Structure determination and evolution of the chicken cDNA and gene encoding prepropancreatic polypeptide

Gene, 130 (1993) 183-189 0 1993 Elsevier Science Publishers B.V. All rights reserved. 0378-I 119/93/%06.00

183

GENE 07179

Structure determination and evolution of the chicken cDNA and gene encoding prepropancreatic polypeptide (Mosaic evolution; neuro~ptide-Y;

peptide-YY, nucleotide sequence; cloning; exon; intron; recombinant DNA)

Koji Nata, Takako Sugimoto, Kazuhiro Kohri, Hiroshi Hidaka, Eiji Hattori, Hiroshi Yamamoto*, Hideto Yonekura and Hiroshi Okamoto Department of Biochemistry,

Tohoku University School of Medicine, Sendai 980, Miyagi, Japan

Received by Y. Sakaki: I I December 1992; Accepted: 8 February 1993; Received at publishers: 25 March 1993

SUMMARY

We have previously demonstrated that the C-terminal regions of the rat and human pancreatic polypeptide (PPP) precursors exhibit a high degree of divergence, whereas the N-terminal regions are highly conserved. This blend of structural conservation and divergence in the precursors appears to be caused by splice junction sliding and translational frameshift in the 3’-region of the PPP gene [Yonekura et al., J. Biol. Chem. 263 (1988) 2990-29971. In the present study, we determined the nucleotide (nt) sequences of the chicken PPP (cPPP) cDNA and gene, and compared them with those of the mammals. In cPPP, the C-terminal region of the precursor is quite heterologous with respect to the rat (rPPP) and human (hPPP) precursors, and this heterogeneity is accentuated by the large deletion in exon 3 of cPPP. Furthermore, mutational accumulation during evolution caused the structural organization of the 3’-region of cPPP to change; cPPP is terminated in exon 3, whereas rPPP and hPPP are terminated in exon 4. Thus, our previous observation regarding the possibility of ‘mosaic evolution’ [Yamamoto et al., J. Biol. Chem. 261 (1986) 615661591 of PPP has been extended and confirmed by this study. Available evidence suggests that ‘mosaic evolution’ is a phenomenon unique to PPP, and not to the genes encoding the other members of the PPP family, neuropeptide-Y and peptide-YY.

INTRODUCTION

Pancreatic poiy~ptide, PPP, a 36-aa carboxyamidated hormone, is synthesized in the islets of Langerhans (Solcia et al., 1985). PPP has been reported to act as a Correspondence to: Dr. H. Okamoto, Department of Biochemistry, Tohoku University School of Medicine, 2-1 Seiryou-machi, Aoba-ku, Sendai 980, Miyagi, Japan. Tel. (81-22) 274-1111, ext. 2211; Fax (81-22) 272-1273. *Present address: Department of Biochemists, Kanazawa University School of Medicine, 13-l Takara-machi, Kanazawa 920, Ishikawa, Japan. Tel. (81-762) 62-8151.

Abbreviations: aa, amino acid(s); bp, base pair(s); cDNA, DNA complementary to RNA, cPPP, chicken PPP; hPPP, human PPP, kb, kilobase(s) or 1000 bp; nt, nucleotide(s); oligo, oligodeoxyribonucleotide; ORF, open reading frame; PPP, pancreatic polypeptide; PPP, gene (DNA) encoding PPP, rPPP, rat PPP; tsp, transcription start point(s).

regulator of pancreatic and gastrointestinal functions (Adrian et al., 1981; Hazelwood, 1981). In canine islets cells, the PPP precursor was demonstrated to be posttranslationally processed to produce PPP and an icosapeptide, a 20-aa peptide derived from the C-terminal region of the precursor (Schwartz and Tager, 1981). The icosapeptide has also been detected in human, ovine, and feline pancreases (Schwartz et al., 1984; Nielsen et al., 1986). However, our determination of the nt sequences of cDNAs encoding rat and mouse PPP precursors and rPPP demonstrated that the C-terminal regions of the rat and mouse precursors did not contain any sequence similar to the icosapeptide and were quite heterologous to the nt and aa sequences from the equivalent human domain (Yamamoto et al., 1986; 1990; Yonekura et al., 1988). Whereas the S-region of rPPP and hPPP, coding for the N-terminal regions of the precursors, are well con-

