org/10.1016/j.clineuro.2017.06.003 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

STMN1 as a candidate gene associated with atypical meningioma progression Haiyu Liu1, §, Ye Li1, §, Yunbo Li1, §, Lixiang Zhou1, §, Li Bie1, 2, * 1Department

of Neurosurgery of the First Clinical Hospital, Jilin University, Changchun, China; 2Department of

Pathology & Laboratory Medicine, University of California, Irvine, CA, USA * Corresponding author E-mail address:[email protected] §These

authors contributed equally to this work

Highlights 1. Atypical meningiomas are difficult to manage due to frequent disease recurrence.

2. Stathmin (STMN1) play an important role in atypical meningioma recurrence. 3. STMN1 expression might serve as a biomarker for determining atypical meningioma prognosis.

Abstract Objectives: Meningiomas are the most common type of primary intracranial tumor. Atypical meningiomas are especially difficult to manage due to frequent disease recurrence. This study aimed to examine the role of stathmin (coded by the gene STMN1) as a factor in atypical meningioma recurrence. Patients and Methods: A total of 59 sporadic atypical meningioma formalin-fixed paraffin-embedded (FFPE) samples were collected. The mRNA levels of the biomarker gene STMN1 were tested using quantitative RT-PCR. Results: We observed significant up-regulation of STMN1 mRNA expression in recurrent tumors in comparison with primary tumors (p < 0.05). Moreover, mRNA expression levels of STMN1 significantly correlated with Ki-67 score (r = 0.93, p < 0.01). Multivariate survival analyses indicated that high expression of STMN1, high Ki-67 score, and more advanced patient age at diagnosis (>60 yrs) each act as independence prognostic factors for recurrence. Kaplan-Meier analysis revealed that STMN1 expression pattern could effectively predict prognosis of atypical meningioma in patients (p < 0.01). Conclusions: Our study indicates for the first time that an increased risk of sporadic atypical meningioma recurrence can be found in cases with elevated expression of STMN1. These results suggest that STMN1 expression might serve as a biomarker for determining patient atypical meningioma prognosis.

1

Keywords: Meningioma; STMN1; Biomarker; Recurrence

1. Introduction Meningiomas, tumors that originate from meningothelial cells, account for approximately 30% of all new diagnoses of central nervous system (CNS) neoplasms [1]. According to the 2007 WHO classification of CNS tumors [2], meningiomas are classified into three grades, I, II, and III. Atypical meningiomas are “intermediate grade” malignancies (WHO grade II) that account for 4.7%-7.2% of meningiomas and are associated with a 29%-52% post-resection recurrence rate [2, 3]. Meningioma progression involves partial or complete loss of multiple chromosomes. In addition, mutations of the NF2 gene (neurofibromin 2, located on chromosome 22) are detected with the same frequency for all grades of meningiomas; thus, a shared mutagenic event is thought to be an early genetic event in meningioma tumorigenesis overall [1, 4]. Past studies have shown that the risk of meningioma recurrence is strongly correlated with the molecular profile of the tumor [5]. Recently, the development of microarrays for analysis of large numbers of tumor samples has served as a powerful tool to identify meningioma prognostic biomarkers. Utilizing this technology, in our recent study we found that elevated expression levels of several genes significantly correlated with meningioma grade. Here we expanded on that work and studied one such gene, STMN1, the expression of which was significantly up-regulated in grade II meningiomas. STMN1 is an important microtubule depolymerization protein that regulates its own activity through phosphorylation to alter the dynamic balance of the microtubule system [6]. Over-expression of STMN1 has been reported in several types of tumors and is associated with tumor aggressiveness [7]. Consequently, STMN1 has been shown to be involved in invasion, metastasis, and drug resistance of neuronal tumor cells [8-10]. STMN1 also regulates cell cycling and its expression is associated with specific cell cycle phase and is negatively regulated by p53 activation and p21 (8). However, little is known about the clinical significance of STMN1 expression pattern for patients with atypical meningiomas. In the present study we examined the prognostic value of STMN1 mRNA expression levels based upon quantitative reverse transcription polymerase chain reaction (qRT-PCR) and microarray data analysis. We demonstrate here that STMN1 serves as a potential biomarker for prediction of both atypical meningioma malignancy and recurrence.

