Strain-specific expression profiles of virulence genes in Helicobacter pylori during infection of gastric epithelial cells and granulocytes

Microbes and Infection 7 (2005) 437–447 www.elsevier.com/locate/micinf

Original article

Strain-specific expression profiles of virulence genes in Helicobacter pylori during infection of gastric epithelial cells and granulocytes Steffi Gieseler, Brigitte König, Wolfgang König, Steffen Backert * Department of Medical Microbiology, Otto von Guericke University, Leipziger Street 44, 39120 Magdeburg, Germany Received 23 July 2004; accepted 25 November 2004 Available online 19 March 2005

Abstract Helicobacter pylori expresses a variety of known virulence-associated factors, whose expression is likely to be dependent on the ecological niche of this pathogen. Here, we compared the temporal changes in the level of virulence-associated gene transcription in H. pylori strains isolated from patients with different pathology. Our aim was to study the coordinated gene expression profiles of these virulence factors during infection of AGS gastric epithelial cells and granulocytes. Using real-time quantitative (TaqMan) RT-PCR, we determined the mRNA expression of cagA, ureA, napA, katA, vacAs1 and vacAs2 alleles in a time course up to 6 h. The expression profiles of the investigated genes vary according to the strain, and were mainly either upregulated or unchanged upon bacterial contact with AGS cells. In contrast, upon contact with granulocytes, the majority of the genes were repressed in H. pylori. The following major results were obtained: (i) genetically diverse H. pylori exhibit different mRNA expression profiles, (ii) the expression patterns were strain-specific and time-dependent and (iii) the regulation of expression profiles was host cell dependent. These data were statistically significant and suggest that contact with target cells leads to an active cross-talk between the pathogen and its host. The use of Taqman-PCR to analyse the expression of mRNA of a bacterial pathogen in response to a changing host environment enabled us to identify variable and strain-specific transcription profiles in a sensitive and reproducible manner. © 2005 Elsevier SAS. All rights reserved. Keywords: Molecular pathogenesis; Pathogenicity island; Type IV secretion; Virulence

1. Introduction Helicobacter pylori is a highly successful bacterial pathogen that inhabits the hostile environment of the human stomach of more than one half of the world population. It is transmitted within families and occasionally from other sources. Infections by H. pylori are characteristically associated with intense inflammation and infiltration of polymorphonuclear

Abbreviations: cagA, cytotoxin-associated gene A; cagPAI, cag pathogenicity island; KatA, katalase A; MALT, mucosa-associated lymphoid tissue; MOI, multiplicity of infection; NapA, neutrophil-activating protein A; PMNs, polymorphonuclear cells; RAPD, random amplified polymorphic DNA; T4SS, type IV secretion system; UreA, ureaseA; VacA, vacuolating cytotoxin. * Corresponding author. Tel.: +49 391 67 13329; fax: +49 391 67 190469. E-mail address: [email protected] (S. Backert). 1286-4579/$ - see front matter © 2005 Elsevier SAS. All rights reserved. doi:10.1016/j.micinf.2004.11.018

lymphocytes (PMNs) and monocytes [1,2]. The inflammatory response by the infiltrated immune cells appears to be a primary cause of the damage to surface epithelial layers and may eventually progress to a variety of diseases such as peptic ulcer, mucosa-associated lymphoid tissue (MALT) lymphoma or adenocarcinoma [3,4]. H. pylori strains can be classified into two major types according to their degree of pathogenicity [3–5]. Type I isolates are more virulent and are characterised by the presence of major disease-associated genetic components: namely, the vacuolating cytotoxin (VacA) and the cytotoxin-associated genes (cag) pathogenicity island (cag PAI). The cag PAI encodes a membrane-associated type IV secretion system (T4SS) for delivery of virulence factors such as the CagA protein [5–7]. H. pylori strains that possess a type s1/m1 vacA allele are associated with an increased risk of gastric cancer and enhanced gastric epithelial cell injury compared with vacA s2/m2 strains [3,4]. Other known virulence-associated deter-

438

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

minants of H. pylori include flagella-driven motility in the stomach mucus layer; local buffering of stomach acid by urease (UreA, UreB and accessory proteins), adhesion to gastric epithelial cells mediated by several adhesins (including BabA, SabA, AlpA/B or HopZ) and adherence of neutrophils to endothelial cells induced by the neutrophil-activating protein NapA [3,4,8–12]. Other described virulence factors are the catalase KatA with a proposed function in the oxidative defense of H. pylori [13,14] and IceA, a restriction endonuclease homolog, whose expression is induced by contact with the gastric epithelium [15]. The expression of H. pylori genes has been evaluated on the transcriptional level in the human mucosa, mice, Mongolian gerbils and in vitro growth [16,17]. Two recent systematic analyses of growth-phase-dependent gene expression of H. pylori revealed a dramatic change in the expression of genes encoding virulence-associated factors and a number of genes involved in iron homeostasis [18–20]. In addition, DNA microarrays and subtractive hybridisation were used to investigate H. pylori RNA expression in response to acid stress [21–24] and the effects of mutations in flgM and fliA on the transcriptome level in H. pylori [25]. A recent cDNA microarray study demonstrated with the macaque animal model that H. pylori regulates OMP expression in vivo by using both antigenic variation and phase variation [26]. Changes in gene expression of H. pylori-induced by adhesion to AGS gastric cancer cells were also compared using DNA microarrays [27,28]. Despite the significance of the studies described above, most of them investigated a small number of clinical H. pylori isolates on a global level which allowed a condition-specific and time-specific genome-scale snapshot of the transcriptome. Despite the vast amount of information generated by these studies, little is known about the process of transcriptional regulation in H. pylori, the extent of diversity in gene expression patterns in clinical strains associated with distinct clinical outcomes, and how different strains respond to different host cells such as epithelial cells and granulocytes at the transcriptional level. In particular, the gene expression in H. pylori during interaction with granulocytes remains poorly understood. The main goals of our study are to better understand the adaptive genetic mechanisms utilised by H. pylori during infection and to reveal whether the observed gene expression variability is due to (i) different time points of infection, (ii) genetically different H. pylori strains or (iii) the infected cell type. For this purpose, we established a useful in vitro system to study H. pylori virulence gene regulation during infections of AGS cells and granulocytes. We used quantitative TaqMan-RT-PCR to characterise the mRNA expression of selected virulence-related genes in eight nonrelated H. pylori strains isolated from patients with different pathology. This method is straightforward, sensitive and reproducible [16,29,30]. Our findings revealed that H. pylori clinical strains exhibit variable, time-dependent and strainspecific gene expression profiles during infection of different cell types.