184 AGCTGCCIGCIGTGCTGCCGCTGTeCCCCCA~lCCGCGTCCC~AAGGAGCAGCC

Chicken

TCCAGC~GAAG~,A~GT

R.1

TCTG.GT::A.:A

CAC :G,TC::‘.CACAGG

TGC.TGAGGc3.G .:TCGCT:,GT:TAG.G ,CAT,TA TCT:CTCCGG

H”..”

-50

-40

-20

-30

-IO

-I

Signal PerAide

ATO 111

CCG It,

CCC CGC ,GG GCC TCG C,G CTG CTG CTG GCC TGC AGC CTG CTG CTG CTC

l-l*1

“’

GCC GTC GCA ,A:

,A

““ml”

::

GC,

:T,

G:C GCA .G:

C CT:

.C

,:

: C CT,

c

‘.

T.,

..C

: A T.

AC,

,:G

G..

GC,

..c.

T,

AC

T

G

GC,

:::

-G ,:A

50

I

ChiCk*”

GC,

GTG CCC CCC

Rat

C,A CA:

““man

CTA CA

.TG

A

TG

11,

GGC ICC

CAG

.-T

G.

CTG : T 0

.I‘

GCC GGC CCC TCG CAG CCC ICC TIC CCC GGG GAT GAT

TGG

.GA

CA0

GA

C'

“A

CT

G:

C: :A

CT

G

:.A

.TG

:

AGTG::

::G

“’

:CT:. cr.

,.A,,

,OO

Chid." GCT CCC GTG GAG GAC CTC AX : I.0

Fat Hum.”

-c

A,*

C&T CCA

CGC TTC TIC UC

A C:G AGG GCT .AA .A C 0 A.0

0 A

GAC UC

CT C.0

GCC :A0 :AT GCA GCT “T

” ‘,

CA0 CAG TAC CTC AAC GTG GTC

,GA AGA :”

T AGA

A:: A

:::

served, mutational accumulation in the 3’-region of the genes appears to have caused splice junction sliding and translational frameshift, which seems to have enhanced the structural divergence in the C-terminal regions. The results indicate that the blend of structural conservation and divergence in the PPP precursors may have been generated through ‘mosaic evolution’ of PPP; the exons coding for the C-terminal region and those for the N-terminal region have evolved at different rates because they were faced with different selective constraints (Yamamoto et al., 1986; 1990; Yonekura et al., 1988). The aim of the present study was to understand the evolutionary process of PPP better, to isolate and characterize structurally the cPPP cDNA and gene, to compare them with those of rat and human, and to examine the degree of interspecies conservation of the genes of neuropeptide-Y and peptide-YY, the other members of the PPP family.

ACA C 0 A::