2

2. Materials and methods 2.1. Patients and tumor samples Tumor tissue specimens from 59 primary sporadic atypical meningiomas were collected by the Department of Neurosurgery of the First Affiliated Hospital of Jilin University from 2005 to 2014. All sample collections followed protocols that had been approved by the institutional review board (IRB 00008484). Tumors were surgically removed from 59 adult patients (26 females and 33 males with mean ages at diagnosis of 55.8±13.2 years, ranging in age from 21 to 81 years). All patients underwent Simpson grades I or II total resections (TR) as a first surgical treatment. No patients received adjuvant therapy before surgery. We subsequently evaluated recurrence using radiological imaging at follow-up. All patient samples were histologically reviewed according to the WHO 2007 classification of CNS tumors [2]; we confirmed that all samples were classified as atypical meningiomas (WHO grade II). Parts of each tumor were formalin-fixed and paraffin-embedded (FFPE) after surgery. The samples were histologically reviewed for specimen adequacy (samples were required to be at least 80% tumor cells). 2.2. RNA isolation and cDNA synthesis Total RNA was extracted from each tumor sample using QuickExtract™ FFPE RNA Extraction Kit (Epicentre, Madison, WI, USA) according to the manufacturer's instructions. The 28S/18S ratios for all RNA samples were greater than 1.5. Next, cDNA synthesis was performed using SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA) using 300 ng total RNA following the manufacturer’s protocol. 2.3. Quantitative real-time PCR All gene expression assays were performed using the ABI Prism 7900HT Sequence Detection System (Applied Biosystems, Foster City, CA, USA) with recommended default settings. All assays were prepared with 1 × SYBR Green PCR SuperMix (BioPioneer, San Diego, CA, USA). Levels of mRNA were normalized to mRNA levels of the endogenous reference gene β-actin. Relative fold changes were calculated using the Pfaffl method [11] for each gene and were corrected for sample loading using β-actin. Primers were synthesized by Takara (Japan) with the following sequences: STMN1 5′- TGTCGCTTG TCTTCTATTCACCAT -3′ (sense), 5′- CTTTTGACCGAGGGCTGAGA -3′ (antisense); β-actin 5′CCACGAAACTACCTTCAACTCCA -3′ (sense), 5′- GTGATCTCCTTCTGCATCCTGTC -3′ (antisense);

3

The absence of primer-dimer formation was tested using agarose gel electrophoresis. Each sample was run in triplicate. 2.4. Microarray dataset analysis One independent external microarray dataset (WHO grade II 19, Table 1) was analyzed using the WebArrayDB cross-platform analysis suite (http://www.webarraydb.org) to validate our experimental results [12]. Data were analyzed with the WebArrayDB cross-platform analysis suite using an ANCOVA (analysis of covariance) model for recurrence. Genes were sorted in ascending order according to the p values for the recurrence factor. 2.5. Statistical analysis Variables are presented as mean value ± standard deviation. For comparison of different groups, the ANCOVA test was used. The Cox proportional hazards model for multivariate survival analysis was used to assess predictors of recurrence and survival. Disease-free survival (DFS) was assessed using the Kaplan-Meier method and survival curves were calculated. A significance level of 0.05 was selected for statistical testing of hypotheses. Statistical analysis was performed using SPSS software version 17.0 (SPSS Inc., Chicago, IL, USA) 3. Results 3.1. Patients’ clinical characteristics A total of 59 atypical meningioma patients were included in the study and treated within the defined study period. The mean age at diagnosis was 55.8 years (range 21–81 years) and patients had undergone Simpson I or II resections. The recurrent group exhibited higher Ki-67 scores (cut-off score, 15%) than did the no-recurrence patient group (70.4% vs. 31.3%, p < 0.01) (Table 2). 3.2. Genes were selected from microarray datasets We had previously demonstrated that several genes exhibit expression patterns that correlated with tumor recurrence. We focused on STMN1 because in our past study we had found that STMN1 correlated with progression of meningiomas (Table 2). Here, STMN1 mRNA levels were compared between the no-recurrence group and the recurrent group. To compare STMN1 expression levels in 32 primary and 27 recurrent meningiomas, we examined mRNA levels using qRT-PCR. When analyzing the mRNA levels of

4

STMN1 in the two groups, we found an average increase in STMN1 (1.7-fold) expression in the recurrent group compared with the no-recurrence group (p < 0.05). 3.3. Analysis of survival time in meningioma patients with atypical meningiomas We performed a Cox regression analysis to evaluate the expression of STMN1 in patients. Multivariate survival analyses indicated that high expression of STMN1, along with high Ki-67 scores and advanced age at diagnosis (>60 yrs), acted as independent prognostic factors for survival times (Table 3). Furthermore, expression levels of STMN1 were significantly correlated with Ki-67 score (r = 0.93, p < 0.01). In the search for a model to describe the relationship between patient survival and expression of STMN1 using maximally selected log-rank statistics, a cut-point model was determined to be the most suitable; this model was used to delineate two subgroups of patients with meningiomas. Applying the STMN1 expression level cut-off score to the Kaplan-Meier survival curve estimation revealed a decreased probability of survival for patients with tumors expressing high STMN1 mRNA levels (p < 0.01) (Figure. 1). Therefore, for patients with atypical meningiomas, the two subgroups exhibited significantly distinct outcomes.

