Structural and functional characterization of an iron–sulfur cluster assembly scaffold protein-SufA from Plasmodium vivax

Gene 585 (2016) 159–165

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

Structural and functional characterization of an iron–sulfur cluster assembly scaffold protein-SufA from Plasmodium vivax Zarna Rajeshkumar Pala a, Vishal Saxena a, Gagandeep Singh Saggu a, Sushil Kumar Yadav b, R.P. Pareek b, Sanjay Kumar Kochar c, Dhanpat Kumar Kochar d, Shilpi Garg a,⁎ a

Department of Biological Sciences, Birla Institute of Technology and Science, Pilani, Rajasthan, India Department of Pharmacy, Birla Institute of Technology and Science, Pilani, Rajasthan, India Department of Medicine, Sardar Patel Medical College, Bikaner, Rajasthan, India d Department of Medicine, Rajasthan University of Health Sciences, Jaipur, Rajasthan, India b c

a r t i c l e

i n f o

Article history: Received 12 February 2016 Received in revised form 22 March 2016 Accepted 22 March 2016 Available online 28 March 2016 Keywords: Apicoplast Suf pathway Clinical isolates Immunofluorescence

a b s t r a c t Iron–sulfur (Fe–S) clusters are utilized as prosthetic groups in all living organisms for diverse range of cellular processes including electron transport in respiration and photosynthesis, sensing of ambient conditions, regulation of gene expression and catalysis. In Plasmodium, two Fe–S cluster biogenesis pathways are reported, of which the Suf pathway in the apicoplast has been shown essential for the erythrocytic stages of the parasite. While the initial components of this pathway detailing the sulfur mobilization have been elucidated, the components required for the assembly and transfer of Fe–S clusters are not reported from the parasite. In Escherichia coli, SufB acts as a scaffold protein and SufA traffics the assembled Fe–S cluster from SufB to target apo-proteins. However, in Plasmodium, the homologs of these proteins are yet to be characterized for their function. Here, we report a putative SufA protein from Plasmodium vivax with signature motifs of A-type scaffold proteins, which is evolutionarily conserved. The presence of the [Fe4S4]3+ cluster under reduced conditions was confirmed by UV–visible and EPR spectroscopy and the interaction of these clusters with the conserved cysteine residues of chains A and B of PvSufA, validates its existence as a dimer, similar to that in E. coli. The H-bond interactions at the PvSufA–SufB interface demonstrate SufA as a scaffold protein in conjunction with SufB for the pre-assembly of Fe–S clusters and their transfer to the target proteins. Co-localization of the protein to the apicoplast further provides an experimental evidence of a functional scaffold protein SufA for the biogenesis of Fe–S clusters in apicoplast of Plasmodium. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Apicoplast, a non-photosynthetic plastid in the apicomplexans has gained a lot of attention in the last two decades as a putative drug target due to its prokaryotic nature and indispensability for the parasite survival (Ralph et al., 2001). It harbors four major metabolic pathways of importance, amongst which the iron sulfur [Fe–S] cluster biogenesis pathway is essential for apicoplast maintenance in the erythrocytic stage of Plasmodium (Gisselberg et al., 2013; Haussig et al., 2014). Many of the enzymes involved in major metabolic pathways like IspG and IspH (isoprenoids biosynthesis pathway), lipoate synthase (LipA) and the t-RNA modification enzyme (MiaB) require 4Fe–4S clusters for their activity (Pierrel et al., 2002; Cicchillo et al., 2004; Zepeck

Abbreviations: Fe–S, iron–sulfur; Suf, sulfur mobilization; Pv, Plasmodium vivax; EPR, electro paramagnetic resonance; Isc, iron–sulfur cluster; Nif, nitrogen fixation. ⁎ Corresponding author at: Molecular Parasitology and Systems Biology Laboratory, Department of Biological Sciences, Birla Institute of Technology and Science, Pilani, Rajasthan 333031, India. E-mail addresses: [email protected], [email protected] (S. Garg).

http://dx.doi.org/10.1016/j.gene.2016.03.041 0378-1119/© 2016 Elsevier B.V. All rights reserved.

et al., 2005; Rekittke et al., 2008; Lee et al., 2010). The functionality of these proteins is further believed to depend on the 2Fe–2S electron transfer protein ferredoxin (Fd) (Rohrich et al., 2005; Kimata-Ariga et al., 2007), which further details the importance of Fe–S clusters and the pathway. Fe–S cluster biogenesis pathways are conserved in nature, with three distinct pathways reported in the prokaryotes, namely: Isc (iron–sulfur cluster) and Nif (nitrogen fixation machinery) for housekeeping cluster assembly and Suf (sulfur mobilization) to be used under stress conditions. In Plasmodium, the Isc and Suf pathways have been shown to exist, where some of the constituent proteins involved in these pathways are targeted to the parasite's mitochondria and apicoplast respectively (Gisselberg et al., 2013; Haussig et al., 2014). All the key molecules participating in the above pathway are nuclear encoded except the SufB which is encoded by the apicoplast genome and interacts with SufC, an ATPase lying in close proximity to the apicoplast membrane (Kumar et al., 2011). Another component of the Suf system, SufS is active in the apicoplast and along with SufE transfers the sulfur from cysteine to SufBCD complex (Gisselberg et al., 2013; Charan et al., 2014). While the mobilization of sulfur catalyzed by