C.G

150

Icosasestide

RESULTS

AND DISCUSSION

(a) Nucleotide sequence of chicken preproPPP cDNA and thededucedaasequence Chick.” AC0 CGG C&C COG TIC GGC CGG CGG TCC AGC AGC CGG GTG CTG TGC GAG GAG CCC ATG GGT As shown in Fig. 1, we have determined the nt sequence : C A.. .C, :T ::G AA *:A OAT GAG GA: ACA CT OZ. CTT CCT GGA AGO CI, CTC R.1 ,T 0 MA A:A CA :AA GAG GAC AC. GC: TTC TC, GAG TG: :,G ““man c * .CT t. of the cDNA encoding the cPPP precursor. The nt 200 sequence determined was identical in the cDNA inserts of the three independent clones (data not shown). The cDNA stretched 419 nt, not counting the poly(A) tract, and had one large ORF of 240 nt. The deduced aa C:k C:A T.C AC. &GC CTT :T :TG :G, T,. A.: C.C TGC :CT 0.T G.. C:G At. TGA A.. Ft.1 sequence was found to code for a 80-aa protein contain:AC T,A TAA T:C CA, ,T CT. ,:C C:G CAT GC, GCT .,C :CC Aui ,AC CTC AGC C.G C: Hun.” 300 250 ing a sequence at aa 30-65 that was quite similar to the chicken 36-aa PPP sequence determined with the purified GTGGCTGCIAC~CCCGC~GCCCCCACAGCCCCCC,CACAC~GCCCCCCACCCCAAC~A~CCC~~*T~~~~~~~~ QolYA .:AA,.GA,,,G,.. ., .:TC,G,CT.T:T:.T.’ TGOC:GT GGA GG,k,,G C,AG Rat peptide from chicken pancreas (Kimmel et al., 1975). The A CCTTGGCTCTGGCCAAAGC: X TGCT :A0 T.C:C,:TG TCTC.:A G:.T ATGCG AG:GC 30 36-aa sequence differed from a previously reported (Kimmel et al., 1975) sequence only at two residues (Asp”+Asn) and (Asns2 -Asp). Therefore, it is reasonFig. 1. The nt and deduced aa sequences of chicken preproPPP: comable to assume that this aa sequence (aa 30-65) can be parison with corresponding sequences of other species. The nt are numidentified as the cPPP, and it is necessary to correct the bered in the 5’ to 3’ direction, beginning with the first ATG triplets chicken

CA

.GAT.,CAG

“WI.”

encoding the initiator Met; the nt on the 5’ side of residues 1 are indicated by negative numbers. Last digits of numerals are aligned with given nt. The aa residues are numbered beginning with the initiator Met. Identity of the nt and aa sequences with the chicken sequences are indicated by colons. The sequences of the putative signal peptide and the polyadenylation signal are underlined. The PPP sequences are highlighted. The icosapeptide sequence is doubly underlined. Asterisks represent aa or nt deletions. The GenBank accession No. for this sequence is D13760. Methods: Pancreas were removed from 6-weekold male chickens (Gallus gallus domesticus). Total RNA was extracted from the pancreas as described (Chirgwin et al., 1979) using cesium trifluoroacetate. Poly(A)+RNA was isolated by oligo(dT)-cellulose column chromatography (Aviv and Leder, 1972). A cDNA library was constructed as previously described (Terazono et al., 1988) using hZAPI1 and Escherichia coli XL-I Blue (Stratagene, La Jolla, CA, USA). A 60-nt oligo was synthesized using an Applied Biosystems Model 380B DNA synthesizer. The sequence of the oligo, S-ATTATCGTAGAA-

TCGGATCAGGTCCTCCACTGGGGCATCGTCCCCTGGGTACGTTGGCTG, was designed on the basis of the aa sequence of cPPP (Kimmel et al., 1975). After S-labeling using [Y-~‘P]ATP (Amersham, UK) and T4 polynucleotide kinase (Takara Shuzo, Kyoto, Japan), the oligo was purified by a push column (Stratagene) and used to screen lo6 plaques lifted onto nitrocellulose filters. Recombinant phage DNAs in the hybridization-positive clones were excised and recircularized in vivo (Webb et al., 1989), and the resulting pBluescript plasmids were isolated. Cloned DNA was cleaved with various restriction endonucleases and subcloned into PBS vector (Stratagene). Unidirectional exonuclease III digestion was used for constructing deletions of some inserts. The nt sequence of each restriction fragment was determined by the dideoxy chain-termination method using deoxy-7-deazaguanosine triphosphate as a substrate to prevent compression (Hattori and Sakaki, 1986: Mizusawa et al., 1986).

