Strong hypoxia reduces leptin synthesis in purified primary human trophoblasts

Placenta 36 (2015) 427e432

Contents lists available at ScienceDirect

Placenta journal homepage: www.elsevier.com/locate/placenta

Strong hypoxia reduces leptin synthesis in purified primary human trophoblasts E. Nüsken a, Y. Herrmann b, M. Wohlfarth a, T.W. Goecke c, d, S. Appel a, H. Schneider b, €tsch a, b, K.D. Nüsken a, b, * J. Do a

University of Cologne, Department of Pediatrics, Cologne, Germany University of Erlangen-Nuremberg, Department of Pediatrics, Erlangen, Germany University of Erlangen-Nuremberg, Department of Obstetrics and Gynecology, Erlangen, Germany d Medical Faculty of the University of Technology Aachen, Department of Gynecology and Obstetrics, Aachen, Germany b c

a r t i c l e i n f o

a b s t r a c t

Article history: Accepted 24 January 2015

Introduction: Oxygen availability severely affects placental function. During placental hypoxia, stabilization of hypoxia inducible factors (HIFs) affects transcription, and leptin gene expression concomitantly increases in vivo and in vitro. However, a causal relationship is uncertain. Methods: We investigated the effect of oxygen availability on HIF-1 alpha (HIF1A) and leptin regulation in primary human trophoblasts isolated from six normal term placentae cultured at 0.1%, 1%, 3%, and 8% oxygen for 6 h, 24 h and 48 h. Gene expressions of leptin (LEP), leptin receptors (LEPR), HIF1A, insulin receptor (INSR) and further genes relevant in hypoxia (VEGFA, EPO, NOS2) or apoptosis (BCL2, BAX, Tp53) were examined. Leptin, HIF1A, INSR, phospho-AKT/AKT (insulin receptor signaling), caspase 3 and cleaved caspase 3 (apoptosis) proteins were measured. Results: A hypoxic reaction with stabilization of HIF1A protein as well as up-regulation of HIF1A and VEGFA gene expressions, but without any hint for apoptosis, was present at 0.1% and 1% oxygen. However, leptin protein concentration (cell supernatants) peaked at 8% oxygen (normoxia) and was significantly reduced at 0.1% oxygen. There was no significant correlation between leptin and HIF1A, neither on the gene nor on the protein level. Discussion: Elevated leptin gene expression in hypoxic placentas may not originate from trophoblasts, but from other placental cells, or from interaction of trophoblasts with other cells. Not only fetal hyperleptinemia, but also fetal hypoleptinemia under hypoxic conditions is conceivable. Strategies to prevent leptin dysregulation during pregnancy should be elucidated to protect the offspring from fetal programming of leptin resistance and adiposity in later life. © 2015 Elsevier Ltd. All rights reserved.

Keywords: Placenta Trophoblast Hypoxia Leptin/leptin receptor

1. Introduction Leptin is an essential component in the regulation of energy metabolism and indispensible for fertility and reproduction [1]. During gestation, the human placenta produces leptin in high amounts and releases it both to the maternal and to the fetal circulation [2,3]. In complicated pregnancies, including intrauterine growth restriction and preeclampsia, leptin production in the human placenta is dysregulated [4e6]. Unlike in normal pregnancies,

* Corresponding author. University of Cologne, Department of Pediatrics, Kerpener Str. 62, 50937 Cologne, Germany. Tel.: þ49 221 478 96883; fax: þ49 221 478 5835. E-mail address: [email protected] (K.D. Nüsken). http://dx.doi.org/10.1016/j.placenta.2015.01.191 0143-4004/© 2015 Elsevier Ltd. All rights reserved.

fetal plasma leptin concentrations are positively correlated to maternal leptin concentrations [7,8]. Consequently, placental leptin production and trans-placental leptin transport, the latter possibly mediated by the short isoform of the placental leptin receptor [9], both have critical impact on fetal leptin exposure in certain gestational pathologies. Oxygen availability severely affects placental function in all stages of pregnancy, and hypoxia inducible factors (HIFs) are major mediators of oxygen dependent placental adaptations [10]. During hypoxia, HIFs are stabilized and act as transcription factors [11,12]. In pregnancies complicated by intrauterine growth restriction, preeclampsia or birth asphyxia, either acute or chronic hypoxia has been described, and increased placental leptin gene expression at birth is a common feature [13,14]. In JAr and in BeWo cells, two