4. Discussion STMN1 is an important microtubule depolymerization protein that regulates its own activity through phosphorylation to control the dynamic balance of the microtubule system [6]. A previous study had found that STMN1 expression is inversely correlated to malignancy in lung cancer. Furthermore, higher expression of STMN1 correlated with both a lower degree of cellular differentiation and worse prognosis than did lower STMN1 expression. Moreover, STMN1 expression was associated with migration of tumor cells [13]. The mechanisms by which STNMI exerts its influence are not yet known. In general, upon adhesion to the basement membrane, tumor cells produce protein kinases that cause dissolution of the extracellular matrix (ECM); such activities allow tumor infiltration into the surrounding tissue and metastasis. Indeed, phosphorylation of STMN1 in tumor cells changes during adhesion to the basement membrane and subsequent ECM dissolution; thus the STMN1 protein may play a role in tumor progression [14]. Furthermore, reducing STMN1 expression in glioma cells has been demonstrated to reduce the ability of tumor cells to migrate, with subsequent reduction of local infiltration and distant metastasis [15]. Notably, atypical meningiomas exhibit a malignant tendency that results in progression of tumors from less aggressive to more aggressive forms, ultimately resulting in significant migration and infiltration [16]. In

5

the present study, we investigated the role of STMN1 in recurrence of atypical meningiomas. Our findings revealed that mRNA levels of STMN1 were significantly up-regulated in the recurrent group compared with the no-recurrence group (p < 0.05). Moreover, expression levels of STMN1 were significantly correlated with Ki-67 score, a measure of proliferation. Given the role of STMN1 in regulating the kinetics of the microtubule system to control the cell cycle, cell proliferation, and differentiation [17], it follows that up-regulation of tumor STMN1 expression may impact patient prognosis. So far, high expression of STMN1 has been observed in respiratory tumors [18], digestive system tumors [19, 20], gynecological tumors [21], and urinary tract tumors [22, 23], supporting an important role for STMN1 in tumorigenesis. Moreover, STMN1 has been correlated with migration and invasion in several kinds of neurological tumors [10, 24]. In agreement with our past recent study, we found that STMN1 mRNA levels were significantly higher in aggressive meningiomas, including atypical and anaplastic/malignant meningiomas. Moreover, atypical meningioma STMN1 mRNA levels were increased in the recurrent group vs. levels in the no-recurrence group. Therefore, over-expression of STMN1 is an independent risk factor for recurrence of atypical meningiomas, ultimately linking STMN1 expression to patient survival. The Ki-67 score, useful for analysis of proliferative potential, also correlates with meningioma histopathologic grade. Previous studies demonstrated that the mean Ki-67 score is 2.1% to 9.3% for atypical meningiomas [25]. Mirroring observations for STMN1, the Ki-67 score has been found to be an independent predictor of both tumor recurrence and overall survival in patients with atypical meningiomas [26]. In this study, we observed that STMN1 had a strong correlation with Ki-67 score. These results demonstrate the power of using a combination of microarray datasets with qRT-PCR for identification of potent candidate genes that are predictive of atypical meningioma recurrence. Using this strategy, STMN1 was identified as a useful clinical marker for predicting recurrence. While the results reported here are promising, validation of these findings will require confirmation using a study with a larger sample size. 5. Conclusion In conclusion, our study confirmed that an increased risk of sporadic atypical meningioma recurrence can be found in cases with elevated expression of STMN1. It holds promise as a target for pharmacological interventions that someday could improve patient cure rates for atypical meningioma. Conflict of interests

6

The authors declare that there is no conflict of interest regarding the publication of this paper. Acknowledgments This work was supported by the National Natural Science Foundation of China (numbers 81201980 and 81572476) and the Natural Science Foundation of Jilin Province, China (number 20130522028JH). The data sets supporting the conclusion of this article are included within the article. Any request for data and material may be sent to the corresponding author. Ethics approval and consent to participate The research has been performed in accordance with the Declaration of Helsinki and has been approved by the First Hospital of Jilin University ethics committee (IRB00008484)