2. Materials and methods 2.1. H. pylori strains and growth conditions H. pylori strains were isolated from German patients with different clinical outcome. Individual isolates were selected from non-related asymptomatic patients and patients with gastritis, non-ulcer dyspepsia, duodenal ulcer or gastric cancer. To ensure equal growth state conditions for each isolate, all H. pylori strains were grown for 2 days to thin layers on horse serum agar plates supplemented with vancomycin (10 µg/ml), nystatin (1 µg/ml) and trimethoprim (5 µg/ml). All antibiotics were obtained from Sigma-Aldrich Chemie (Deisenhofen, Germany). Incubation was performed at 37 °C in an anaerobic jar containing a campygen gas mix of 5% O2, 10% CO2 and 85% N2 (Oxoid, Wesel, Germany). 2.2. DNA preparation and primer design Bacterial genomic DNA was isolated using QIAamp Mini Kit according to the instructions of the supplier (Qiagen, Hilden, Germany). PCR amplification of H. pylori gene loci was performed for several known virulence genes. Details of the investigated genes, standard primers and references are listed in Table 1. Standard Random Amplified Polymorphic DNA (RAPD)-primers 186F-5′ GAGCGGCCAAAGGGAGCAGAC, 187F-5′CCGGATCCGTGATGCGGTGCG and 188F-5′GGTTGGGTGAGAATTGCACG were used as described for other H. pylori isolates [31]. TaqMan probes were designed using the primer design software Primer Express (PE Applied Biosystems, Foster City, CA) and have been listed in Table 2. 2.3. H. pylori genotyping and RAPD-fingerprinting The RAPD-PCR fingerprinting method [31] was used to distinguish among H. pylori isolates and to identify genetically non-related strains. This method uses arbitrarily chosen oligonucleotides to prime DNA synthesis from genomic sites to which they are fortuitously matched [31]. Eight independent H. pylori strains which shared distinguishable RAPD patterns with three different RAPD primers (listed above) have been selected for further studies, suggesting that these strains exhibit high genomic sequence diversity (data provided to the reviewers). The genomic DNA of the H. pylori strains was then subjected to PCR genotyping with standard primers of known virulence-associated genes (ureA, cagA, katA, alpA, vacA, iceA and napA). The results obtained are listed according to the H. pylori type I and type II nomenclature (Table 3). 2.4. AGS cell culture, PMN isolation and infection assays AGS cells (ATCC CRL 1739, a human gastric adenocarcinoma epithelial cell line) were grown in 25 cm2 flasks with RPMI-1640 medium (Invitrogen, Karlsruhe, Germany) containing 10% fetal bovine serum (FBS) for 2 days to reach

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

439

Table 1 List of primers used in this study Gene 16S rRNA ureA katA napA cagA vacAs1/2 vacAs1/2 vacAs1a vacAs1b vacAm1 vacAm2 vacAm1/2 alpA iceA1 iceA2

Primer F 5′-GGAGGATGAAGGTTTTAGGATTG-3′ R 5′-TCGTTTAGGGCGTGGACT-3′ F 5′-AAACGCAAAGAAAAAGGC-3′ R 5′-CCATCCATCACATCATCC-3′ F 5′-AGAGGTTTTGCGATGAAGT-3′ R 5′-CGTTTTTGAGTGTTGATGAA-3′ F 5′-TGCAAGCGGATGCGATCGTGTT-3′ R 5′-GCAACTTGGCCAATTGATCGTCCGC-3′ F 5′-TTGACCAACAACCACAAACCGAAG-3′ R 5′-CTTCCCTTAATTGCGAGATTCC-3′ F 5′-ATGGAAATACAACAAACACAC-3′ R 5′-CTGCTTGAATGCGCCAAA C-3′ F 5′-ATGGAAATACAACAAACACAC-3′ R 5′-CCTGARACCGTTCCTACAGC-3′ F 5′-ATGGAAATACAACAAACACAC-3′ R 5′-GTCAGCATCACACCGCAAC-3′ F 5′-ATGGAAATACAACAAACACAC-3′ R 5′-AGCGCCATACCGCAAGAG-3′ F 5′-GGTCAAAATGCGGTCATGG-3′ R 5′-CCATTGGTACCTGTAGAAAC-3′ F 5′-GGAGCCCCAGGAAACATTG-3′ R 5′-CATAACTAGCGCCTTGCAC-3′ F 5′-CACAGCCACTTTCAATAACGA-3′ R 5′-CGTCAAAATAATTCCAAGGG-3′ F 5′-ACGCTTTCTCCCAATACC-3′ R 5′-AACACATTCCCCGCATTC-3′ F 5′-GTGTTTTTAACCAAAGTATC-3′ R 5′-CTATAGCCASTYTCTTTGCA-3′ F 5′-GTTGGGTATATCACAATTTAT-3′ R 5′-TTRCCCTATTTTCTAGTAGGT-3

Table 2 Sequences of TaqMAN probes used in this study Gene TaqMAN probes 16S rRNA FAM-5′-TCCGTGCCAGCAGCCGC-3′-TAMRA ureA FAM-5′-AAGCGAGAGCTGGTAAGAAAAGTGCGG-3′TAMRA katA FAM-5′-ATCGCATCACGGATAAAGAAAACAGGC-3′TAMRA napA FAM-5 -TTTATCCGAAGCGATCAAACTCACTCGTG-3′TAMRA cagA FAM-5′-CGGCTTTTAACCCGCAGCAATTTATCA-3′TAMRA vacAs1/2 FAM-5′-TGATCATTCCAGCCATTGTTGG-3′-TAMRA

Fragment size in bp 390

References [16]

160

[16]

120

[16]

370

[59]

183

[61]

259/286

[60]

176/203

[61]

190

[60]