428

E. Nüsken et al. / Placenta 36 (2015) 427e432

choriocarcinoma cell lines used to study placenta biology, hypoxia upregulates leptin gene expression in vitro [4,15,16]. The leptin gene promoter indeed is transactivated by HIF1 [17,18]. It was therefore suggested that oxygen is a major regulator of placental leptin expression via HIF-dependent activation of the leptin gene during hypoxia [18]. This mechanism is of high clinical interest, as it may strongly affect fetal leptin availability, a key factor contributing to perinatal programming of metabolic disease in later life [5,6,19,20]. Furthermore, trophic effects of leptin on placenta and fetus have been demonstrated [21e24]. However, a causal relationship between hypoxia-induced HIF1 activation and leptin elevation in the placenta has not been proven. In above mentioned clinical study, hypoxia inducible factor-1 alpha (HIF1A) protein could not be quantified [13]. In a rat model of reduced uteroplacental blood flow, placental leptin gene expression was even reduced at term [20]. Regarding in vitro studies, both JAr and BeWo cells are cancer cell lines and markedly differ from primary human trophoblasts. Most importantly, they are adapted to room oxygen whereas 8% oxygen concentration represents physiologic (“normoxic”) conditions for primary human trophoblasts [25]. Thus, the focus of our study was to examine the effect of different oxygen concentrations on HIF1A protein stabilization, leptin gene expression and leptin protein synthesis in primary human trophoblasts. Additionally, leptin receptor gene expressions were examined because of their assumed implication in transplacental leptin transport. Secondarily, we studied the effect of oxygen availability on insulin receptor signaling as an important modulator of leptin gene and protein expression [26,27]. To ensure data reliability, we examined common pro- and anti-apoptotic markers to address the question whether primary human trophoblasts survive in vitro even at very low oxygen tensions (i.e. 0.1% hypoxia for 48 h). 2. Material and methods The study was reviewed and approved by the local institutional review board (ethics committee) and performed in accordance with the Declaration of Helsinki. Informed consent was given by all participants. 2.1. Trophoblast isolation and cell culture Six human placentae from uncomplicated singleton term pregnancies (37e40 weeks of pregnancy) were collected immediately after elective caesarean section. Presence of hypertension, proteinuria, diabetes mellitus, heart insufficiency, HIVinfection and amniotic infection was excluded. Trophoblast cells were isolated using a modified trypsin-DNase-dispase/percoll method [28]. Further purification was performed using a negative immunomagnetic bead-separation leading to a final reduction of CD45-and HLA-ABC positive cells of less than 1% [29]. Within a maximum of 5 min after purification, cells were transferred to freezing-medium [70% Dulbecco's Modified Eagle's Medium (D-MEM/F-12; Invitrogen), 20% Dimethyl sulfoxide (DMSO; D8418, Sigma) and 10% fetal calf serum (PAA Laboratories)] and placed at 80  C overnight. Then, cells were transferred to liquid nitrogen for storage. Storage time was similar in all samples and did not exceed 4 weeks. Time for defrosting and transfer to fresh medium did not exceed 5 min. For RNA-isolation, 2.5  106 cells were seeded in 6 cm dishes and for protein isolation, 1  107 cells were seeded in 10 cm dishes. Cells were cultured in D-MEM/F-12 supplemented with 10% fetal calf serum and 1% Antibiotic-Antimycotic (100) liquid (Invitrogen) at 37  C in an incubator supplied with 5% CO2 and the respective oxygen concentration (0.1%, 1%, 3%, 8%). Oxygen concentration was monitored by an oxygen sensor. Additionally, mean oxygen partial pressures (mmHg) in cell supernatants were measured by a routine blood gas analyzer (ABL800 Basic, Radiometer) within 3 min after sample collection as follows: 0.1%, 6 h, 37.3; 0.1%, 48 h, 35.0; 1%, 6 h, 44.3; 1%, 48 h, 41.6; 3%, 6 h, 51.3; 3%, 48 h, 64.4; 8%, 6 h, 72.8; 8%, 48 h, 81.0. Cells were lysed after 6 h, 24 h and 48 h for RNA and protein quantification. Cell supernatants were used to measure leptin protein concentrations after 6 h and 48 h. The time points 6 h and 48 h were chosen to examine acute or chronic hypoxic effects, respectively. At 24 h, we analyzed gene expression only. 2.2. RNA isolation and PCR techniques We measured 1) genes relevant for regulation of/by leptin [leptin (LEP), full length leptin receptor (full LEPR), short leptin receptor (short LEPR), insulin receptor

(INSR)], 2) genes indicating cellular hypoxia [hypoxia inducible factor-1 alpha (HIF1A), vascular endothelial growth factor (VEGFA), erythropoietin (EPO), inducible NO-synthase (NOS2), as well as 3) pro-apoptotic [Bcl2-associated X protein (BAX), tumor protein p53 (Tp53)] and 4) anti-apoptotic [B-cell CLL/lymphoma 2 (BCL2)] genes (Table 1). Expression levels of target genes were normalized to the expression of five different housekeeping genes [YWAHZ, SDHA, TBP, beta2-microglobulin (B2M), beta-Actin (Table 1)], which were all tested for reliability. All normalizations showed similar results. Thus, gene expression results (Fig. 2A, Table 2) are shown normalized to YWAHZ (most reliable housekeeping gene). RNA was isolated using guanidineethiocyanate acid phenol (TRIzol®, Invitrogen). RNA concentrations were determined spectro-photometrically. One microgram of DNase-treated RNA was reversely transcribed in a volume of 26 ml (37  C, 60 min, Finnzymes oligonucleotides). Quantitative RT-PCR was performed on a 7500 Real-Time PCR-System (Applied Biosystems). Primers and probes (Table 1) were designed using Primer Express Software™ (Applied Biosystems). All of the primers and probes were purchased from Eurofins MWG. Commercial reagents (Eurogentec) and conditions were applied according to the manufacturer's protocol. 2.5 ml of complementary DNA (reverse transcription mixture), 2.5 ml of 200 mM TaqMan hybridization probe and 2.5 ml of each primer respectively were analyzed in a 25 ml-volume reaction mix. For quantification, the CT values of the samples were interpolated to an external standard curve (serial dilution) of a known template. 2.3. Protein isolation and western blot techniques Cells were lysed in extraction buffer (10 mM Tris pH 6.8; 6.65 M Urea, 10% Glycerol, 1% SDS, 10 ml/ml 0.5 M DTT, 10 ml/ml 50 mM PMSF), incubated on ice (1 h) and centrifuged (14.000 rpm, 15 min, 4  C). Subsequently, protein concentration was determined using a commercial kit (BCATM Protein Assay Kit, Thermo Scientific). For protein detection, 80 mg of protein were separated on 10% acrylamide SDS-PAGE under reducing conditions and transferred onto a nitrocellulose membrane for 120 min at 1.2 mA/cm2 using towbin buffer. Membranes were subsequently blocked (5% milk powder, 2% BSA, TRIS-buffered saline containing 0.05% Tween-20) and probed overnight with the primary antibody in blocking buffer at 4  C. Primary antibodies used were b-actin mAb #3700, Caspase-3 Rabbit Antibody #9662, cleaved caspase-3 Rabbit Antibody #9661, IRS-1 Rabbit mAb #3407, Akt Antibody #9272, Phospho-Akt Rabbit mAb #4058 (all CellSignaling), and HIF1A Rabbit Antibody NB100-449 (Novus Biologicals). After washing and incubation in HRPconjugated secondary antibody, membranes were developed using Amersham ECL Plus-Solution, GE-Healthcare. Secondary antibodies used were Anti-mouse IgG, HRP-linked Antibody #7076 and Anti-rabbit IgG, HRP-linked Antibody #7074 (all CellSignaling). 2.4. Statistical analysis All data was checked for outliers by Grubb's test (significance level p < 0.05). A maximum of one outlier was excluded from some data sets. The effect of different oxygen concentrations on either protein concentration or gene expression was analyzed by a global Friedman test (each time point separately) in the majority of analyses. In case of missing values due to excluded outliers, a Kruskal-Wallis-test (each time point separately) with Dunn's posttests was performed, because a Friedman test does not tolerate missing values. A p-value of <0.05 was considered to be statistically significant. The effect of incubation time was tested by comparing values with the same oxygen concentrations at 6 h with values at 48 h by a MannWhitney-test with a Bonferroni-adjusted p-value of <0.01 considered to be significant. Additionally, we performed Spearman correlation analyses of HIF1A as well as leptin gene expressions with the expression of the other measured genes at all oxygen concentrations analyzed in one analysis each, and of HIF1A/actin densitometric protein data with either leptin ELISA data or InsR/actin densitometric protein data.