160

Z.R. Pala et al. / Gene 585 (2016) 159–165

SufSE complex have been extensively studied, the subsequent steps detailing the assembly of mobilized sulfur and iron to form Fe–S clusters and their transfer to the apo-proteins is still functionally uncharacterized in Plasmodium. Thus, to further unfold the importance of this pathway in the parasite, we have characterized one of the components of the Fe–S cluster biogenesis pathway; an iron sulfur cluster assembly accessory protein (SufA, putative) from Plasmodium vivax. We report apicoplast specific localization of the full length recombinant PvSufA protein and in vitro formation of [4Fe–4S] clusters on this protein. In addition to this, we also analysed the interaction of PvSufA with other components of the pathway like PvSufB and PvSufC in silico to explore the interacting partners involved in the assembly and transfer of the [4Fe–4S] clusters to the apo-proteins. 2. Materials and methods 2.1. Patient sample collection, RNA isolation and cDNA preparation Clinically proven (using conventional microscopy and rapid diagnostic tests) P. vivax infected patient venous blood samples were collected in acid citrate dextrose (ACD) from patients admitted to S.P. Medical College and associated group of hospitals, Bikaner, India. A formal approval of participating Institute's Human Ethics Committee (approval no. IHEC-35/13-14) and patient's consent was taken prior to collection for further studies. Blood was immediately subjected to density gradient centrifugation (Histopaque 1077, Sigma Aldrich, USA) to separate the infected RBCs which were further stored in Tri Reagent (Sigma Aldrich, USA). Total RNA and DNA were isolated from these samples using the manufacturer's protocol. The presence of P. vivax mono infection was confirmed by diagnostic PCR based on 18S rRNA gene (Das et al., 1995; Kochar et al., 2005) and 28S rRNA gene (Pakalapati et al., 2013). RNA from confirmed P. vivax cases was used to prepare total cDNA using QuantiTect Reverse Transcription Kit (QIAGEN, Germany). 2.2. Multiple sequence and phylogenetic analysis To understand the evolutionary position of Indian PvSufA protein, a phylogenetic tree was constructed using MEGA 6.0 (Tamura et al., 2006). Multiple sequence alignment was done for Indian PvSufA (gene ID: KU556730) with the SufA sequences available from different apicomplexans and prokaryotes at NCBI using CLUSTAL Omega (Sievers et al., 2011). The evolutionary history was inferred using the maximum-likelihood method (Jones et al., 1992). The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the taxa analysed (Felsenstein, 1985) where the analysis involved 17 amino acid sequences. All positions containing gaps and missing data were eliminated. There were a total of 79 positions in the final dataset. To obtain the phylogenetic tree, neighbor-join and BioNJ algorithms were applied to a matrix of pairwise distances estimated using a JTT model, and then the topology with superior log likelihood value was selected (Tamura et al., 2006).