187

[60]

290

[60]

352

[60]

401/476

[61]

304

[16]

246

[61]

229/334

[61]

approximately 70% cell confluency. For isolation of human PMNs, 5 ml heparinised blood from one volunteer was applied on top of 5 ml polymorph prep solution and isolated as described by the manufacturer (AXIS-Shield PoC AS, Oslo, Norway). The cells (1 × 106) were resuspended in 1 ml RPMI medium containing 2% FCS and infected with H. pylori at a multiplicity of infection (MOI) of 100. The viability of H. pylori cultures was routinely assessed by determining the number of colony-forming units (cfu) on agar plates. After incubation for 1, 3 and 6 h at 37 °C in a 5% CO2/95% air incubator, the infected cells and bacteria were subjected to RNA isolation. For this purpose, RNAprotect Bacteria

Table 3 Genotyping of H. pylori strains by PCR a Status Type I

Type II

a

Strains P1 P12 P284 P303 P1280 P1288 P1303 P1321

Endoscopy Non-ulcer dyspepsia Duodenal ulcer Duodenal ulcer Cancer No pathology Gastritis Gastritis Gastritis

ureA + + + + + + + +

katA + + + + + + + +

alpA + + + + + + + +

Investigated Genes vacAs1 vacAs2 vacAs1a – – – + – + + – + – + – + – + – + – + – + – + –

PCR was carried out with the primers listed in Table 1; +, present; –, no PCR product.

vacAs1b – – – – – – – +

vacAm1 – + – – + – – –

vacAm2 + – + + – + + +

cagA + + + + – – – –

iceA1 + + – + + – + +

iceA2 – – + – – + – –

napA + + + + + + + +

440

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

2.6. Statistical analyses

Reagent (Qiagen) was added to the cell suspension and total RNA was prepared using the RNeasy Kit system (Qiagen). RNA was purified according to the manufacturer’s instructions followed by a DNaseI digest to remove traces of remnant DNA. Isolated RNA was subsequently used for one-step RT-PCR (see below).

Statistical evaluation was performed with the Sigma-Stat statistical 2.0 software. P-values < 0.05 were considered to be statistically significant.

3. Results and discussion

2.5. Quantitative TaqMan-PCR

3.1. Selection of H. pylori strains and optimisation of TaqMan real-time PCR

TaqMan-PCR assays were performed according to manufacturers’ recommendations using the QuantiTectTM Probe RT-PCR Kit (Qiagen) for real-time one-step RT-PCR. Both the quantity and quality of the bacterial and eukaryotic rRNA prepared were verified in parallel by conventional agarose electrophoresis and samples that had not been reverse transcribed showed no detectable amplification, indicating the absence of contaminating DNA. TaqMan-PCR reactions were then run on an ABI Prism 5700 apparatus (Applied Biosystems Division; Perkin Elmer, Weiterstadt, Germany). All probes were synthesised by TibMolBiol (Berlin, Germany) or MWG BioTech (Munich, Germany) and labelled with the reporter dye 6-carboxyfluorescein at the 5′ end and the quencher dye 6-carboxytetramethylrhodamin at the 3′ end. To determine absolute mRNA copy numbers, standard curves were generated for each gene using plasmid dilution series. Briefly, we first determined the standard curves for quantitative detection of the amplified PCR products of the H. pylori 16SrRNA gene using plasmid DNA containing cloned 16SrRNA (cloned into the pTopo-4 vector from Invitrogen) at serial 10-fold dilutions as the PCR templates. The standard curves were obtained from representative control experiments on samples containing 101–108 copies per sample of cloned 16SrRNA plasmid DNA (provided to the reviewers; data not shown). Over a wide dynamic range, the threshold cycle value was a linear function of the starting mRNA input with coefficients of correlation of 0.95–1. The cycle program was as follows: 30 min at 50 °C; 15 min at 95 °C and 45 cycles (16SrRNA; katA; ureA) or 50 cycles (napA; vacA; cagA) of 15s at 95 °C and 1 min 50 °C (ureA), 55 °C (katA) and 60 °C (16SrRNA; napA; vacA; cagA). Data were collected during the extension step and are expressed in arbitrary fluorescence units per cycle.

The main goal of the present study was to characterise the differential expression of known H. pylori virulenceassociated genes during infection of both AGS gastric epithelial cells and granulocytes. For this purpose, eight individual type I or type II H. pylori isolates were selected from nonrelated asymptomatic patients and patients with gastritis, nonulcer dyspepsia, duodenal ulcer or gastric cancer, respectively (Table 3). Using real-time quantitative (TaqMan) RT-PCR, we determined the mRNA expression of cagA, ureA, napA, katA, vacAs1 and vacAs2 alleles in a time course up to 6 h. Real-time PCR measures a fluorescent signal that is proportional to the amount of amplified cDNA. The most reliable point for quantification of template cDNA is the cycle at which the PCR product fluorescence becomes greater than a defined threshold; the more starting template cDNA, the fewer PCR cycles are required to reach the threshold [32]. To ensure high primer binding efficiency, standard PCRs with template DNA of each H. pylori strain confirmed that there was only one product. In some cases, no PCR product was obtained, probably because the primers did not bind to the template DNA due to the enormous sequence diversity of the H. pylori genome sequences. The overall results are summarised in Tables 4 and 5. 3.2. Gene expression of H. pylori co-cultured with AGS cells Ideally, gene expression studies should compare the mRNA profiles of bacteria under standardised in vitro conditions of infection. To identify genes that are differentially regulated in H. pylori as a result of infection of particular host target

Table 4 TaqMan mRNA expression of pathogenicity factors of H. pylori during infection of AGS cells Designation

Strains

Type I

P1 P12 P284 P303 P1280 P1288 P1303 P1321

Type II

a

16S rRNA • • • • • • • •

ureA – up up • – • • up

katA up – up down up • up up

•, no regulation; up, upregulation; down, downregulation; –, no PCR product.