185 previously reported aa sequence of the cPPP. As shown in Fig. 1, significant nt and aa sequence identity is found in the chicken, rat (Yamamoto et al., 1986), and human (Boel et al., 1984; Leiter et al., 1984; Takeuchi and Yamada, 1985) PPP. There is also considerable identity between chicken, rat, and human putative signal peptides in the nt and aa sequences. On the other hand, the C-terminal region (aa 69-84, Fig. 1) of the cPPP precursor differs in length and is quite heterologous in nt and aa sequences from the corresponding rat and human regions. Thus, the chicken C-terminal region is found not to contain any sequence similar to the icosapeptide, which has been derived from human, ovine, canine, and feline precursors (Boel et al., 1984; Leiter et al., 1984; Schwartz et al., 1984; Takeuchi and Yamada, 1985; Nielsen et al., 1986). (b) Southern blot hybridi~tion analysis of cPPP We analyzed genomic DNA from chicken liver by Southern blot hybridization using cPPP cDNA as probe. The Southern blot analysis revealed only one band for most of the digests (Fig. 2), suggesting that there is a single copy of PPP in a haploid set of chicken gene. Furthermore, as StuI +ScaI digestion of DNA yielded single 6.5-kb fragments which hybridized to the probe (Fig. 2), we constructed a genomic DNA library with StuI + SC&digested liver DNA and hZAPI1. (c) Isolation and nt sequence analysis of cPPP To isolate a genomic DNA fragment containing cPPP, the genomic DNA library was screened with a synthetic

(d) T~n~riptionaI start point (tsp) of cPPP The tsp was determined by SI n&ease mapping and primer extension analysis of mRNA from chicken pancreas (data not shown). Several DNA fragments differing in length were resistant to Sl nuclease, and the major band was detected at the position corresponding to the T residue labeled 1 in Fig. 3. In primer extension analysis, the largest product was detected at the position corresponding to the G residue labeled 2 in Fig. 3. These resuits indicated that exon 1 of cPPP was 69-70 bp long. The TATA box sequence was found 27-28 bp upstream from the tsp.

WI

W 23.1 >

60-nt oligo as probe. A plaque-pure positive clone for PPP in hZAPI1 was excised and recircularized into pBluescript. The plasmid DNA was digested with EcoRI. Southern blot hybridization revealed a single 6.5-kb fragment that hybridized to the synthetic 60-nt oligo probe. As shown in Fig. 3, approximately 2.0 kb of the 6.5-kb subcloned fragment were sequenced. Comparison of the genomic sequence with the chicken preproPPP cDNA sequence revealed that the coding region is divided into three exons separated by two introns; the nt sequence of the coding region of the gene is identical to that of the cDNA. The gene spans approx. 1.6 kb, and all exonintron junctions conform to the ‘GT-AG’ rule (Padgett et al., 1986). Exon 1 encodes the S-untranslated region of chicken preproPPP mRNA. Exon 2 encodes the signal peptide and most of PPP. Exon 3 encodes the small remainder of PPP, the Gly-Lys-Arg processing site, C-terminal region, and 3’untranslated region.

,.

23.1 > 6.4

>

6.6

>

4.4

>

. 4m-mD-b

I, l

.

m

Fig. 2. Southern blot hybridization analysis of DNA isolated from chicken liver. Cienomic DNA was extracted from the liver of a male chicken (G&s g&us domesticus) as described (Davis et al., 1986; Strauss, 1987). Genomic DNA (IO pg) was digested with restriction enzymes shown at the top, electrophoresed on 0.8% agarose gel, and transferred to nitr~llulose filters (Wahl et al., 1979). Filters were hybridized (Yonekura et al., 1988) to a cDNA probe that had been labeIed in the presence of [a-32P]dCTP by the random priming method (Feinberg and Vogelstein, 1983). The cDNA probe was the 370-bp EcoRI fragment of cPPP cDNA: the EcoRI fragment contains the entire coding region of the cDNA. Positions of size markers are given on the left margins.

Signal Pentide

444 60 564 684 804 924 1024 1184

t 284 ccttgttgcascsccttcccccttgcaatgctccc

GCCGGCGGTCCAGCAGCCGGGTGCTGTGCGAGGAGCCCATGGGTGCTGCTGG lyArgAtgSarSarSerAr@VaiLauCysGluGluProlff~tGl~AiaAlsGl

1404 79

Exon 3 GTGCTGAGCACGGGATGCAGCGCTGACTGTGGGGCCCAGCAGTTCCCCGGG~TGGCTGCAACACCCGCAGCCCCCACAGCCCCCCTCACACTGCCCCCCACCCCAACAAiAAACCCCAT