pLysS cells (Promega, USA) and the expression was checked on a 15% SDS PAGE. Recombinant (6X His)-PvSufA (~ 21 kDa) was purified through a Ni-NTA matrix (QIAGEN, Germany) and presence of recombinant protein was confirmed by western blotting using anti-His antibodies (QIAGEN, Germany). 2.4. Antibody raising and immuno-localization Purified PvSufA protein (30 μg) was formulated with Freund's adjuvant (Merck, India) and injected in 4–5 weeks old female Swiss Albino out-bred mice followed by three booster doses at regular intervals of 21 days (Edward and David, 1988). All the protocols were approved by Institute's Animal Ethics Committee (approval no. IAEC/RES/18/30). The specificity of the PvSufA protein antibodies in the serum samples was confirmed by western blot analysis and antibody titre of each sera sample was checked using ELISA. The confirmed sera samples with good antibody titre were further used for immuno-fluorescence microscopy. For co-localization of the PvSufA protein, P. vivax parasite infected blood smears (from patients) were fixed with cold methanol, permeabilized with 0.05% Saponin (30 min) and 0.1% Triton X-100 (4 min) followed by overnight blocking in 3% Bovine Serum Albumin (BSA) at room temperature. Cells were further incubated with PvSufA antiserum (1:1000 dilution for 4 h) and goat anti-mouse IgG FITC conjugate (1:2000 dilution for 1 h and 30 min; MERCK, India) at 25 °C. Counterstaining of the parasite nucleus was done using DAPI (Life Technologies, USA) for 10°min and apicoplast membrane using Qdot® 585 Streptavidin conjugate (Life Technologies, USA) for 1 h at room temperature (Jelenska et al., 2001). Intermittent washing with PBS was performed in between each step. The cells were finally mounted with VECTASHIELD (Vector Laboratories, USA) and viewed in a confocal laser scanning microscope (Leica TCS SP5) under a 63X oil immersion lens. 2.5. Biochemical and EPR spectra analysis of PvSufA protein Purified PvSufA (4 μM) was incubated anaerobically at 25 °C with 5-fold molar excess of both Na2S and Fe(NH4)2(SO4)2 for 3 h in the presence of 5 mM dithiothreitol prepared in 0.1 M Tris–HCl (pH 8.0), to reconstitute the Fe–S clusters on the protein. The unbound iron and sulfur were removed using Amicon Ultra-4 filters (Merck, Germany). The amount of iron and sulfur bound was determined using Ferrozine (Fish, 1988) and methylene blue (Siegel, 1965) colorimetric assays respectively. Further the above reconstituted protein complexed with Fe–S clusters was analyzed by EPR spectroscopy to check for the oxidation state of bound Fe–S cluster (Zeng et al., 2007). Briefly, the samples were diluted to a concentration of 5 μM in 20 mM phosphate buffer containing 0.5 M NaCl (pH 7.4) followed by incubation with 5 mM ammonium persulfate for 30 min to oxidize PvSufA for spectra analysis. X-band EPR spectra were recorded at 100 K on a JES-FA200 spectrometer. Parameters for recording the EPR spectra were typically 15–30 mT/ min sweep rate, 0.63 mT modulation amplitude, 9.44 GHz frequency, and 4 mW incident microwave power with a sweep time of 2 min.

2.3. Cloning and purification of recombinant protein 2.6. Molecular modeling The full length coding PvSufA gene (PlasmoDB gene ID: PVX_080115) was amplified from total cDNA of P. vivax using forward 5′ GCGGGATCCATGGCAACGACAAAGGC3′ and reverse primer 5′ GCGCCATGGCTAAACATTGAATGACTTCCC 3′. The amplicons were cloned in pRSETA expression vector (Invitrogen, USA), and both the amplicons and the clone were confirmed using T7 and gene specific primers. The obtained sequences were analyzed for conserved residues and motifs. Targeting to the apicoplast and presence of signal or transit leader sequence for apicoplast was confirmed using PlasmoAP (Foth et al., 2003). The recombinant protein was induced with 0.5 mM IPTG (MERCK, India) for 6 h at 37 °C in Escherichia coli Rosetta BL21(DE3)

Crystal structure of E. coli SufA (PDB ID: 2D2A) with resolution of 2.7 Å was used as a template for PvSufA protein structure prediction based on the results obtained from HHpred online server (Söding et al., 2005). After removing the signal and transit peptide sequence from the PvSufA protein sequence, a three dimensional model was built using the program MODELLER 9v11 (Sali and Blundell, 1993; Eswar et al., 2006). The best model with minimum DOPE score was selected and further evaluated for quality and atomic content using different online servers like PROCHECK (Laskowski et al., 1993), VERIFY3D (Eisenberg et al., 1997), ERRAT (Colovos and Yeates, 1993), WHAT IF

Z.R. Pala et al. / Gene 585 (2016) 159–165

(Vriend, 1990) and RAMPAGE (Lovell et al., 2003). The obtained model was further refined by energy minimization using online server YASARA (Krieger et al., 2009). Similarly, models for P. vivax SufB and SufC were generated using crystal structure of E. coli stabilizer iron transporter (PDB ID: 1VH4) with resolution of 1.75 Å and crystal structure of E. coli SufC (PDB ID: 2D3W) with a resolution of 2.5 Å respectively. To gain an insight into the interaction of PvSufA with Fe–S cluster and PvSufBCD, docking of PvSufA with [4Fe–4S] cluster and individual components of the PvSufBCD complex was performed using Molegro Virtual Docker (Thomsen and Christensen, 2006) and GRAMM-X (Tovchigrechko and Vakser, 2006) respectively.

161

these, other residues including I55, L57, T58, A61, I65, L79, K80, L81, G87, G90, Y93, I98, K100, L119, I121, I129, L134, D135, Y136, I141, F145 and N149 were also found to be conserved in all the Plasmodium spp. (Fig. 1). The N-terminal sequence showed presence of basic amino acids specific for the signal peptide, with little probability of the protein to be targeted to the apicoplast (only 3/5 tests positive). Evolutionary analysis of PvSufA sequence with different orthologs resulted in a tree with PvSufA in close association with other primate parasites P. cynomolgi and P. knowlesi. All the sequences of Plasmodium species were placed in the same clade, while the apicomplexans and prokaryotes were found to form a separate clade showing evolutionary divergence (Fig. 2).