Regulation ofa cagA down down – up – – – –

vacAs1 – • up – – – – –

vacAs2 – – – up – up – up

napA down – • • up • • up

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

441

Table 5 TaqMan mRNA expression of pathogenicity factors of H. pylori during infection of human PMNs Designation Type I

Type II

a

Strains P1 P12 P284 P303 P1280 P1288 P1303 P1321

16S rRNA • • down • • down • •

ureA – down down up • down down up

katA • down down down down down • up

Regulation ofa cagA up • – down – – – –

vacAs1 – • up – – – – –

vacAs2 – – – down – up – •

napA up – • down up up • up

•, no regulation; up, upregulation; down, downregulation; –, no PCR product.

cells, the bacterial gene expression affected by infection should be compared with that in the absence of eukaryotic cells under the same conditions. For this purpose, AGS gastric epithelial cells were infected with each strain using an MOI of 100. In parallel, bacteria were cultured under the same conditions in control medium. After incubation in a time course of 1, 3 and 6 h post-infection, bacterial cells ( ± host cells) were harvested, and total bacterial RNA was quantitated by TaqMan-PCR. To exclude the possibility that variation in gene expression is due to multiplication or killing of bacteria during infection, we first determined the copy number of mRNA of the reference housekeeping gene 16SrRNA in a time course up to 6 h. Fig. 1A shows a representative example of no differential expression of 16SrRNA, which was also observed for the other seven H. pylori strains (Table 4). These data together with counting the cfu at each time point (data not shown) suggest that the bacteria were viable and did not multiply in our time course. Next, we amplified by Taqman-PCR the mRNA virulence-associated genes ureA, katA, cagA, vacAs1, vacAs2 and napA from both H. pylori alone and from the H. pylori-AGS cell co-culture. A gene is considered to be either up- or downregulated in response to infection when the following two criteria are satisfied: (i) the respective gene shows no differential expression in the medium control and (ii) the copy number of the gene changes at least twofold during infection. The overall data are summarised in Table 4 and representative examples from several strains are shown in Fig. 1A–H. These results were confirmed by three independent experiments. The high degree of reproducibility in the experiments enables a reliable comparison of the expression profiles among the different H. pylori isolates. Taken together, the above findings reveal differential expression of genes in a strain-specific manner. All eight H. pylori isolates exhibited different mRNA expression profiles (Table 4). In addition, it is important to note that we did not find any investigated genes among the strains that are consistently upregulated or downregulated. Interestingly, the overall number of upregulated genes was significantly higher in the group of type II strains, which lack the cagPAI, whereas downregulation was not detected for any of the genes. In the group of type I strains, we found upregulation of a number of genes but also downregulation of a few genes. For example,

napA was upregulated in two type II strains (Table 4, example in Fig. 1C), whereas its expression level in one type I strain was downregulated with time but upregulated in the presence of AGS compared with the medium control sample (Table 4, example in Fig. 1D). However, the level of napA expression was unchanged in four other strains. In addition, we have detected change in the gene expression of katA. In three type II strains, katA was consistently upregulated (Table 4 and Fig. 1E), whereas katA expression levels were downregulated in two type II strains, and one type I strain (P303) showed particularly prominent upregulation during infection of AGS cells (Table 4). In contrast, vacA was consistently upregulated in two strains from each group (Table 4, example in Fig. 1B). When the TaqMan data of ureA mRNA expression were compared, we found a significant upregulation of this gene in altogether three H. pylori strains (example in Fig. 1H), whereas it was unchanged in three other strains (Table 4). Surprisingly, we only saw upregulation of cagA in one type I strain and even downregulation in two H. pylori strains (Table 4, example in Fig. 1G). Given that CagA is the major known effector protein of the T4SS encoded by the cagPAI and is associated with disease severity [3–5], the dynamic change in the level of CagA expressed might have important implications in H. pylori-induced pathogenesis. Temporally, regulation of genes at specific time points, in contrast to continuous up- or downregulation, was also observed. For example, the ureA expression of strain P12 was particularly enhanced during the early phase of infection (1 h), followed by a subsequent decrease (Fig. 1H). The expression of katA in strain P1 showed upregulation during the first 3 h of AGS infection, followed by a subsequent downregulation (Fig. 1E). Taken together, these results show that genetically diverse H. pylori strains exhibit variations in gene expression patterns in a time-dependent manner during infection of AGS cells. 3.3. Gene expression of H. pylori co-cultured with granulocytes To examine whether modulation of H. pylori gene expression is host cell-specific, we sought to investigate the transcription of the same set of genes during co-culturing of the bacteria with granulocytes. For this purpose, freshly isolated

442

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

Fig. 1. Real-time PCR quantitation of mRNA copy numbers of the regulated genes in H. pylori during infection of AGS cells. Representative examples show the transcriptional expression of 16SrRNA (A), vacAs2 (B), napA (C–D), katA (E–F), cagA (G) and ureA (H) in a time course at 1, 3 and 6 h post-infection. Black bars indicate the results obtained during co-incubation of H. pylori with AGS cells, and white bars indicate the controls where the bacteria were incubated in medium without AGS cells. Changes in mRNA copy number were determined by TaqMan-PCR. The data shown are the averages of three independent experiments. The error bars indicate the standard errors of the mean. * = P < 0.05, ** = P < 0.005, n.s. = not significant.