References 1. Whittle IR, Smith C, Navoo P, Collie D. Meningiomas. Lancet 2004;363:1535-1543. 2. Louis DN OH, Wiestler OD, etal (Eds). WHO classfication of tumors of the central nervous system. . IARC: Lyon 2007. 3. Kshettry VR, Ostrom QT, Kruchko C, Al-Mefty O, Barnett GH, Barnholtz-Sloan JS. Descriptive epidemiology of World Health Organization grades II and III intracranial meningiomas in the United States. Neuro Oncol 2015;17:1166-1173. 4. Shoshan Y, Chernova O, Juen SS, Somerville RP, Israel Z, Barnett GH, Cowell JK. Radiation-induced meningioma: a distinct molecular genetic pattern? J Neuropathol Exp Neurol 2000;59:614-620. 5. Bi WL, Mei Y, Agarwalla PK, Beroukhim R, Dunn IF. Genomic and Epigenomic Landscape in Meningioma. Neurosurg Clin N Am 2016;27:167-179. 6. Oda T, Hirokawa N, Kikkawa M. Three-dimensional structures of the flagellar dynein-microtubule complex by cryoelectron microscopy. J Cell Biol 2007;177:243-252. 7. Biaoxue R, Xiguang C, Hua L, Shuanying Y. Stathmin-dependent molecular targeting therapy for malignant tumor: the latest 5 years' discoveries and developments. J Transl Med2016;14:279. 8. Wang R, Wang Z, Yang J, Liu X, Wang L, Guo X, Zeng F, Wu M, Li G. LRRC4 inhibits the proliferation of human glioma cells by modulating the expression of STMN1 and microtubule polymerization. J Cell Biochem 2011;112:3621-3629. 9. Fife CM, Sagnella SM, Teo WS, Po'uha ST, Byrne FL, Yeap YY, Ng DC, Davis TP, McCarroll JA, Kavallaris M. Stathmin mediates neuroblastoma metastasis in a tubulin-independent manner via RhoA/ROCK signaling and enhanced transendothelial migration. Oncogene 2016;36:501-511. 10. Song Y, Mu L, Han X, Liu X, Fu S. siRNA targeting stathmin inhibits invasion and enhances chemotherapy sensitivity of stem cells derived from glioma cell lines. Acta Biochim Biophys Sin (Shanghai) 2014;46:1034-1040. 11. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45. 12. Lee Y, Liu J, Patel S, Cloughesy T, Lai A, Farooqi H, Seligson D, Dong J, Liau L, Becker D, Mischel P, Shams S, Nelson S. Genomic landscape of meningiomas. Brain Pathol 2010;20:751-762. 13. Chen G, Wang H, Gharib TG, Huang CC, Thomas DG, Shedden KA, Kuick R, Taylor JM, Kardia SL, Misek DE, Giordano TJ, Iannettoni MD, Orringer MB, Hanash SM, Beer DG. Overexpression of oncoprotein 18 correlates with poor differentiation in lung adenocarcinomas. Mol Cell Proteomics 2003;2:107-116. 14. Ringhoff DN, Cassimeris L. Gene expression profiles in mouse embryo fibroblasts lacking stathmin, a microtubule regulatory protein, reveal changes in the expression of genes contributing to cell motility. BMC Genomics 2009;10:343. 15. Liang XJ, Choi Y, Sackett DL, Park JK. Nitrosoureas inhibit the stathmin-mediated migration and invasion of malignant glioma cells. Cancer Res 2008;68:5267-5272. 16. Nanda A, Bir SC, Konar S, Maiti T, Kalakoti P, Jacobsohn JA, Guthikonda B. Outcome of resection of WHO Grade II meningioma and correlation of pathological and radiological predictive factors for recurrence. J Clin Neurosci 2016;31:112-121. 17. Ozon S, Maucuer A, Sobel A. The stathmin family -- molecular and biological characterization of novel mammalian proteins expressed in the nervous system. Eur J Biochem 1997;248:794-806.