3. Results 3.2. Protein purification, biochemical and EPR spectra analysis 3.1. Sequence and conserved domain analysis The full length coding SufA gene (546 bp) amplified from Indian P. vivax field isolates showed a sequence identity of 99.39% with Salvador-I (PVX_080115), 90.24% with Plasmodium knowlesi (PKH_100950) and 88.82% with Plasmodium cynomolgi (PCYB_101900) at the amino acid level, suggesting a high level of conservation among the domain and signature residues in the primate parasites. The CDD analysis showed the presence of a Fe–S biosynthesis superfamily domain spanning the amino acid residues 53–165. In this domain, the cysteine residues at positions 88, 156 and 158 known as signature residues of the A-type scaffold protein were found to be conserved. Apart from

The full length PvSufA coding gene sequence (546 bp) containing the signal and transit peptide was cloned and expressed as a ~ 21 kDa His-tagged recombinant protein, which was confirmed by western blotting using anti-His antibodies (Fig. 3). Anaerobic incubation of purified PvSufA protein with 5-fold molar excess of both Na2S and Fe(NH4)2(SO4)2 in the presence of dithiothreitol, resulted in a brownish colored solution indicating the presence of iron–sulfur clusters. The UV– visible spectra of the purified SufA (apo-PvSufA) and iron–sulfur cluster loaded SufA (holo PvSufA) is shown in Fig. 4a. The apoPvSufA showed no significant absorption between 350–450 nm, while the holo PvSufA with the assembled iron–sulfur cluster showed significant absorption

Fig. 1. Multiple sequence alignment of P. vivax SufA sequence with other apicomplexans and bacterial homologues. The marked arrows depict the conserved cysteine residues of the signature motifs in SufA protein.

162

Z.R. Pala et al. / Gene 585 (2016) 159–165

Fig. 2. Phylogeny of SufA protein sequences. Phylogenetic tree for the SufA protein sequence of P. vivax Indian field isolate (P. vivax Indian) with the sequences of P. vivax Sal-I (PVX_080115), P. berghei (PBANKA_121600), P. cynomolgi (PCYB_101900), P. chabaudi (PCHAS_123790), P. knowlesi (PKH_100950), P. falciparum (PF3D7_0322500), P. yoelii (PY17X_1219200), P. inui (XP_008815198), P. vinckei (EUD72302.1), Toxoplasma gondii (EPR59570), E. coli (2D2A_A), Eimeria tenella (XP_01322874).

between 350 and 450 nm, with maximum visible absorption at 415 nm, which is typical for proteins containing iron–sulfur clusters. The total iron content of the purified reconstituted SufA was found to be 2.20384 μmol (μmol protein)−1, and the sulfide content was detected to be 2.464 μmol (μmol protein)−1. The reconstituted PvSufA protein was also analyzed for the oxidation state of the [Fe–S] clusters using EPR spectra. The purified PvSufA protein in the reduced state did not exhibit any EPR activity while the oxidized PvSufA protein showed a typical EPR signal indicating the presence of the [Fe4S4]3+ cluster, where the oxidized PvSufA gave an S = 5/2 signal and the g value was estimated to be 2.13 (Fig. 4b, c). 3.3. Antibody raising and immuno-localization The antibodies raised against the full length PvSufA protein were checked for their specificity using western blotting. Further, to investigate the functional site of SufA in the parasite, these antibodies were used for immuno-localization on thin smears made from P. vivax infected patient's blood. The PvSufA protein localized as a green fluorescent spot at the apical end of the parasite with an overlapping red spot indicating the apicoplast. The merged dot was adjacent to the DAPI stained nucleus confirming the localization of PvSufA to the apicoplast (Fig. 5).

Fig. 3. Expression of full length PvSufA protein in E. coli Rosetta BL21(DE3) pLysS confirmed by western blot using anti-His antibodies.