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

human PMNs were infected with each strain. As described above for infections with AGS cells, bacterial strains were also cultured in parallel under the same conditions in control medium, and then subjected to TaqMan-PCR analysis. Determination of the mRNA copy number of the 16SrRNA gene showed no differences between six H. pylori strains, suggesting no multiplication or bacterial killing in the time course of infection (Table 5 and Fig. 2A). However, we detected two exceptions, namely strains P284 and P1288, which exhibited lower 16SrRNA after 6 h of infection (Table 5). This coincided with the detection of lower cfu at this time point (data not shown), suggesting that some bacteria from these two strains were killed. Next, we quantified the mRNA of the virulence-associated genes ureA, katA, cagA, vacAs1, vacAs2 and napA from both H. pylori alone and H. pylori co-cultured with PMNs by TaqMan-PCR. The amount of mRNA determined from strains P284 and P1288 was standardised against the corresponding 16SrRNA levels. The results of three independent experiments are summarised in Table 5 and representative examples are shown in Fig. 2A–H. Similarly to our observations obtained from co-incubation of H. pylori with AGS cells, co-incubation of H. pylori with PMNs resulted in strain-specific gene expression profiles. The overwhelming majority of genes were found to be downregulated in H. pylori. Two interesting exceptions are strains P1 and P1321, which showed upregulation of two or three genes, respectively (Table 5). For the remaining six strains, the majority of genes investigated were either downregulated or unaffected. Interestingly, the napA gene encoding the neutrophil-activating protein NapA was significantly upregulated in four H. pylori strains (Table 5, example in Fig. 2B). Similarly, vacA was upregulated in two H. pylori strains in a time-dependent manner (Table 5 and Fig. 2C) and only downregulated in one other strain (Fig. 2D). Given that katA has a proposed function in the defense of H. pylori against oxygendependent killing mechanisms by PMNs [13], we expected to detect the upregulation of katA in infections of PMNs. Instead, katA underwent downregulation in five H. pylori isolates (Table 5, example in Fig. 2G). We also did not see continuous up- or downregulation of certain genes over 6 h of PMN infection with H. pylori. For example, ureA gene expression was downregulated after 1–3 h of infection with strain P12, followed by upregulation at 6 h post-infection (Fig. 2E). In addition, the transcriptional level of ureA of strain P1321 was particularly enhanced at early time points of infection (1–3 h) and reduced drastically after 6 h (Fig. 2F). A similar observation was obtained with vacA in strain P284, where we detected upregulation of vacA for 1 h and subsequent downregulation (Fig. 2C). In contrast, cagA in strain P1 was downregulated between 1–3 h, followed by subsequent upregulation after 6 h of infection (Fig. 2H). Taken together, these data demonstrate that genetically diverse H. pylori strains exhibit strain-specific and timedependent gene expression patterns not only during infection of AGS gastric epithelial cells but also during co-incubation with PMNs.

443

3.4. Conclusions One of the goals of genomic expression studies on pathogenic bacteria is to identify bacterial genes that are differentially regulated during infection of the host. Such genes either enable a microbe to adapt to host-specific microenvironments or encode virulence determinants. Presumably, several sets of genes are regulated by H. pylori to optimise colonisation efficiency in the human stomach. In a number of previous cDNA microarray studies, several labs characterised the host cell RNA response in infections with H. pylori [33–40] and changes in the transcriptome of this pathogen [17–19,21–25,27]. In this study, using the AGS gastric epithelial cells and PMNs as in vitro infection models, we analysed the expression profiles of selected virulence-associated genes in clinical H. pylori isolates in further detail by TaqMan real-time PCR. Our study demonstrates that TaqManPCR is a powerful tool for the detection and quantitation of H. pylori gene expression in an in vitro infection model. Furthermore, our data reveal that the changes in gene expression induced by infection of host target cells can be highly reproducible. Only relatively few transcriptional regulators have been identified in H. pylori [41]. For example, H. pylori harbours only three histidine kinases and five response regulators belonging to the so-called two-component systems, which are signal transduction systems frequently involved in the coordinated global regulation of virulence-associated genes [42]. Another regulatory component of H. pylori global gene regulation is the CsrA protein. Mutation of csrA deregulates the acid induction of napA, cagA, vacA, the urease operon, and fur, as well as the heat shock responses of napA, groESL and hspR [43]. The degree of DNA methylation may also be crucial, as mutation of hpyIM methyltransferase alters the expression of the stress-responsive dnaK operon [28]. In addition, the degree of DNA methylation may vary among different H. pylori strains, as suggested by the existence of various methyltransferase genes [44,45]. In this context, our findings in this study provide further insights by demonstrating that genetically diverse H. pylori exhibit different expression profiles, and that these profiles are strain-specific, time-dependent and host-dependent. One of the major virulence factors of H. pylori is the vacuolating cytotoxin VacA. This secreted protein causes defects in T cell activation [46–48] and damages the gastric epithelium by erosion and loosening of tight junctions [3,4]. In agreement with these important functions of VacA, we observed increased expression of the vacA gene during infection of AGS cells with four out of eight H. pylori strains. These results are in good agreement with numerous other studies showing upregulation of vacA expression during infection of epithelial cells [18,20,49]. Similar results were obtained for infection of PMNs, in which two of eight H. pylori strains produced higher level of vacA mRNA (Table 5). However, whether and how enhanced expression of certain vacA allels influences signal transduction in infected PMNs, yet remains to be investigated.

444

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

Fig. 2. Real-time PCR quantitation of mRNA copy numbers of the regulated genes in H. pylori during infection of PMNs. Representative examples show the transcriptional expression of 16SrRNA (A), napA (B), vacAs2 (C–D), ureA (E–F), katA (G) and cagA (H) in a time course at 1, 3 and 6 h post-infection. Black bars indicate the results obtained during co-incubation of H. pylori with PMNs, and white bars indicate the controls where the bacteria were incubated in medium without PMNs. Changes in mRNA copy number were determined by TaqMan-PCR. The data shown are the averages of three independent experiments. The error bars indicate the standard errors of the mean* = P < 0.05, ** = P < 0.005, n.s. = not significant.