3. Results 3.1. Primary human trophoblast cells react to 0.1% oxygen with immediate stabilization of HIF1A protein and subsequent upregulation of VEGFA, HIF1A and full LEPR gene expressions Strong hypoxia acutely stabilized HIF1A protein. Subsequently, gene expressions of HIF1A and VEGFA were induced. In the chronic hypoxic phase, HIF1A protein concentrations decreased, but gene expressions of VEGFA, HIF1A and full LEPR increased. In detail, HIF1A protein was stabilized at 0.1% and e to a lesser degree e 1% oxygen after 6 h of incubation and showed a double band at ~120 kDa. After 48 h, HIF1A protein stabilization was detectable at 0.1% oxygen only (Fig. 1). Densitometric HIF1A/beta-actin protein ratios, which were available from P3, P4 and P6 (n ¼ 3), showed a negative correlation with oxygen concentrations (due to low sample number only

E. Nüsken et al. / Placenta 36 (2015) 427e432

429

Table 1 Primers used. Gene

Forward

Housekeeping genes YWAHZ TGGTGATGACAAGAAAGGGATTG SDHA GACAGAGCCTCAAGTTTGGAAAG TBP TGTATCCACAGTGAATCTTGGTTGT B2M TGACTTTGTCACAGCCCAAGATA beta-Actin CCGCGAGAAGATGACCAG Target genes relevant for regulation of/by leptin LEP ACAATTGTCACCAGGATCAATGAC short LEPR AGGCTGAGGGTACTGAGGTAACC full LEPR GTAAGAGGCTAGATGGACTGGGATAT INSR AAAACCTCTTCAGGCACTGGTG Target genes indicating cellular hypoxia HIF1A GAAAAAGATAAGTTCTGAACGTCGAA VEGFA TGAGATCGAGTACATCTTCAAGCC EPO GCCCAGAAGGAAGCCATCTC NOS2 GCAGGTCGAGGACTATTTCTTTCA Target genes indicating apoptosis/anti-apoptosis BCL2 GGCTGGGATGCCTTTGTG BAX TGGAGCTGCAGAGGATGATTG Tp53 CCTGAGGTTGGCTCTGACTGTA

Reverse

Probe

TGGTTGCATTTCCTTTTTTGCT TCGCAGAGACCTTCCATATAAGG AAACCGCTTGGGATTATATTCG CCAAATGCGGCATCTTC CCAGTGGTACGGCCAGAGG

CGATCAGTCACAACAAGCATACCAAGAAGC TCGGACTGGCCACTCGCTATTGC AAGACCATTGCACTTCGTGCCCGAA TGATGCTGCTTACATGTCTCGATCCCA CCAGCCATGTACGTTGCTATCCAGGC

TCCAAACCGGTGACTTTCTGT GATCAGCGTGGCGTATTTAACA ATTCTCCAAAATTCAGGTCCTCTCA ATCGCCAAGGGACCTGC

TTTCACACACGCAGTCAGTCTCCTCCA ATGAGGCCGAAAGCCAGAGACAACCCT CCAGCCTACACAGTTGTCATGGATATAAAAGTTC CGAGGACCCTAGGCCATCTCGGAAA

CCTTATCAAGATGCGAACTCACA CACATTTGTTGTGCTGTAGGAAGC CCCGGAGGAAATTGGAGTAGA CGTAAGGAAATACAGCACCAAAGAT

AGCTTGCTCATCAGTTGCCACTTCCAC CCATGCAGATTATGCGGATCAAACCTCA CCTCAGCTGCTCCACTCCGAACAATC CTCAAGAGCCAGAAGCGCTATCACGAAGA

GCCAAACTGAGCAGAGTCTTCA TTGCCGTCAGAAAACATGTCA TGTTCCGTCCCAGTAGATTACCA

AACTGTACGGCCCCAGCATGCG CGTGGACACAGACTCCCCCCGA AGGCCCATCCTCACCATCATCACACT

LEP, leptin; LEPR, short form of leptin receptor; full LEPR, full length leptin receptor; INSR, insulin receptor; HIF1A, hypoxia inducible factor-1 alpha; VEGFA, vascular endothelial growth factor; EPO, erythropoietin; NOS2, inducible NO-synthase; BCL2, B-cell lymphoma 2 (anti-apoptotic); BAX (pro-apoptotic), Tp53 (pro-apoptotic).