3.4. 3D structure analysis of PvSufA The obtained monomeric PvSufA structure consisted of two helices and seven beta-strands. The seven beta-strands were divided amongst the two helices in which A1, A2, A3 belong to Helix A and B1, B2, B3, B4 belong to Helix B. The generated PvSufA structure showed a high level of conservation amongst the important residues involved in the interaction of the scaffold protein with the iron sulfur clusters, including the three invariant cysteine residues at positions Cys88, Cys156, and Cys158. The residues involved in forming hydrophobic interactions or salt bridges to stabilize the structure were also found to be conserved. Two characteristic loop structures were found namely, A2–LA23–A3 and B1–LB12–B2, which were stabilized by hydrophobic interactions involving conserved residues Leu57, Val83, Tyr93, Leu95, Phe145 and Phe147 (Fig. 6a). A type IV turn structure, specific to A-type scaffold protein, from Asn107 to Ala110 linked to the B2 beta strand by a hydrogen bond between Tyr55 and Asn107 was also present. However, the B1 strand was linked to B3 strand by a salt bridge between residues Lys66 and Asp107 unlike the E. coli salt bridge which is between Arg42 and Asp107. The negatively charged residues contributing to the acidic nature of the protein were found to be conserved and distributed throughout the structure, typical of A-type scaffold proteins. As the monomeric SufA lacked the Fe–S cluster binding pocket, and SufA has been reported to exist as a dimer, the dimeric model of PvSufA was generated and the 4Fe–4S cluster was docked to gain an insight into the interaction of the cluster with the protein. The cysteine residues at positions 88, 156 and 158 were shown to be ligating with the 4Fe–4S cluster and the distances between the cysteine residues and the corresponding iron atoms of the 4Fe–4S cluster were all found to be within 3.2 Å (Fig. 6b). The molecular modeling results were in agreement with that of the experimental results in Acidithiobacillus ferrooxidans (Zeng et al., 2007), where the sulfhydryl groups of the conserved cysteine residues at the corresponding positions 35, 99 and 101 were essential for the 4Fe–4S cluster binding. Sequence alignment of PvSufA with E. coli SufA indicated a change in the conserved residue Glu103 which is proposed to be involved in the interaction with the Fe–S cluster. The corresponding residue in PvSufA was found to be Lys160 with a distance of 0.86 Å and this change was found not to pose any difficulty in ligating with the Fe–S cluster.

Z.R. Pala et al. / Gene 585 (2016) 159–165

163

Fig. 4. Spectra analysis of reduced and oxidized recombinant PvSufA protein. a) UV–Vis scanning of the purified PvSufA protein before (black) and after reconstitution (red) of Fe–S clusters. b) Electron paramagnetic resonance spectra of reduced recombinant PvSufA. c) Electron paramagnetic resonance spectra of oxidized recombinant PvSufA.

To investigate the interactions between PvSufA and PvSufBCD, individual components of the SufBCD complex were docked to the PvSufA structure (Fig. 6c). Since the template structure used for PvSufB and PvSufD was the same, similar residues were found interacting between PvSufA and PvSufBD. Twelve possible interactions involving both chain A and chain B of dimeric PvSufA were found to be involved in the hydrogen bonds present at the interface (Supplementary Table 1). The interaction studies between PvSufA and PvSufC did not result in any significant binding residues. This may suggest that PvSufC is not directly involved in the binding with PvSufA. 4. Discussion Iron–sulfur (Fe–S) proteins are ubiquitous and are known to participate in a wide range of physiological processes including respiration, photosynthesis, DNA repair, metabolism and regulation of gene expression (Kiley and Beinert, 2003; Fontecave and Ollagnier-de-Choudens, 2008). The ground-breaking work by Dean and colleagues revealed that at least two proteins, NifS (cysteine desulfurase) and NifU (scaffold protein), are important for Fe–S cluster assembly in Azotobacter vinelandii (Jacobson et al., 1989; Zheng et al., 1993; Yuvaniyama et al., 2000), suggesting the importance of cysteine desulfurase and the scaffold protein in the biogenesis of the Fe–S clusters. Given the fact, that

the cysteine desulfurases: SufS, IscS (Gisselberg et al., 2013; Charan et al., 2014) and the accessory molecules: SufBCD, SufE, Isd11 (Kumar et al., 2011; Gisselberg et al., 2013; Charan et al., 2014) present in Plasmodium have already been explored, the lacuna was felt in the knowledge of the scaffold protein. The present study aimed to characterize one such putative scaffold protein, PvSufA. The sequence similarity between different SufA orthologs varied from 22–90% with a high number of conserved residues in the Fe–S biosynthesis superfamily domain. The protein was found to be evolutionary conserved, showing high level of similarity among different apicomplexans and bacterial species. A close association was observed with the primate parasites as reported for other genes from nuclear as well as apicoplast genome of the parasite (Escalante et al., 2005; Saxena et al., 2007, 2012). The protein co-localized to the apical end of the parasite along with the apicoplast, suggesting it's targeting to the apicoplast, the suggested site of action for this pathway (Kumar et al., 2011; Gisselberg et al., 2013; Charan et al., 2014). The predicted PvSufA protein structure showed all the characteristic features of an A-type scaffold protein. In all A-type scaffold proteins, the position of three cysteine residues is conserved as X34CX63CGCX67, and these invariant cysteine residues are important for interaction with Fe–S clusters (Vinella et al., 2009). In Indian PvSufA protein, these

Fig. 5. Sub cellular localization of PvSufA protein in P. vivax Indian field isolates. The full-length PvSufA protein was tagged with FITC and visualized as a green fluorescence. The parasite's apicoplast was further stained with a Qdot® 585 Streptavidin conjugate (red) and with DAPI (blue) to identify the nucleus. Image z-stacks were deconvolved and then presented as a single combined image. The merged image shows the colocalization of PvSufA to the apicoplast (yellow) of the parasite.