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

CagA is as yet the only known effector protein of the H. pylori T4SS [3–7]. Despite the significant effects of translocated CagA in host cells, almost nothing is known about its transcriptional regulation. In fact, the regulation of other cag PAI genes also remains poorly understood. We found that cagA mRNA is upregulated in one strain and downregulated in two other strains during infection of AGS. Furthermore, cagA in the strain P1 is downregulated during infection of AGS cells but upregulated during infection of PMNs. The reason for this intriguing variation in gene expression patterns is unclear. Nevertheless, the phenomenon seems to be consistent with the finding that several regulatory regions in the cag PAI differ widely in promoter activity, as shown by a study on the expression of UreB fusion proteins using a reporter system [50]. Nevertheless, other evidence suggests that CagA may also be constitutively expressed. For example, two-dimensional gels showed that the basal level of the CagA protein is very high in H. pylori even in the absence of host cell contact [51,52]. The H. pylori NapA protein was named for its ability to promote neutrophil adhesion to endothelial cells [53] and has been shown to be a major antigen in the human immune response to H. pylori [11]. Due to its ability to confer colonisation protection in mice by orally administered NapA, it has been suggested that NapA could be included in a H. pylori vaccination strategy [11,54]. Interestingly, in recent H. pylori gene expression studies, iron-regulated genes including cagA, vacA and napA have been identified [18], and the accumulation of NapA is indeed influenced by Fur [55]. Our studies show that napA (besides vacA) is one of the major virulence factors that is predominantly upregulated in many strains during infection of AGS cells and PMNs. These findings underline the importance of this protein for H. pylori-induced pathogenesis. However, future studies will be necessary to discern the role of its iron-dependent regulation. Urease, together with the five known urease accessory proteins (UreI, UreE, UreF, UreG and UreH), is an important colonisation factor. It is acid resistant under physiological conditions, hence allowing H. pylori to survive in the human stomach [3,4,12]. We found that ureA is upregulated in three H. pylori strains during infection of AGS cells and predominantly downregulated during infection with PMNs. This is consistent with previous findings that the onset of urease activity is required for initial colonisation of the stomach in animal models [56–58]. Another important virulence-associated factor, KatA, has a putative function in the defence of H. pylori against oxygen-dependent killing by PMNs [13,14]. Thus, we expected to see increased transcription of katA during infection of H. pylori with PMNs. In contrast, we observed downregulation of katA during infection of PMNs by H. pylori and upregulation of katA during infection of AGS cells. Experiments are under way in our laboratory to investigate the pathophysiological implications of these observations. Taken together, our data indicate that both the genetic diversity and the host cell environment can influence the gene expression in H. pylori. The significant variation in gene

445

expression profiles in a strain-dependent and host-dependent manner confirms the current notion that H. pylori is highly capable of adapting to its environment and host cells. Such adaptability is likely to be acquired through decades of colonisation in the human stomach and co-evolution with humans.

Acknowledgements We are grateful to Dr. Terry Kwok for discussion and critical reading the manuscript and Dr. Markus Gerhard for his help in statistical evaluation of the data. The work of S.B. is supported through NBL-3 project (Magdeburger Forschungsverbund PFG4) and Priority Program SPP1150 of the Deutsche Forschungsgemeinschaft (Ba1671/3-1).

References [1]

[2] [3]

[4] [5]

[6]

[7] [8]

[9]

[10] [11]

[12]

[13]

[14]

L.A. Allen, The role of the neutrophil and phagocytosis in infection caused by Helicobacter pylori, Curr. Opin. Infect. Dis. 14 (2001) 273–277. A. Mayer-Scholl, P. Averhoff, A. Zychlinsky, How do neutrophils and pathogens interact? Curr. Opin. Microbiol. 7 (2004) 62–66. C. Montecucco, R. Rappuoli, Living dangerously: how Helicobacter pylori survives in the human stomach, Nat. Rev. Mol. Cell Biol. 2 (2001) 457–466. R.M. Peek Jr., M.J. Blaser, Helicobacter pylori and gastrointestinal tract adenocarcinomas, Nat. Rev. Cancer 2 (2002) 28–37. A. Covacci, J.L. Telford, G. Del Giudice, J. Parsonnet, R. Rappuoli, Helicobacter pylori virulence and genetic geography, Science 284 (1999) 1328–1333. S. Backert, Y. Churin, T.F. Meyer, Helicobacter pylori type IV secretion host cell signalling and vaccine development, Keio J. Med. 51 (2002) 6–14. E. Cascales, P. Christie, The versatile bacterial type IV secretion systems, Nat. Rev. Microbiol. 1 (2004) 137–148. S. Odenbreit, M. Till, D. Hofreuter, G. Faller, R. Haas, Genetic and functional characterization of the alpAB gene locus essential for the adhesion of Helicobacter pylori to human gastric tissue, Mol. Microbiol. 5 (1999) 1537–1548. D. Ilver, A. Arnqvist, J. Ogren, I.M. Frick, D. Kersulyte, E.T. Incecik, D.E. Berg, A. Covacci, L. Engstrand, T. Boren, Helicobacter pylori adhesin binding fucosylated histo-blood group antigens revealed by retagging, Science 279 (1998) 373–377. D.J. Evans Jr., D.G. Evans, Helicobacter pylori adhesins: review and perspectives, Helicobacter 5 (2000) 183–195. B. Satin, G. Del Giudice, V. Della Bianca, S. Dusi, C. Laudanna, F. Tonello, D. Kelleher, R. Rappuoli, C. Montecucco, F. Rossi, The neutrophil-activating protein (HP-NAP) of Helicobacter pylori is a protective antigen and a major virulence factor, J. Exp. Med. 191 (2000) 1467–1476. N.C. Ha, S.T. Oh, J.Y. Sung, K.A. Cha, M.H. Lee, B.H. Oh, Supramolecular assembly and acid resistance of Helicobacter pylori urease, Nat. Struct. Biol. 8 (2001) 505–509. S. Odenbreit, B. Wieland, R. Haas, Cloning and genetic characterization of Helicobacter pylori catalase and construction of a catalasedeficient mutant strain, J. Bacteriol. 178 (1996) 6960–6967. P.C. Loewen, X. Carpena, C. Rovira, A. Ivancich, R. Perez-Luque, R. Haas, S. Odenbreit, P. Nicholls, I. Fita, Structure of Helicobacter pylori catalase, with and without formic acid bound, at 1.6 A resolution, Biochemistry 43 (2004) 3089–3103.