significant at 48 h; 6 h: r ¼ 0.41, p ¼ 0.19; 48 h: r ¼ 0.69, p ¼ 0.01). HIF1A gene expression was up-regulated at 0.1% oxygen after 24 h and 48 h. VEGFA, a main HIF1 target gene, was upregulated at 0.1% oxygen after 24 h and 48 h and at 1% oxygen Table 2 Gene expressions of target genes (normalized by YWAHZ, normalization to other housekeeping genes showed similar results) in primary human trophoblasts in vitro. Oxygen concentrations of 0.1%, 1%, 3% and 8%, and incubation times of 6 h, 24 h and 48 h are shown. Gene

Time

full LEPR

6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h 6h 24 h 48 h

short LEPR

INSR

HIF1A

VEGFA

EPO

NOS2

BCL2

BAX

Tp53

3.2. Leptin gene expression and protein production in primary human trophoblasts are oxygen dependent, but peak at normoxia and are not correlated to hypoxia or HIF1A stabilization

Oxygen 0.1% 1.09 0.81 3.55 0.31 0.60 0.29 1.26 1.55 2.20 1.55 1.77 3.08 2.74 1.89 2.81 1.78 2.46 1.31 0.26 1.41 2.90 1.89 0.80 0.70 1.86 1.37 1.59 1.46 1.15 1.38

1% ± 0.24 ± 0.20 ± 0.98# ± 0.11 ± 0.22 ± 0.10 ± 0.41 ± 0.30 ± 0.50 ± 0.14 ± 0.35* ± 0.41#* ± 0.55 ± 0.17#** ± 0.28** ± 0.61 ± 1.44 ± 0.59 ± 0.22 ± 0.86 ± 0.80 ± 0.27# ± 0.09 ± 0.14 ± 0.57 ± 0.30 ± 0.29 ± 0.25 ± 0.27 ± 0.26

0.98 1.2 1.27 0.26 0.51 0.50 0.89 1.35 1.79 1.14 1.07 1.69 1.67 1.82 1.99 1.17 1.58 2.34 0.65 1.45 0.85 0.90 0.53 0.75 1.31 1.31 1.52 1.39 0.92 1.45

3% ± 0.18 ± 0.21 ± 0.19 ± 0.04 ± 0.14 ± 0.08 ± 0.08 ± 0.14 ± 0.34 ± 0.18 ± 0.08 ± 0.25 ± 0.35 ± 0.35* ± 0.45 ± 0.43 ± 0.61 ± 1.35 ± 0.22 ± 0.68 ± 0.25 ± 0.12 ± 0.06* ± 0.14 ± 0.17 ± 0.23 ± 0.24 ± 0.17 ± 0.14 ± 0.33

0.79 1.03 0.85 0.33 0.55 0.41 0.91 1.37 2.05 1.09 1.14 1.37 1.27 0.81 1.31 1.63 1.62 3.53 0.56 1.31 0.86 0.80 0.61 0.78 1.20 1.34 1.46 1.17 1.01 1.54

8% ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.16 0.14 0.14 0.07 0.13 0.15 0.15 0.23 0.43 0.20 0.13 0.34 0.23 0.17 0.28 0.67 0.90 2.15 0.23 0.52 0.53 0.07 0.09 0.12 0.22 0.16 0.27 0.16 0.20 0.32

0.66 0.75 2.10 0.36 0.41 0.29 0.89 1.17 1.58 1.23 0.80 1.25 1.44 0.61 0.68 1.43 2.04 2.82 0.45 1.32 2.30 0.82 1.11 1.41 1.15 1.33 1.33 1.07 1.09 1.05

after 24 h, resembling preceding HIF1A protein concentration and concomitant HIF1A gene expression. Gene expression of the full LEPR increased at 0.1% oxygen after 48 h (Table 2). Moreover, we found a positive correlation of HIF1A gene expression not only with the gene expressions of VEGFA (6 h, r ¼ 0.83, p < 0.001; 48 h, r ¼ 0.85, p < 0.001), but also with the full LEPR (6 h, r ¼ 0.64, p ¼ 0.001; 48 h, r ¼ 0.49, p ¼ 0.01).

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

0.19 0.13 0.37 0.10 0.08 0.06 0.14 0.20 0.35 0.21 0.10 0.19 0.21 0.10 0.11 0.51 0.87 1.31 0.16 0.58 0.72 0.12 0.16 0.24 0.18 0.20 0.26 0.12 0.19 0.28

*, p < 0.05 compared to 8%; **, p < 0.01 compared to 8%; #, p < 0.05 compared to 3% (Dunn's post test). Values are shown as mean ± SEM. Short LEPR, short form of leptin receptor; full LEPR, full length leptin receptor; INSR, insulin receptor; HIF1A, hypoxia inducible factor-1 alpha; VEGFA, vascular epithelial growth factor; EPO, erythropoietin; NOS2, inducible NO-synthase; BCL2, B-cell lymphoma 2 (anti-apoptotic); BAX (pro-apoptotic); Tp53 (pro-apoptotic).