164

Z.R. Pala et al. / Gene 585 (2016) 159–165

Fig. 6. Structure prediction and docking analysis of PvSufA protein. a) PvSufA protein monomer structure prediction by homology modeling [E. coli SufA (2D2A) crystal structure was used as a template for structure prediction]. The conserved cysteine residues are marked in yellow whereas other conserved residues are marked in green. b) Binding of [4Fe–4S] (blue/orange) cluster to the dimeric PvSufA protein. The interacting Cys residues 88, 156 and 158 and Lys160 are shown in blue. c) Interaction of PvSufA (green) and PvSufB (blue). The hydrogen bonds involved in the interaction are depicted by red lines.

three cysteine residues were conserved as X55CX185CGCX189, and showed interactions with the Fe–S clusters, suggesting the formation of Fe–S clusters on this protein. However, instead of Glu103 as reported in E. coli, Lys160 was found to interact with the Fe–S clusters in P. vivax (Wadaa et al., 2005). The results of colorimetric assays and EPR spectra further confirmed the successful incorporation of [Fe4S4] cluster in PvSufA, illustrating its role as a scaffold protein for the Fe–S cluster assembly in P. vivax. In E. coli, the sulfur mobilized by SufSE is received by SufB which acts as a scaffold in complex with SufD (to channel iron from unknown sources) and SufC (an ATPase), while SufA acts as a Fe–S cluster shuttle protein receiving clusters from the SufBCD complex prior to their insertion onto the target apo-enzymes (Chahal et al., 2009). In Plasmodium, the SufBCD interaction has been shown, but as the SufB lacks CXXCXXXC motif present in E. coli SufB, its role as a scaffold protein is unclear (Kumar et al., 2011; Saxena et al., 2012). Along with it, there are no reports detailing the transfer of these clusters to the apoproteins in Plasmodium. Our in silico docking studies between PvSufA and PvSufBCD complex, suggested a possible interaction between PvSufA and PvSufBD indicating that PvSufA is acting in combination with PvSufBD for the assembly and transfer of 4Fe–4S clusters to the apo-proteins. But no interaction was seen between PvSufA and PvSufC, thus SufC might be interacting with SufBD only to function as an ATPase in Plasmodium (Fig. 7). Recently in Plasmodium berghei the components of the Suf pathway; SufC, D, E, S were shown essential for the blood stage proliferation, but

SufA was shown to play a dispensable role during asexual blood stage growth in vivo (Haussig et al., 2014). However, in bacteria, this Suf pathway is said to be active under oxidative stress conditions, and in the above study all the analysis was performed under optimized in vivo and cell culture conditions, thus it becomes essential to study all the components of Suf pathway including SufA, under different stress

Fig. 7. Proposed mechanism of the Suf pathway involved in Fe–S Cluster biogenesis in Plasmodium.