7

18. Sun R, Liu Z, Wang L, Lv W, Liu J, Ding C, Yuan Y, Lei G, Xu C. Overexpression of stathmin is resistant to paclitaxel treatment in patients with non-small cell lung cancer. Tumour Biol 2015;36:7195-7204. 19. Jeon TY, Han ME, Lee YW, Lee YS, Kim GH, Song GA, Hur GY, Kim JY, Kim HJ, Yoon S, Baek SY, Kim BS, Kim JB, Oh SO. Overexpression of stathmin1 in the diffuse type of gastric cancer and its roles in proliferation and migration of gastric cancer cells. Br J Cancer 2010;102:710-718. 20. Hsieh SY, Huang SF, Yu MC, Yeh TS, Chen TC, Lin YJ, Chang CJ, Sung CM, Lee YL, Hsu CY. Stathmin1 overexpression associated with polyploidy, tumor-cell invasion, early recurrence, and poor prognosis in human hepatoma. Mol Carcinog 2010;49:476-487. 21. Howitt BE, Nucci MR, Drapkin R, Crum CP, Hirsch MS. Stathmin-1 expression as a complement to p16 helps identify high-grade cervical intraepithelial neoplasia with increased specificity. Am J Surg Pathol 2012;37:89-97. 22. Wosnitzer MS, Domingo-Domenech J, Castillo-Martin M, Ritch C, Mansukhani M, Petrylack DP, Benson MC, McKiernan JM, Cordon-Cardo C. Predictive value of microtubule associated proteins tau and stathmin in patients with nonmuscle invasive bladder cancer receiving adjuvant intravesical taxane therapy. J Urol 2011;186:2094-2100. 23. Hemdan T, Linden M, Lind SB, Namuduri AV, Sjostedt E, de Stahl TD, Asplund A, Malmstrom PU, Segersten U. The prognostic value and therapeutic target role of stathmin-1 in urinary bladder cancer. Br J Cancer 2014;111:1180-1187. 24. Koncarevic S, Urig S, Steiner K, Rahlfs S, Herold-Mende C, Sueltmann H, Becker K. Differential genomic and proteomic profiling of glioblastoma cells exposed to terpyridineplatinum(II) complexes. Free Radic Biol Med 2009;46:1096-1108. 25. Matsuno A NH, Nagashima T, et al. . Histopathological analyses and proliferative potential of intracranial meningioma using bromodeoxyuridine and MIB-1 immunohistochemistry. Acta Histochem Cytochem 2005;38:9-15. 26. Bruna J, Brell M, Ferrer I, Gimenez-Bonafe P, Tortosa A. Ki-67 proliferative index predicts clinical outcome in patients with atypical or anaplastic meningioma. Neuropathology 2007;27:114-120.

8

Legends to the figures and tables Figure 1 Comparison of mRNA expression of STMN1 in tumor tissue by qRT-PCR (p < 0.01).

9

Figure 2 Kaplan-Meier estimates of disease-free survival (DFS) in relation to STMN1 expression as determined by qRT-PCR. Cutoff value for dichotomization of STMN1 expression and p values were determined by maximally selected log-rank statistics. A High STMN1 expression appeared to be strongly associated with poor overall survival in meningioma patients (p < 0.01).

10

Table 1 Independent meningioma RNA expression microarray datasets. Table 2 Clinical characteristics of patients (n=59). Table 3 Multivariate analysis on prognosis of the patients with Simpson's I (n=59).

11

Table 1 Independent meningioma microarray datasets GEO_ID

Platform

GSE16581

HU133 plus 2.0 arrays

Sample type GPL570

12

Frozen sample

WHO II No-recurrence 14

Recurrence 5

Table 2 Clinical characteristics of patients (n=59) Clinical parameter

Age at diagnosis (ys) Median (ys) Range (ys) >60(ys) Gender Male Female Extent of Resection Simpson I Simpson II Radiotherapy Ki-67 ≤15% ＞15% p<0.05

Recurrence No (n=32) No.

p value

%

Yes (n=27) No.

55.3±14.7 21-81 11

34.4

56.4±11.4 29-77 17

63.0

14 18

43.8 56.3

12 15

44.4 55.6

22 10 9

68.8 31.3 28.1

18 9 7

66.7 33.3 25.9

22 10

68.8 31.3

8 19

29.6 70.4

% p>0.05 p<0.05 p>0.05

p>0.05

13

p>0.05 p<0.01

Table 3 Prognostic factors for recurrenc and survival in univariate analysis (n=59) Parameter

Recurrence

Survival

HR

95% CI

p value

HR

95% CI

p value

Age (>60ys)

4.735

1.983-12.107

0.026

6.591

1.705-21.619

0.021

Gender

1.941

0.828-5.375

0.157

1.827

1.137-9.562

0.349

Radiotherapy

1.856

0.749-4.653

0.357

1.575

0.683-4.291

0.528

STMN1

2.377

1.852-3.265

0.017

2.729

1.562-6.248

0.024

Ki-67

1.593

0.956-2.048

0.009

1.624

1.143-3.375

0.007

p<0.05, HR: hazard ratio

14