1524 80

yCyr*** TGCAGCCACctcctgcctctgcctg@t@ctgapegcactgc@a@tgctgggaatgggcac~Qct@QQtgot@cattQQtgCgt@t@cao@tstststQtCaOC~ca@oaG

1634

Fig. 3. The nt sequence of cPPP. Capital letters indicate exons, and lower-case letters are used for introns and S- and 3’-flanking sequences. Numbering (tsp= + 1, the T residue detected by Sl nuclease mapping) begins at the cap site. Negative numbers indicate 5’-flanking sequence. Peptides within the precursor are indicated above their respective aa sequences. Asterisks denote the stop codon. The Goldberg-Hogness promoter (tataa) at -27 is doubly underlined, as is the polyadenylation recognition signal (AATAAA). The sequence of cPPP is highlighted. The GenBank accession No. is DI3761. Methods: Liver genomic DNA was digested with StuI+ScaI, ligated with EcoRI linker (S-dGGAATTCC), and then digested with EcoRI. The linker-ligated sample was size-fractionated by 0.8% agarose gel electrophoresis. Size-fractionated DNA (6-7 kb) was ligated with ZAP11 arms. Ligated DNA was packaged in vitro and plated on a lawn of XLI-Blue. The library was screened with the S-end-labeled synthetic oligo corresponding to nt 94-153 of the cPPP cDNA (see Fig. I). Recombinant phage DNAs in the hyb~di~tion-positive clones were excised and recircularized in vivo (Webb et al., 1989), and the resulting pBluescript plasmids were isoiated.

(e) Comparison of cPPP with rPPP and hPPP As shown in Fig. 4, cPPP consists of three exons and two introns, whereas rPPP and hPPP consist of four exons and three introns (Leiter et al., 1985; Yonekura et al., 1988; Yamamoto et al., 1990). In the 5’-region of the genes, chicken exons I and 2, which are 70 and 18 1 bp long, respectively, are almost the same in length as rat and human exons 1 and 2 (rat and human exons 1 and 2 are 56 and 191 bp long, respectively). Exon 2 encoding the signal peptide and PPP displays 49% identity to the rat sequence and 54% identity to the human sequence. On the other hand, the 3’-region of the genes are quite heterologous in nt sequence among chicken, rat and human. Chicken exon 3 encoding the C-terminal region is 186 bp long, whereas rat exon 3 encoding the C-terminal region is 112 bp long, and human exon 3 encoding the icosapeptide is 72 bp long. Chicken exon 3

displays only 22% and 19% identity with rat and human exon 3, respectively. The translational termination signal is locahzed in exon 3 of cPPP and rPPP, but in exon 4 of hPPP. The most striking mark of divergence in this region is the presence or absence of exon 4. The cPPP is te~inated in exon 3, whereas rPPP and hPPP are terminated in exon 4. (f) Conclusions (1) As summarized in Fig. 1, it is now clear that the N-terminal regions of chicken, rat, and human preproPPP are conserved, whereas the C-terminal regions exhibit a high degree of divergence. This seems to confirm further the possibility of ‘mosaic evolution’ of PPP. In the chicken exon 3 coding for the C-terminal region of the precursor, 42 nt are deleted without a translational frameshift in compa~son with the nt sequence of

187

C-tern&al

region

Pancreatic polypeptide (human) TATA’ box

ATI3

m

TM

icosapeptide

Neumpeptide Y (chicken, rat and human) ‘TATA’ box

AK3

Ars

734

C-terminal region

Peptide YY (rat and human)

I C-terminal region

exon 1

exon 2

exon 3

exon 4

Fig. 4. Structural organization of the genes in the PPP family. Exons are indicated as boxes. Protein-coding regions are variously shaded. Flanking and intron sequences are shown as solid lines. SUT and 3’UT, 5’ and 3’ untranslated regions of the mRNA, signal, signal peptide; PPP, pancreatic polypeptide; NPY, neuropeptide-Y, PYY, peptide-YY. The nt and aa sequences of chicken, rat and human preproPPP are shown in Fig. 1. The nt sequence of cPPP is shown in Fig. 3.