Z.R. Pala et al. / Gene 585 (2016) 159–165

conditions like hypoxia. This may enhance our knowledge about the exact role of this pathway and its components in the parasite. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2016.03.041. Conflict of interest The authors declare no conflicts of interest. Acknowledgments We thank all the patients who have given their consent for participation in the project. We are especially thankful to Prof. Ashis K. Das for his valuable suggestions throughout the study. S.G. acknowledges the financial support given by DST in form of DST Young Scientist Start-Up Grant [SB/YS/LS-275-2013] and UGC in the form of UGC-BSR Start-Up Grant [F. No. 20-22/2013/(DSR)]. Z.R.P. acknowledges senior research fellowship from the Council of Scientific and Industrial Research (CSIR) (Grant no: 09/719(0058)/2013), New Delhi, India and UGC-BSR fellowship. G.S.S. acknowledges senior research fellowship from University Grants Commission India (Grant No: F.2-1/2012(SA-I)). The authors wish to thank Birla Institute of Technology and Science, Pilani, India, for providing the required infrastructural facilities during this study. We wish to acknowledge the Confocal Microscopy facility, IGIB, New Delhi. References Chahal, H.K., Dai, Y., Saini, A., Ayala-Castro, C., Outten, F.W., 2009. The SufBCD Fe −S scaffold complex interacts with SufA for Fe − S cluster transfer. Biochemistry 48 (44), 10644–10653. Charan, M., Singh, N., Kumar, B., Srivastava, K., Siddiqi, M.I., Habib, S., 2014. Sulfur mobilization for Fe–S cluster assembly by the essential SUF pathway in the Plasmodium falciparum apicoplast and its inhibition. Antimicrob. Agents Chemother. 58 (6), 3389–3398. Cicchillo, R.M., Lee, K.H., Baleanu-Gogonea, C., Nesbitt, N.M., Krebs, C., Booker, S.J., 2004. Escherichia coli lipoyl synthase binds two distinct [4Fe–4S] clusters per polypeptide. Biochemistry 43 (37), 11770–11781. Colovos, C., Yeates, T.O., 1993. Verification of protein structures: patterns of nonbonded atomic interactions. Protein Sci. 2, 1511–1519. Das, A.K., Holloway, B., Collins, W.E., Sharma, V.P., Ghosh, S.K., Sinha, S., et al., 1995. Species specific 18S rRNA gene amplification for the detection of P. falciparum and P. vivax malaria parasites. Mol. Cell. Probes 9 (30), 161–165. Edward, H., David, L., 1988. Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory. Eisenberg, D., Lüthy, R., Bowie, J.U., 1997. VERIFY3D: assessment of protein models with three-dimensional profiles. Methods Enzymol. 277, 396–404. Escalante, A.A., Cornejo, O.E., Freeland, D.E., Poe, A.C., Durrego, E., Collins, W.E., et al., 2005. A monkey's tale: the origin of Plasmodium vivax as a human malaria parasite. Proc. Natl. Acad. Sci. U. S. A. 102 (6), 1980–1985. Eswar, N., Webb, B., Marti‐Renom, M.A., Madhusudhan, M., Eramian, D., Shen, M.Y., et al., 2006. Comparative protein structure modeling using Modeller. Curr. Protoc. Bioinformatics 5 (6), 1–30. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Fish, W.W., 1988. Rapid colorimetric micromethod for the quantitation of complexed iron in biological samples. Methods Enzymol. 158, 357–364. Fontecave, M., Ollagnier-de-Choudens, S., 2008. Iron–sulfur cluster biosynthesis in bacteria: mechanisms of cluster assembly and transfer. Arch. Biochem. Biophys. 474 (2), 226–237. Foth, B.J., Ralph, S.A., Tonkin, C.J., Struck, N.S., Fraunholz, M., Roos, D.S., et al., 2003. Dissecting apicoplast targeting in the malaria parasite Plasmodium falciparum. Science 299, 705–708. Gisselberg, J.E., Dellibovi-Ragheb, T.A., Matthews, K.A., Bosch, G., Prigge, S.T., 2013. The Suf iron–sulfur cluster synthesis pathway is required for apicoplast maintenance in malaria parasites. PLoS Pathog. 9 (9), e1003655. Haussig, J.M., Matuschewski, K., Kooij, T.W.A., 2014. Identification of vital and dispensable sulfur utilization factors in the Plasmodium apicoplast. PLoS ONE 9 (2), e89718. Jacobson, M.R., Cash, V.L., Weiss, M.C., Laird, N.F., Newton, W.E., Dean, D.R., 1989. Biochemical and genetic analysis of the nifUSVWZM cluster from Azotobacter vinelandii. Mol. Gen. Genet. 219 (1–2), 49–57. Jelenska, J., Crawford, M.J., Harb, O.S., Zuther, E., Haselkorn, R., Roos, D.S., et al., 2001. Subcellular localization of acetyl-CoA carboxylase in the apicomplexan parasite Toxoplasma gondii. Proc. Natl. Acad. Sci. U. S. A. 98 (5), 2723–2728.