446

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447

[15] R.M. Peek Jr., S.A. Thompson, J.P. Donahue, K.T. Tham, J.C. Atherton, M.J. Blaser, G.G. Miller, Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome, Proc. Assoc. Am. Phys. 110 (1998) 531–544. [16] B. Rokbi, D. Seguin, B. Guy, V. Mazarin, E. Vidor, F. Mion, M. Cadoz, M.J. Quentin-Millet, Assessment of Helicobacter pylori gene expression within mouse and human gastric mucosa by real-time reverse transcriptase PCR, Infect. Immun. 69 (2001) 4759–4766. [17] J.E. Graham, R.M. Peek Jr., U. Krishna, T.L. Cover, Global analysis of Helicobacter pylori gene expression in human gastric mucosa, Gastroenterology 123 (2002) 1637–1648. [18] D.S. Merrell, L.J. Thompson, C.C. Kim, H. Mitchell, L.S. Tompkins, A. Lee, S. Falkow, Growth phase-dependent response of Helicobacter pylori to iron starvation, Infect. Immun. 71 (2003) 6510–6525. [19] L.J. Thompson, D.S. Merrell, B.A. Neilan, H. Mitchell, A. Lee, S. Falkow, Gene expression profiling of Helicobacter pylori reveals a growth-phase-dependent switch in virulence gene expression, Infect. Immun. 71 (2003) 2643–2655. [20] F. Szczebara, L. Dhaenens, S. Armand, M.O. Husson, Regulation of the transcription of genes encoding different virulence factors in Helicobacter pylori by free iron, FEMS Microbiol. Lett. 175 (1999) 165–170. [21] S. Ang, C.Z. Lee, K. Peck, M. Sindici, U. Matrubutham, M.A. Gleeson, J.T. Wang, Acid-induced gene expression in Helicobacter pylori: study in genomic scale by microarray, Infect. Immun. 69 (2001) 1679–1686. [22] C.C. McGowan, A.S. Necheva, M.H. Forsyth, T.L. Cover, M.J. Blaser, Promoter analysis of Helicobacter pylori genes with enhanced expression at low pH, Mol. Microbiol. 48 (2003) 1225–1239. [23] Y. Wen, E.A. Marcus, U. Matrubutham, M.A. Gleeson, D.R. Scott, G. Sachs, Acid-adaptive genes of Helicobacter pylori, Infect. Immun. 71 (2003) 5921–5939. [24] A.H. Van Vliet, E.J. Kuipers, J. Stoof, S.W. Poppelaars, J.G. Kusters, Acid-responsive gene induction of ammonia-producing enzymes in Helicobacter pylori is mediated via a metal-responsive repressor cascade, Infect. Immun. 72 (2004) 766–773. [25] C. Josenhans, E. Niehus, S. Amersbach, A. Horster, C. Betz, B. Drescher, K.T. Hughes, S. Suerbaum, Functional characterization of the antagonistic flagellar late regulators FliA and FlgM of Helicobacter pylori and their effects on the H. pylori transcriptome, Mol. Microbiol. 43 (2002) 307–322. [26] J.V. Solnick, L.M. Hansen, N.R. Salama, J.K. Boonjakuakul, M. Syvanen, Modification of Helicobacter pylori outer membrane protein expression during experimental infection of rhesus macaques, Proc. Natl. Acad. Sci. USA 101 (2004) 2106–2111. [27] N. Kim, E.A. Marcus, Y. Wen, D.L. Weeks, D.R. Scott, H.C. Jung, I.S. Song, G. Sachs, Genes of Helicobacter pylori regulated by attachment to AGS cells, Infect. Immun. 72 (2004) 2358–2368. [28] J.P. Donahue, D.A. Israel, V.J. Torres, A.S. Necheva, G.G. Miller, Inactivation of a Helicobacter pylori DNA methyltransferase alters dnaK operon expression following host-cell adherence, FEMS Microbiol. Lett. 208 (2002) 295–301. [29] D. Kobayashi, Y. Eishi, T. Ohkusa, T. Ishige, J. Suzuki, T. Minami, T. Yamada, M. Takizawa, Koike, Gastric mucosal density of Helicobacter pylori estimated by real-time PCR compared with results of urea breath test and histological grading, J. Med. Microbiol. 51 (2002) 305–311. [30] M. Mikula, A. Dzwonek, K. Jagusztyn-Krynicka, J. Ostrowski, Quantitative detection for low levels of Helicobacter pylori infection in experimentally infected mice by real-time PCR, J. Microbiol. Methods 55 (2003) 351–359. [31] N. Akopyanz, N.O. Bukanov, T.U. Westblom, S. Kresovich, D.E. Berg, DNA diversity among clinical isolates of Helicobacter pylori detected by PCR-based RAPD fingerprinting, Nucleic Acids Res. 20 (1992) 5137–5142.