rPPP, and 44 nt are deleted with a translational frameshift in comparison with that of hPPP (Fig. 5). This large deletion seems to have enhanced the heterogeneity of the C-terminal region of the chicken precursor. Since no functions have yet been found for peptides derived from the C-terminal region, this region might not have been vital, and more base substitutions could have been tolerated by the corresponding genomic region than by the region that codes for the PPP segment. (2) In the 3’-region of cPPP, the structural organization is divergent from mammalian genes. Whereas mammalian PPP consist of four exons, cPPP consists of three exons and lacks exon 4. As shown in Fig. 5, in the alignment of the 3’-region of cPPP, rPPP and hPPP, according to maximum homology of their nt sequences, there are some homologies between the 3’-extension of chicken exon 3 and some parts of rat and human intron 3 and between the 3’-flanking region of cPPP and the S-region of rat and human exon 4. This indicates that mutations accumulated during evolution in the 3’-region of cPPP have caused the conversion of intron 3 into exon 3, and exon 4 into the 3’-flanking region. Since it is known that the most striking aspect of intron distribution within a particular gene or gene family is stability over time (Darnell et al., 1990), PPP seems to be unique in that the intron-exon structure is divergent among species. (3) Peptide-YY and neuropeptide-Y, 36-aa peptides with an N-terminal Tyr and a C-terminal Tyr amide, exhibit similarities in aa sequence to PPP (Tatemoto and Mutt, 1980; Tatemoto et al., 1982). PPP, peptide-YY and neuropeptide-Y have therefore been regarded as constituting a family of structurally related peptides. The structural organization of chicken (Blomqvist et al., 1992), rat

TABLE I Sequence identities in fuctionally divided domains of human, rat and chicken pancreatic polypeptide family precursors and corresponding mRNAs Domain”

Homology (%)b Human vs. rat aa

Prepropancreatic polypeptide Signal peptide Pancreatic polypeptide C-terminal region Preproneuropeptide-Y Signal peptide Neuropeptide-Y C-terminal region Prepropeptide-YY Signal peptide Peptide-YY C-terminal region

Human vs. chicken

Rat vs. chicken

nt

aa

nt

aa

nt

76 78 19

80 82 25

34 44 15

51 54 23

31 42 13

44 53 32

79 100 93

83 94 90

68 97 83

73 92 87

55 97 87

62 90 80

71 94 48

77 91 66

“The identities in the signal peptide and C-terminal domains were estimated by adding appropriate gaps in the sequences. bSee Figs. 1, 3 and 5.

Chicken

Exon 3 79 1405

1069 97

Rat

Exon 3 Chicken f..‘. I** *** **

. ..*.

tctggaaaggggrtcca-sag...,.

Rat

Exon 3

t* * ** ****** * *

. . . ..actgtccttcctcacgagt

Intron 3

Rat Chicken

80 ZP97 1155 98

Intron 3

3’=Flanking Region 1588 1250

ttcttctttcattacag

Rat

Exon 4

B .,~,” ,”,“,,“,,_,,“,_ ,,,,,,., _ ._. ,,.,,, ,,x .,__,^, ,,,,_,,_ ,, -, ** *

* * ** * *

* ** *

*

***

*

1348 88

tgagtttgactocctgccct

Human

Human

Exon 3

Intron 3 Chicken

..,.*

Exon 3 80 1505

. ...* **

* * ** gtotgtccaggctcc.....

76 1396

*

***

. . . * . catgttctgccctg

1509

Human Intron 3 ‘-Flanking

Region

otgcctggtgctgagggcactgcgagtgctgggaatgggcacagC *** ** ** * ** *** ** * * **

1587 * 1594 95

Human Exon 4 Fig. 5. Alignment of the 3’-regions of cPPP, rPPP and hPPP according to maximum homology of their nt sequences: (A) between chicken and rat, (B) between chicken and human. Capital letters indicate exons, and lower-case letters are used for introns and 3’4anking sequences. The nt and deduced aa sequences of exons are highlighted. Stars indicate identical nt between sequences. Dots indicate gaps in nt sequences in the maximally matched alignments.