165

Jones, D.T., Taylor, W.R., Thornton, J.M., 1992. The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. 8, 275–282. Kiley, P.J., Beinert, H., 2003. The role of Fe–S proteins in sensing and regulation in bacteria. Curr. Opin. Microbiol. 6, 181–185. Kimata-Ariga, Y., Kurisu, G., Kusunoki, M., Aoki, S., Sato, D., Kobayashi, T., et al., 2007. Cloning and characterization of ferredoxin and ferredoxin-NADP+ reductase from human malaria parasite. J. Biochem. 141 (3), 421–428. Kochar, D.K., Saxena, V., Singh, N., Kochar, S.K., Kumar, V.S., Das, A.K., 2005. Plasmodium vivax malaria. Emerg. Infect. Dis. 11, 132–134. Krieger, E., Joo, K., Lee, J., Lee, J., Raman, S., Thompson, J., et al., 2009. Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: four approaches that performed well in CASP8. Proteins 77 (9), 114–122. Kumar, B., Chaubey, S., Shah, P., Tanveer, A., Charan, M., Siddiqi, M.I., et al., 2011. Interaction between sulphur mobilisation proteins SufB and SufC: evidence for an iron–sulphur cluster biogenesis pathway in the apicoplast of Plasmodium falciparum. Int. J. Parasitol. 41, 991–999. Laskowski, R.A., MacArthur, M.W., Thornton, J.M., 1993. PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Crystallogr. 26, 283–291. Lee, M., Grawert, T., Quitterer, F., Rohdich, F., Eppinger, J., Eisenreich, W., et al., 2010. Biosynthesis of isoprenoids: crystal structure of the [4Fe–4S] cluster protein IspG. J. Mol. Biol. 404, 600–610. Lovell, S.C., Davis, I.W., Arendall, W.B., de Bakker, P.I., Word, J.M., Prisant, M.G., et al., 2003. Structure validation by Cα geometry: ϕ, ψ and Cβ deviation. Proteins Struct. Funct. Genet. 50, 437–450. Pakalapati, D., Garg, S., Middha, S., Acharya, J., Subudhi, A.K., Boopathi, A.P., et al., 2013. Development and evaluation of a 28S rRNA gene-based nested PCR assay for P. falciparum and P. vivax. Pathog. Glob. Health 107 (4), 180–188. Pierrel, F., Bjork, G.R., Fontecave, M., Atta, M., 2002. Enzymatic modification of tRNAs: MiaB is an iron–sulfur protein. J. Biol. Chem. 277 (16), 13367–13370. Ralph, S.A., D’Ombrain, M.C., McFadden, G.I., 2001. The apicoplast as an antimalarial drug target. Drug Resist. Updat. 4, 145–151. Rekittke, I., Wiesner, J., Röhrich, R., Demmer, U., Warkentin, E., Xu, W., et al., 2008. Structure of (E)-4-hydroxy-3-methyl-but-2-enyl diphosphate reductase, the terminal enzyme of the non-mevalonate pathway. J. Am. Chem. Soc. 130 (51), 17206–17207. Rohrich, R.C., Englert, N., Troschke, K., Reichenberg, A., Hintz, M., Seeber, F., et al., 2005. Reconstitution of an apicoplast-localised electron transfer pathway involved in the isoprenoid biosynthesis of Plasmodium falciparum. FEBS Lett. 579 (28), 6433–6438. Sali, A., Blundell, T.L., 1993. Comparative protein modelling by satisfaction of spatial restraints. J. Mol. Biol. 234, 779–815. Saxena, V., Garg, S., Ranjan, S., Kochar, D.K., Ranjan, A., Das, A.K., 2007. Analysis of elongation factor Tu (tuf A) of apicoplast from Indian Plasmodium vivax isolates. Infect. Genet. Evol. 7, 618–626. Saxena, V., Garg, S., Tripathi, J., Sharma, S., Pakalapati, D., Subudhi, A.K., et al., 2012. Plasmodium vivax apicoplast genome: a comparative analysis of major genes from Indian field isolates. Acta Trop. 122, 138–149. Siegel, L.M., 1965. A direct microdetermination for sulfide. Anal. Biochem. 11, 126–132. Sievers, F., Wilm, A., Dineen, D., Gibson, T.J., Karplus, K., Li, W., et al., 2011. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 7 (539), 1–6. Söding, J., Biegert, A., Lupas, A.N., 2005. The HHpred interactive server for protein homology detection and structure prediction. Nucleic Acids Res. 33 (Web Server issue), W244–W248. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2006. MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Thomsen, R., Christensen, M.H., 2006. MolDock: a new technique for high-accuracy molecular docking. J. Med. Chem. 49, 3315–3321. Tovchigrechko, A., Vakser, I.A., 2006. GRAMM-X public web server for protein–protein docking. Nucleic Acids Res. 34 (Web Server issue), W310–W314. Vinella, D., Brochier-Armanet, C., Loiseau, L., Talla, E., Barras, F., 2009. Iron–sulfur (Fe/S) protein biogenesis: phylogenomic and genetic studies of A-type carriers. PLoS Genet. 5 (5), e1000497. Vriend, G., 1990. WHAT IF: a molecular modeling and drug design program. J. Mol. Graph. 8, 52–56. Wadaa, K., Hasegawaa, Y., Gonga, Z., Minamib, Y., Fukuyamaa, K., Takahashia, Y., 2005. Crystal structure of Escherichia coli SufA involved in biosynthesis of iron–sulfur clusters: implications for a functional dimer. FEBS Lett. 579, 6543–6548. Yuvaniyama, P., Agar, J.N., Cash, V.L., Johnson, M.K., Dean, D.R., 2000. NifS-directed assembly of a transient [2Fe–2S] cluster within the NifU protein. Proc. Natl. Acad. Sci. U. S. A. 97, 599–604. Zeng, J., Geng, M., Jiang, H., Liu, Y., Liu, J., Qiu, G., 2007. The IscA from Acidithiobacillus ferrooxidans is an iron–sulfur protein which assemble the [Fe4S4] cluster with intracellular iron and sulfur. Arch. Biochem. Biophys. 463, 237–244. Zepeck, F., Grawert, T., Kaiser, J., Schramek, N., Eisenreich, W., Bacher, A., et al., 2005. Biosynthesis of isoprenoids: purification and properties of IspG protein from Escherichia coli. J. Org. Chem. 70 (23), 9168–9174. Zheng, L., White, R.H., Cash, V.L., Jack, R.F., Dean, D.R., 1993. Cysteine desulfurase activity indicates a role for NIFS in metallocluster biosynthesis. Proc. Natl. Acad. Sci. U. S. A. 90, 2754–2758.