Interestingly, leptin gene and protein expression seemed to be independent of or even suppressed by strong hypoxia in our primary human trophoblasts (Fig. 2A, B). After 6 h, leptin protein (pg/ mL) was hardly detectable in any of the cell supernatants, irrespective of the oxygen concentration (0.1%, 1.94 ± 0.31; 1%, 2.26 ± 0.41; 3%, 2.94 ± 0.83; 8%, 2.18 ± 0.34). Most interestingly, a significant, time-dependent, sometimes more than 100-fold increase of leptin protein concentration in supernatants (48 h compared to 6 h) at oxygen levels of 1%, 3% and 8% (p < 0.01 each)

Fig. 1. Representative Western blot (placenta P4) of HIF-1a [molecular weight 120 kDa; single or double band; 130 kDa marker (M) is shown on the left] in primary human trophoblasts at different oxygen concentrations after 6 h (left side) and 48 h (right side) incubation time. Beta-actin served as loading control [molecular weight 45 kDa; 45 kDa marker (M) is shown on the left]. Densitometric ratio of HIF-1a/b-actin from n ¼ 3 placentae (P3, P4 and P6) is shown as plot below the bands as mean ± SEM. Relevant stabilization of HIF1a protein was observed at 0.1% and 1% oxygen after 6 h incubation time and at 0.1% oxygen after 48 h incubation time.

430

E. Nüsken et al. / Placenta 36 (2015) 427e432

as of the anti-apoptotic gene BCL2. The fact that HIF1A principally is capable to induce pro-apoptotic genes was supported by the finding of a positive correlation of HIF1A gene expression with the gene expressions of BAX (6 h, r ¼ 0.88, p < 0.001; 48 h, r ¼ 0.55, p < 0.01) and Tp53 (6 h, r ¼ 0.79, p < 0.001; 48 h, r ¼ 0.69, p < 0.001). However, BAX and Tp53 did not show oxygen dependency (Table 2). The anti-apoptitic gene BCL2 was increased at 0.1% oxygen after 6 h and decreased at 1% oxygen after 24 h (Table 2). On the protein level, we performed a western blot differentiating caspase-3 and cleaved caspase-3 protein expression, calculated the ratio of cleaved caspase-3/caspase-3 to estimate apoptosis and did not find any difference between oxygen concentrations (Fig. 3). Thus, hypoxia did not add to apoptosis in our experimental setting. 3.4. Placental insulin-receptor signaling in primary human trophoblasts is not affected by hypoxia

Fig. 2. A: Leptin/YWAHZ mRNA expression (relative units; mean ± SEM) after incubation with 0.1%, 1%, 3% or 8% oxygen (for further legend see figure) for 6 h, 24 h or 48 h. B: Human leptin concentrations in cell supernatants after incubation with 0.1%, 1%, 3% or 8% oxygen for 48 h. *, p < 0.05 compared to 8%; #, p < 0.05 compared to 3% (Friedman test, overall p ¼ 0.002). Horizontal lines indicate mean values. Points indicate single values, which are labeled with the number of the placenta. Adjustment of leptin concentrations for maternal BMI did neither affect variation of the data nor significances of comparisons (data not shown).

was not detected at 0.1% oxygen. Similarly, a time-depended rise in leptin gene expression levels was found at oxygen concentrations of 1%, 3% and 8% (p ¼ 0.01 to p < 0.001), but not at 0.1% oxygen (Fig. 2A). After 48 h, secreted leptin concentrations were significantly reduced at 0.1% oxygen compared to 3% and 8% oxygen (p < 0.05) and peaked at mild hypoxia to normoxia (3%e8% oxygen; Fig. 2B). The expression of the LEP gene also did not peak at strong hypoxia, but at 3% oxygen (Fig. 2A). Correlation analysis of leptin protein concentrations with HIF1A/b-actin densitometric data was not significant (6 h, r ¼ 0.22, p ¼ 0.52; 48 h, r ¼ 0.23, p ¼ 0.50). Gene expression of LEP did not correlate with HIF1A gene expression at any time point. A secondary finding was that leptin gene expression correlated negatively with the gene expression of the short leptin receptor (short LEPR) after 48 h (r ¼ 0.56, p < 0.01). 3.3. Hypoxia does not add to apoptosis To ensure data reliability, we addressed the question whether primary trophoblast cells undergo apoptosis at 0.1% hypoxia which would result in reduced leptin production. Therefore, we studied gene expressions of the pro-apoptotic genes BAX and Tp53 as well

In order to find an alternative explanation for the leptin-peak at mild hypoxia to normoxia, we examined insulin receptor signaling, which e.g. can be activated by trophoblast-derived IGF2 [27]. However, INSR protein expression in cell lysates (Fig. 4) did not increase after 48 h compared to 6 h, thus not resembling rising leptin concentrations. INSR/b-actin densitometric data (Fig. 4) did not correlate with leptin concentrations in cell supernatants, neither after 6 h (r ¼ 0.22, p ¼ 0.52) nor after 48 h (r ¼ 0.43, p ¼ 0.17). Insulin receptor signaling as estimated by the AKT/ phospho-AKT protein ratio could be measured in primary human trophoblasts from a single placenta (P4) and showed a small upregulation going parallel to increasing oxygen after 48 h (Fig. 5). On the mRNA level, we found a positive correlation of HIF1A gene expression with gene expression of the insulin receptor (INSR; 6 h, r ¼ 0.75, p < 0.001; 48 h, r ¼ 0.65, p < 0.001). However, INSR gene expression significantly increased after 48 h compared to 6 h at 3% and 8% oxygen (p < 0.05 each), but not at 0.1% and 1% oxygen. In summary, we did not find clear evidence for significant modification of leptin production by insulin receptor signaling in our primary human trophoblasts. 4. Discussion The focus of the present study was to test the hypothesis that hypoxia and HIF1A-dependent mechanisms are involved in the placental up-regulation of leptin. In primary human trophoblasts derived from six different term placentas, we found that strong hypoxia stabilized intracellular HIF1A protein in all placentas, followed by an induction of the gene expressions of HIF1A, VEGFA,

Fig. 3. Representative Western blot (placenta P4) of cleaved caspase 3 [molecular weight 17 kDa þ 19 kDa, marker for active apoptosis; 15 kDa marker (M) is shown on the left] and caspase 3 [molecular weight 35 kDa, inactive; 35 kDa marker (M) is shown on the left] in primary human trophoblasts at different oxygen concentrations after 6 h (left side) and 48 h (right side) incubation time. Beta-actin served as loading control [molecular weight 45 kDa; 45 kDa marker (M) is shown on the left]. Cleaved caspase 3 intensity was low at all oxygen concentrations, indicating absence of apoptosis.