(Larhammar et al., 1987)and human (Minth et al., 1986) neuropeptide-Y genes and rat (Krasinski et al., 1991) and human (Kohri et al., 1993) peptide-YY genes are conserved and are very similar to that of hPPP (Fig. 4). This suggests that each member of this family arose from the duplication of a common ancestral gene and that the structural organization of this gene was similar to that of hPPP. We then compared the aa and nt sequences of

human, rat and chicken PPP family precursors. As shown in Table I, there is considerable identity in all the functionally divided domains of preproneuropeptide-Y and prepropeptide-YY. On the other hand, the C-terminal regions of human, rat and chicken preproPPP differ in length, and the sequence identities in those regions of preproPPP are much lower than in any domains of neuropeptide-Y and peptide-YY precursors. Therefore, the

189 ‘mosaic evolution’ is a phenomenon unique to PPP and presumably occurred after PPP was segregated from the peptide-YY and neuropeptide-Y genes.

ACKNOWLEDGEMENT

This work was has been supported in part by Crantsin-Aid for Scientific Research from the Ministry of Education, Science and Culture, Japan.

REFERENCES Adrian, T.E., Greenberg, G.R. and Bloom, S.R.: Actions of pancreatic polypeptide in man. In: Bloom, S.R. and Polak, J.M. (Eds.), Gut Hormones, 2nd ed. Churchill Livingstone, Edinburgh, 1981, pp. 206-212. Aviv, I-I. and Leder, P.: purification of biologically active globin messenger RNA by chromatography on oligotbymidyli~ acid-cellulose. Proc. Natl. Acad. Sci. USA 69 (1972) 1~8-1412. Elomqvist, A.G., Saderberg, C., Lundeil, I., Mimer, R.J. and Larhammar, D.: Strong evolutionary conservation of neuropeptide Y: sequences of chicken, goldfish, and Torpedo marmoruta DNA clones. Proc. Natl. Acad. Sci. USA 89 (1992) 2350-2354. Boel, E., Schwartz, T.W., Norris, K.E. and Fiil, N.P.: A cDNA encoding a small common precursor for human pancreatic ~ly~ptide and pancreatic icosapeptide. EMBO J. 3 (1984) 909-912. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J. and Rutter, W.J.: Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18 (1979) 5294-5299. Darnell, J., Lodish, A. and Baltimore, D.: Molecular Cell Biology, 2nd ed. Scientific American Books, New York, 1990. Davis, L.G., Dibner, M.D. and Battey, J.F.: Basic Methods in Mol~ular Biology. Elsevier Science Publishing, New York, 1986. Feinberg, A.P. and Vogelstein, B.: A technique for radioIa~l~~g DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132 (1983) 6-13. Hattori, M. and Sakaki, Y.: Dideoxy sequencing method using denatured plasmid template. Anal. Biochem. 1.52(1986) 232-238. Hazelwood, R.L.: Synthesis, starage, secretion, and significance of pancreatic polypeptide in vertebrates. In: Coorperstein, S.J. and Watkins, D. (Eds.) The Islets of Langerhans. Academic Press, Orlando, 1981, pp. 275-3 18. Kimmel, J.R,, Hayden, 5. and Pollock, H.G.: Isolation and characterization of a new pancreatic polypeptide hormone. J. Biol. Chem. 250 (1975)9369-9376. Kohri, K., Nata, K., Yonekura, H., Nagai, A., Ronno, K. and Okamoto, H.: CIuning and structural dete~~nat~on of human peptide YY cDNA and gene. Biochim. Biophys. Acta 1172 (1993) 181-183. Krasinski, S.D., Wheeler, M.B. and Leiter, A.B.: Isolation, characterization, and developmental expression of the rat peptide-YY gene. Mol. Endocrinol. 5 (199 1) 433-440. Larhammar, D., Ericsson, A. and Persson, H.: Structure and expression of the rat neuropeptide Y gene. Proc. Natl. Acad. Sci. USA 84 (1987) 2068-2072. Leiter, A.B., Keutmann, HT. and Goodman, R.H.: Structure of a pre-