[32] A. Giulietti, L. Overbergh, D. Valckx, B. Decallonne, R. Bouillon, C. Mathieu, An overview of real-time quantitative PCR: applications to quantify cytokine gene expression, Methods 25 (2001) 386–401. [33] C.C. Chiou, C.C. Chan, D.L. Sheu, K.T. Chen, Y.S. Li, E.C. Chan, Helicobacter pylori infection induced alteration of gene expression in human gastric cells, Gut 48 (2001) 598–604. [34] J.M. Cox, C.L. Clayton, T. Tomita, D.M. Wallace, P.A. Robinson, J.E. Crabtree, cDNA array analysis of cag pathogenicity islandassociated Helicobacter pylori epithelial cell response genes, Infect. Immun. 69 (2001) 6970–6980. [35] S. Maeda, M. Otsuka, Y. Hirata, Y. Mitsuno, H. Yoshida, Y. Shiratori, Y. Masuho, M. Muramatsu, N. Seki, M. Omata, cDNA microarray analysis of Helicobacter pylori-mediated alteration of gene expression in gastric cancer cells, Biochem. Biophys. Res. Commun. 284 (2001) 443–449. [36] S. Bach, A. Makristathis, M. Rotter, A.M. Hirschl, Gene expression profiling in AGS cells stimulated with Helicobacter pylori isogenic strains (cagA positive or cagA negative), Infect. Immun. 70 (2002) 988–992. [37] A.R. Sepulveda, H. Tao, E. Carloni, J. Sepulveda, D.Y. Graham, L.E. Peterson, Screening of gene expression profiles in gastric epithelial cells induced by Helicobacter pylori using microarray analysis, Aliment. Pharmacol. Ther. 16 (2002) 145–157. [38] K. Guillemin, N.R. Salama, L.S. Tompkins, S. Falkow, Cag pathogenicity island-specific responses of gastric epithelial cells to Helicobacter pylori infection, Proc. Natl. Acad. Sci. USA 99 (2002) 15136– 15141. [39] J.W. Lim, H. Kim, K.H. Kim, Cell adhesion-related gene expression by Helicobacter pylori in gastric epithelial AGS cells, Int. J. Biochem. Cell Biol. 35 (2003) 1284–1296. [40] S. Backert, H. Gressmann, T. Kwok, U. Zimny-Arndt, W. König, P.R. Jungblut, T.F. Meyer, Gene expression and protein profiling of AGS gastric epithelial cells upon infection with Helicobacter pylori, Proteomics (2005) (in press). [41] A. Marais, G.L. Mendz, S.L. Hazell, F. Megraud, Metabolism and genetics of Helicobacter pylori: the genome era, Microbiol. Mol. Biol. Rev. 63 (1999) 642–674. [42] D. Beier, R. Frank, Molecular characterization of two-component systems of Helicobacter pylori, J. Bacteriol. 182 (2000) 2068–2076. [43] F.M. Barnard, M.F. Loughlin, H.P. Fainberg, M.P. Messenger, D.W. Ussery, P. Williams, et al., Global regulation of virulence and the stress response by CsrA in the highly adapted human gastric pathogen Helicobacter pylori, Mol. Microbiol. 51 (2004) 15–32. [44] T. Ando, Q. Xu, M. Torres, K. Kusugami, D.A. Israel, M.J. Blaser, Restriction–modification system differences in Helicobacter pylori are a barrier to interstrain plasmid transfer, Mol. Microbiol. 37 (2000) 1052–1065. [45] L.F. Lin, J. Posfai, R.J. Roberts, H. Kong, Comparative genomics of the restriction-modification systems in Helicobacter pylori, Proc. Natl. Acad. Sci. USA 98 (2001) 2740–2745. [46] B. Gebert, W. Fischer, E. Weiss, R. Hoffmann, R. Haas, Helicobacter pylori vacuolating cytotoxin inhibits T lymphocyte activation, Science 301 (2003) 1099–1102. [47] M. Boncristiano, S.R. Paccani, S. Barone, C. Ulivieri, L. Patrussi, D. Ilver, A. Amedei, M.M. D’Elios, J.L. Telford, C.T. Baldari, The Helicobacter pylori vacuolating toxin inhibits T cell activation by two independent mechanisms, J. Exp. Med. 198 (2003) 1887–1897. [48] M.S. Sundrud, V.J. Torres, D. Unutmaz, T.L. Cover, Inhibition of primary human T cell proliferation by Helicobacter pylori vacuolating toxin (VacA) is independent of VacA effects on IL-2 secretion, Proc. Natl. Acad. Sci. USA 101 (2004) 7727–7732. [49] K. Van Amsterdam, A.H. Van Vliet, J.G. Kusters, M. Feller, J. Dankert, A. Van der Ende, Induced Helicobacter pylori vacuolating cytotoxin VacA expression after initial colonisation of human gastric epithelial cells, FEMS Immunol. Med. Microbiol. 39 (2003) 251–256.

S. Gieseler et al. / Microbes and Infection 7 (2005) 437–447 [50] E.A. Joyce, J.V. Gilbert, K.A. Eaton, A. Plaut, A. Wright, Differential gene expression from two transcriptional units in the cag pathogenicity island of Helicobacter pylori, Infect. Immun. 69 (2001) 4202– 4209. [51] P.R. Jungblut, D. Bumann, G. Haas, U. Zimny-Arndt, P. Holland, S. Lamer, F. Siejak, A. Aebischer, T.F. Meyer, Comparative proteome analysis of Helicobacter pylori, Mol. Microbiol. 36 (2000) 710–725. [52] S. Backert, T. Kwok, M. Schmidt, M. Selbach, S. Moese, R.M. Peek Jr., W. König, T.F. Meyer, P.R. Jungblut, Subproteomes of soluble and structure-bound Helicobacter pylori proteins analysed by two-dimensional gel electrophoresis and mass spectrometry, Proteomics (2005) (in press). [53] D.J. Evans Jr., D.G. Evans, T. Takemura, H. Nakano, H.C. Lampert, D.Y. Graham, D.N. Granger, P.R. Kvietys, Characterization of a Helicobacter pylori neutrophil activating protein, Infect. Immun. 63 (1995) 2213–2220. [54] G. Del Giudice, A. Covacci, J.L. Telford, C. Montecucco, R. Rappuoli, The design of vaccines against Helicobacter pylori and their development, Annu. Rev. Immunol. 19 (2001) 523–563. [55] C. Cooksley, P.J. Jenks, A. Green, A. Cockayne, R.P. Logan, K.R. Hardie, NapA protects Helicobacter pylori from oxidative stress damage, and its production is influenced by the ferric uptake regulator, J. Med. Microbiol. 52 (2003) 461–469.

447

[56] K.A. Eaton, C.L. Brooks, D.R. Morgan, S. Krakowka, Essential role of urease in pathogenesis of gastritis induced by Helicobacter pylori in gnotobiotic piglets, Infect. Immun. 59 (1991) 2470–2475. [57] M. Tsuda, M. Karita, T. Mizote, M.G. Morshed, K. Okita, T. Nakazawa, Essential role of Helicobacter pylori urease in gastric colonization: definite proof using a urease-negative mutant constructed by gene replacement, Eur. J. Gastroenterol. Hepatol. 1 (1994) 49–52. [58] H. Kavermann, B.P. Burns, K. Angermuller, S. Odenbreit, W. Fischer, K. Melchers, R. Haas, Identification and characterization of Helicobacter pylori genes essential for gastric colonization, J. Exp. Med. 197 (2003) 813–822. [59] A. Leakey, J. La Brooy, R. Hirst, The ability of Helicobacter pylori to activate neutrophils is determined by factors other than H. pylori neutrophil-activating protein, J. Infect. Dis. 182 (2000) 1749–1755. [60] S. Strobel, S. Bereswill, P. Balig, P. Allgaier, H.G. Sonntag, M. Kist, Identification and analysis of a new vacA genotype variant of Helicobacter pylori in different patient groups in Germany, J. Clin. Microbiol. 36 (1998) 1285–1289. [61] L.J. van Doorn, C. Figueiredo, R. Sanna, S. Pena, P. Midolo, E.K. Ng, J.C. Atherton, M.J. Blaser, W.G. Quint, Expanding allelic diversity of Helicobacter pylori vacA, J. Clin. Microbiol. 36 (1998) 2597–2603.