E. Nüsken et al. / Placenta 36 (2015) 427e432

Fig. 4. Representative Western blot (placenta P4) of insulin receptor [Ins-R; molecular weight 130kD; 130 kDa marker (M) is shown on the left] in primary human trophoblasts at different oxygen concentrations after 6 h (left side) and 48 h (right side) incubation time. Beta-actin served as loading control [molecular weight 45 kDa; 45 kDa marker (M) is shown on the left]. Densitometric ratio of Ins-R/b-actin from n ¼ 3 placentae (P3, P4 and P6) is shown as plot below the bands as mean ± SEM. Insulin receptor protein expression did not depend on oxygen concentration or incubation time.

BCL2 and the full length LEPR in vitro. Contrary to our initial hypothesis, neither leptin gene expression nor leptin protein secretion were elevated by hypoxia. Leptin regulation was rather independent of hypoxia and HIF1A, or even suppressed under hypoxic conditions. To ensure data reliability, we verified that our experimental setting truly induces a hypoxic reaction in vitro and confirmed that human trophoblasts are very tolerant to hypoxia and do not undergo apoptosis despite severe hypoxic conditions. On the first view, our observations are inconsistent with former studies. However, most authors of in vitro studies examined trophoblast cancer cell lines (JAr, BeWo), which markedly differ from primary human trophoblasts. The cancer cell lines were cultured at low (1e6%) compared to room oxygen concentrations (20e21%) [4,15,16]. The latter is an adequate control setting for cancer cells which are adapted to 21% oxygen, but represents hyperoxic conditions for primary human trophoblasts [25]. Even more important, HIF1A protein is permanently stabilized in the cancer cell lines, but not in primary trophoblasts, which most likely results in a different ability to induce genes by (further) stabilization of HIF1A [26]. Thus, we cultured primary human trophoblasts from uncomplicated pregnancies at four different oxygen concentrations and defined 8% oxygen (~80 mmHg) as normoxic controls. With respect to clinical studies, our group showed that leptin gene expression is elevated in placental tissue exposed to potential acute or chronic hypoxic conditions. A limitation was that we were not able to measure HIF1A protein expression to verify a true

Fig. 5. Western blot (placenta P4) of phospho-Akt [molecular weight 60 kDa, upper image, 55 kDa marker (M) is shown on the left] and Akt [molecular weight 60 kDa, lower image, 55 kDa marker (M) is shown on the left] in primary human trophoblasts at different oxygen concentrations after 6 h (left side) and 48 h (right side) incubation time. Densitometric ratio of phospho-Akt/Akt is shown as plot below the bands to indicate the activity of intracellular insulin signaling.

431

hypoxic cellular reaction [4,13]. In preeclampsia, several authors observed elevated placental leptin expression as well as elevated leptin concentrations in the maternal circulation while HIF1-alpha mRNA and protein expression were found to be abnormally elevated [4,30,31]. However, a causal relationship has not been proven. Recent work suggests that other mechanisms like altered expression of miRNAs [32] or increased expression of B-cell lymphoma 6, a transcriptional repressor [33], could possibly play a role in the regulation of leptin expression during preeclampsia instead of hypoxia. In IUGR pregnancies, also associated with fetal and placental hyperleptinemia, not only hypoxic but also relatively hyperoxic placental areas (due to ineffective oxygen transfer to the fetus following villous maldevelopment) might be the source of increased leptin production [34]. Subsequent works showed that placental leptin may even be suppressed under hypoxic conditions. In a rat model of placental hypoperfusion, we observed decreased placental leptin gene expression at term [20]. Similarly, adult rats during short-term hypoxia and short-term carbon monoxide inhalation showed decreased leptin synthesis in adipose tissue [35]. In primary human trophoblasts in vitro, hypoxia attenuated insulin-mediated stimulation of leptin expression [36]. Thus, there is a growing body of evidence that leptin synthesis in trophoblast cells can be reduced during significant hypoxia in the most relevant leptin producing tissues in vivo and in vitro. However, the findings described above in primary trophoblast cells may not be representative for the whole placenta, which is a limitation of our study. In pregnancies complicated by adiposity it could recently be shown that there is a linear increase in leptin expression in placental vascular endothelial cells while there is no change of leptin expression in syncytiotrophoblast cells [37]. In placental tissue, leptin promotes survival of trophoblast cells [38]. Our group showed an up-regulation of full length leptin receptor at hypoxic conditions [29], being in line with our current data of increased full LEPR expression after 48 h of severe hypoxia and a positive correlation between HIF1A and full LEPR. Additionally, we found that the gene encoding the anti-apoptotic protein BCL2 is up-regulated after 6 h of severe hypoxia. These cellular reactions may help primary human trophoblasts to survive under severely hypoxic conditions, even when leptin availability is low. As hypoxia alone may not be the main regulator of placental leptin production, the mechanisms leading to leptin dysregulation during pregnancy remain to be elucidated. Perinatal hypoleptinemia [20] and hyperleptinemia [39] can cause life-long leptin resistance by perinatal programming and are of high clinical relevance. A multitude of hormones like corticotropin-releasing hormone (CRH) [40], insulin [41], 17beta-estradiol [42] or human chorionic gonadotropin [43] can up-regulate leptin in both trophoblast cell lines and primary trophoblast cells or placental explants and deserve further study. In addition, recent work has identified miRNAs [32] or genes like BCL6, a transcriptional repressor [33]. as new candidates potentially involved in the regulation of placental leptin expression. In summary, primary human trophoblast cells are very tolerant to hypoxia and show a clear hypoxic reaction in terms of HIF1A protein stabilization and increased VEGFA gene expression exclusively at very low oxygen tensions (35e45 mmHg). Trophoblast leptin synthesis is significantly reduced under strong hypoxia, compared to mild hypoxia (~60 mmHg) and physiologic conditions (70e80 mmHg). Therefore, hyperleptinemia in pregnancies complicated by placental hypoxia may not originate from increased leptin secretion from trophoblast cells, but from other placental cells, or from interaction of trophoblasts with other cells. Fetal hypoleptinemia due to suppressed placental leptin production under hypoxic conditions is also conceivable. Mechanisms to prevent leptin dysregulation during pregnancy should be elucidated