cursor to human pancreatic ~Iy~ptj~= J. Bioi. Chem. 259 (1984) 14702- 14705. Leiter, A.B., Montminy, M.R., Jamieson, E. and Goodman, RH.: Exons of the human pancreatic polypeptide gene define functional domains of the precursor. J. Biol. Chem. 260 (1985) 13013-13017. Minth, CD., Andrews, PC. and Dixon, J.E.: Characteri~atjon, sequence, and expression of the cloned human neuropeptide Y gene. J. Biol. Chem. 261 (1986) 11974-l 1979. Mizusawa, S., Nishimura, S. and Seela, F.: Improvement of the dideoxy chain termination method of DNA sequencing by use of deoxy-7deazaguanosine triphosphate in place of dGTP. Nucleic Acids Res. I4 (1986) 1319-1324. Nielsen, H.V., Gether, U. and Schwartz, T.W.: Cat pancreatic eicosapeptide and its biosynthetic intermediate: ~nservatjon of a monobasic processing site. Biochem. J. 240 (1986) 69-14. Padgett, R.A., Grabowski, P.J., Konarska, M.M., Seiler, S. and Sharp, P.A.: Splicing of messenger RNA precursors. Annu. Rev. Biochem. 55 (1986) 1119-1150. Schwartz, T.W. and Tager, H.S.: Isolation and biogenesis of a new peptide from pancreatic islets. Nature 294 (1981) 589-591. Schwartz, T.W., Hansen, H.F., Hgkanson, R., Sundler, F. and Tager, H.S.: Human pancreatic icosapeptide: isolation, sequence, and immunocyt~hemic~ localization of the CGGH-terminal fragment of the pancreatic polypeptide precursor. Proc. Nat]. Acad. Sci. USA 81 (1984) 708-712. So&a, E., Capella, C., Usellini, L., Fiocca, R. and Sessa, F.: The PP cell, In: Volk, B.W. and Arquilia, E.R. (Eds.), The Diabetic Pancreas. Plenum Medical, New York, 1985, pp. 197-l 15. Strauss, W.M.: Preparation of genomic DNA from mammalian tissue. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A. and Struhl, K. (Eds.), Current Protocols in Molecular Biology. W~iey-lnters~en~e, New York, 1987, pp. 2.2.1-2.2.3. Takeuchi, T. and Yamada, T.: Isolation of a cDNA clone encoding pancreatic polypeptide. Proc. Natl. Acad. Sci. USA 82 (1985) 1536 I 539. Tatemoto, K. and Mutt, V.: Isolation of two novel candidate hormones using a chemical method for finding naturally occurring polypeptides. Nature 285 (1980) 417-418. Tatemoto, K., Carlquist, M. and Mutt, V.: Neuropeptide Y - a novel brain peptide with structural simifarities to peptide YY and pancreatic polypeptide. Nature 296 (1982) 659-660. Terazono, K., Yamamoto, H., Takasawa, S., Shiga, K., Yonemura, Y., Tochino, Y. and Okamoto, H.: A novel gene activated in regenerating islets. J. Biol. Chem. 263 (1988) 2111-2114. Wahl, G.M., Stern, M. and Stark, G.R.: Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethyl-paper and rapid hybridization by using dextran sulfate. Proc. Natl. Acad. Sci. USA 76 (1979) 3683-3687. Webb, R., Reddy, KJ. and Sherman, L.A.: Lambda ZAP: improved strategies for expression library construction and use. DNA 8 (1983) 69-73. Yamamoto~ H., Nata, K. and Okamoto, H.: Mosaic evolution of prepropancreatic polypeptide. J. Biol. Chem. 261 (1986) 6156-6159. Yamamoto, H., Yonekura, H., and Nata, K.: The mosaic evolution of the pancreatic polypeptide gene. In: Okamoto, H. (Ed.), Molecular Biology of the Islets of Langerhans. Cambridge University press, Cambridge, 1990, pp.107-124. Yonekura, H., Nata, K., Watanabe, T., Kurashina, Y., Yamamoto, H. and Okamoto, H.: Mosaic evolution of prepropancreatic polypeptide, II. Structural conservation and divergence in pancreatic polypeptide gene. J. Biol. Chem. 263 (1988) 2990-2997.