432

E. Nüsken et al. / Placenta 36 (2015) 427e432

by future research to protect the offspring from fetal programming of leptin resistance and adiposity in later life. Conflict of interest statement All authors declare that there is no conflict of interest concerning this study. Acknowledgment This study was supported by DFG grant #DO682/3-4 to JD, HS and KDN. References [1] Chehab FF. 20 years of leptin: leptin and reproduction: past milestones, present undertakings, and future endeavors. J Endocrinol 2014;223(1):T37e48. [2] Masuzaki H, Ogawa Y, Sagawa N, Hosoda K, Matsumoto T, Mise H, et al. Nonadipose tissue production of leptin: leptin as a novel placenta-derived hormone in humans. Nat Med 1997;3(9):1029e33. [3] Linnemann K, Malek A, Sager R, Blum WF, Schneider H, Fusch C. Leptin production and release in the dually in vitro perfused human placenta. J Clin Endocrinol Metab 2000;85(11):4298e301. [4] Dotsch J, Nusken KD, Knerr I, Kirschbaum M, Repp R, Rascher W. Leptin and neuropeptide Y gene expression in human placenta: ontogeny and evidence for similarities to hypothalamic regulation. J Clin Endocrinol Metab 1999;84(8):2755e8. [5] Tzschoppe A, Struwe E, Rascher W, Dorr HG, Schild RL, Goecke TW, et al. Intrauterine growth restriction (IUGR) is associated with increased leptin synthesis and binding capability in neonates. Clin Endocrinol (Oxf) 2011;74(4): 459e66. [6] Struwe E, Berzl G, Schild R, Blessing H, Drexel L, Hauck B, et al. Microarray analysis of placental tissue in intrauterine growth restriction. Clin Endocrinol (Oxf) 2010;72(2):241e7. [7] Lea RG, Howe D, Hannah LT, Bonneau O, Hunter L, Hoggard N. Placental leptin in normal, diabetic and fetal growth-retarded pregnancies. Mol Hum Reprod 2000;6(8):763e9. [8] McCarthy JF, Misra DN, Roberts JM. Maternal plasma leptin is increased in preeclampsia and positively correlates with fetal cord concentration. Am J Obstet Gynecol 1999;180(3 Pt 1):731e6. [9] Smith JT, Waddell BJ. Leptin distribution and metabolism in the pregnant rat: transplacental leptin passage increases in late gestation but is reduced by excess glucocorticoids. Endocrinology 2003;144(7):3024e30. [10] Adelman DM, Gertsenstein M, Nagy A, Simon MC, Maltepe E. Placental cell fates are regulated in vivo by HIF-mediated hypoxia responses. Genes Dev 2000;14(24):3191e203. [11] Semenza GL, Agani F, Booth G, Forsythe J, Iyer N, Jiang BH, et al. Structural and functional analysis of hypoxia-inducible factor 1. Kidney Int 1997;51(2): 553e5. [12] Semenza GL. Perspectives on oxygen sensing. Cell 1999;98(3):281e4. [13] Trollmann R, Klingmuller K, Schild RL, Rascher W, Dotsch J. Differential gene expression of somatotrophic and growth factors in response to in vivo hypoxia in human placenta. Am J Obstet Gynecol 2007;197(6):601 e1e6. [14] Linnemann K, Malek A, Schneider H, Fusch C. Physiological and pathological regulation of feto/placento/maternal leptin expression. Biochem Soc Trans 2001;29(Pt 2):86e90. [15] Grosfeld A, Turban S, Andre J, Cauzac M, Challier JC, Hauguel-de Mouzon S, et al. Transcriptional effect of hypoxia on placental leptin. FEBS Lett 2001;502(3):122e6. [16] Meissner U, Spranger R, Lehner M, Allabauer I, Rascher W, Dotsch J. Hypoxiainduced leptin production in human trophoblasts does not protect from apoptosis. Eur J Endocrinol 2005;153(3):455e61. [17] Grosfeld A, Andre J, Hauguel-De Mouzon S, Berra E, Pouyssegur J, GuerreMillo M. Hypoxia-inducible factor 1 transactivates the human leptin gene promoter. J Biol Chem 2002;277(45):42953e7. [18] Ambrosini G, Nath AK, Sierra-Honigmann MR, Flores-Riveros J. Transcriptional activation of the human leptin gene in response to hypoxia. Involvement of hypoxia-inducible factor 1. J Biol Chem 2002;277(37):34601e9. [19] Nusken KD, Dotsch J, Rauh M, Rascher W, Schneider H. Uteroplacental insufficiency after bilateral uterine artery ligation in the rat: impact on postnatal glucose and lipid metabolism and evidence for metabolic programming of the offspring by sham operation. Endocrinology 2008;149(3): 1056e63.

[20] Nusken KD, Schneider H, Plank C, Trollmann R, Nusken E, Rascher W, et al. Fetal programming of gene expression in growth-restricted rats depends on the cause of low birth weight. Endocrinology 2011;152(4):1327e35. [21] Cameo P, Bischof P, Calvo JC. Effect of leptin on progesterone, human chorionic gonadotropin, and interleukin-6 secretion by human term trophoblast cells in culture. Biol Reprod 2003;68(2):472e7. [22] Castellucci M, De Matteis R, Meisser A, Cancello R, Monsurro V, Islami D, et al. Leptin modulates extracellular matrix molecules and metalloproteinases: possible implications for trophoblast invasion. Mol Hum Reprod 2000;6(10): 951e8. [23] Sierra-Honigmann MR, Nath AK, Murakami C, Garcia-Cardena G, Papapetropoulos A, Sessa WC, et al. Biological action of leptin as an angiogenic factor. Science 1998;281(5383):1683e6. [24] Bouret SG, Draper SJ, Simerly RB. Trophic action of leptin on hypothalamic neurons that regulate feeding. Science 2004;304(5667):108e10. [25] Jauniaux E, Watson A, Ozturk O, Quick D, Burton G. In-vivo measurement of intrauterine gases and acid-base values early in human pregnancy. Hum Reprod 1999;14(11):2901e4. [26] Levy JR, Stevens W. The effects of insulin, glucose, and pyruvate on the kinetics of leptin secretion. Endocrinology 2001;142(8):3558e62. [27] Regazzetti C, Peraldi P, Gremeaux T, Najem-Lendom R, Ben-Sahra I, Cormont M, et al. Hypoxia decreases insulin signaling pathways in adipocytes. Diabetes 2009;58(1):95e103. [28] Kliman HJ, Nestler JE, Sermasi E, Sanger JM, Strauss 3rd JF. Purification, characterization, and in vitro differentiation of cytotrophoblasts from human term placentae. Endocrinology 1986;118(4):1567e82. [29] Klaffenbach D, Meissner U, Raake M, Fahlbusch F, Alejandre Alcazar MA, Allabauer I, et al. Upregulation of leptin-receptor in placental cells by hypoxia. Regul Pept 2011;167(1):156e62. [30] Iwagaki S, Yokoyama Y, Tang L, Takahashi Y, Nakagawa Y, Tamaya T. Augmentation of leptin and hypoxia-inducible factor 1alpha mRNAs in the pre-eclamptic placenta. Gynecol Endocrinol 2004;18(5):263e8. [31] Caniggia I, Winter JL. Adriana and Luisa Castellucci Award lecture 2001. Hypoxia inducible factor-1: oxygen regulation of trophoblast differentiation in normal and pre-eclamptic pregnanciesea review. Placenta 2002;23(Suppl. A):S47e57. [32] Weedon-Fekjaer MS, Sheng Y, Sugulle M, Johnsen GM, Herse F, Redman CW, et al. Placental miR-1301 is dysregulated in early-onset preeclampsia and inversely correlated with maternal circulating leptin. Placenta 2014;35(9): 709e17. [33] Louwen F, Muschol-Steinmetz C, Friemel A, Kampf AK, Tottel E, Reinhard J, et al. Targeted gene analysis: increased B-cell lymphoma 6 in preeclamptic placentas. Hum Pathol 2014;45(6):1234e42. [34] Kingdom J, Huppertz B, Seaward G, Kaufmann P. Development of the placental villous tree and its consequences for fetal growth. Eur J Obstet Gynecol Reprod Biol 2000;92(1):35e43. [35] Meissner U, Hanisch C, Ostreicher I, Knerr I, Hofbauer KH, Blum WF, et al. Differential regulation of leptin synthesis in rats during short-term hypoxia and short-term carbon monoxide inhalation. Endocrinology 2005;146(1): 215e20. [36] Spranger RM, Hartner A, Schild RL, Stuppy A, Knerr I, Rascher W, et al. Leptin expression in primary trophoblast cells in response to incubation with the serum of preeclamptic women. Hypertens Pregnancy 2008;27(3):267e77. [37] Tsai PJ, Davis J, Bryant-Greenwood G. Systemic and placental leptin and its receptors in pregnancies associated with obesity. Reprod Sci 2015;22(2): 189e97. [38] Maymo JL, Perez Perez A, Gambino Y, Calvo JC, Sanchez-Margalet V, Varone CL. Review: leptin gene expression in the placentaeregulation of a key hormone in trophoblast proliferation and survival. Placenta 2011;32(Suppl. 2):S146e53. [39] Taylor PD, Samuelsson AM, Poston L. Maternal obesity and the developmental programming of hypertension: a role for leptin. Acta Physiol (Oxf) 2014;210(3):508e23. [40] Fahlbusch FB, Ruebner M, Volkert G, Offergeld R, Hartner A, MenendezCastro C, et al. Corticotropin-releasing hormone stimulates expression of leptin, 11beta-HSD2 and syncytin-1 in primary human trophoblasts. Reprod Biol Endocrinol 2012;10:80. [41] Perez-Perez A, Maymo J, Gambino Y, Guadix P, Duenas JL, Varone C, et al. Insulin enhances leptin expression in human trophoblastic cells. Biol Reprod 2013;89(1):20. [42] Gambino YP, Maymo JL, Perez-Perez A, Duenas JL, Sanchez-Margalet V, Calvo JC, et al. 17Beta-estradiol enhances leptin expression in human placental cells through genomic and nongenomic actions. Biol Reprod 2010;83(1):42e51. [43] Maymo JL, Perez Perez A, Sanchez-Margalet V, Duenas JL, Calvo JC, Varone CL. Up-regulation of placental leptin by human chorionic gonadotropin. Endocrinology 2009;150(1):304e13.