- Email: [email protected]
Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran
Journal Pre-proof Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran Hossein Ahangari Cohan, Mahmoud Jamshidian, Mahdi Rohani, Meysam Moravedji, Ehsan Mostafavi
PII:
S0147-9571(20)30007-2
DOI:
https://doi.org/10.1016/j.cimid.2020.101419
Reference:
CIMID 101419
To appear in:
Comparative Immunology, Microbiology and Infectious Diseases
Received Date:
20 November 2019
Revised Date:
1 January 2020
Accepted Date:
6 January 2020
Please cite this article as: Ahangari Cohan H, Jamshidian M, Rohani M, Moravedji M, Mostafavi E, Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran, Comparative Immunology, Microbiology and Infectious Diseases (2020), doi: https://doi.org/10.1016/j.cimid.2020.101419
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran Hossein Ahangari Cohan1, Mahmoud Jamshidian1, Mahdi Rohani2,3, Meysam Moravedji4, Ehsan Mostafavi3,5* 1
Department of Pathobiology, Science and Research Branch, Islamic Azad University, Tehran,
Iran 3
Department of Microbiology, Pasteur Institute of Iran, Tehran, Iran
of
2
National Reference Laboratory for Plague, Tularemia and Q fever, Research Centre for
Emerging and Reemerging infectious diseases, Pasteur Institute of Iran, Akanlu, Kabudar4
ro
Ahang, Hamadan, Iran
Department of clinical sciences, Faculty of veterinary medicine, Islamic Azad University,
5
-p
Sanandaj Branch, Iran
Department of Epidemiology and Biostatics, Research Centre for Emerging and Reemerging
re
infectious diseases, Pasteur Institute of Iran, Tehran, Iran
lP
*Corresponding author:
National Reference Laboratory for Plague, Tularemia and Q Fever, Research Centre for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Akanlu, Kabudar-
ur na
Ahang, Hamadan, Iran, Email: [email protected]
Highlights
Isolation of F. tularensis from surface water using in vitro and in vivo culturing methods is associated with a very low success rate and depends on various environmental
Jo
parameters.
Considerations about rodents’ activities and carcasses near the sampling sites, optimization of culture media with supplements and antibiotics according to microorganism population in the water, sampling from cold waters specially in lowtemperature seasons, large volume re-sampling of molecular positive samples, acid treatment for high-load bacterial specimens, and on-site sample processing and on-site
cultivation can improve the chance of isolation of F. tularensis from environmental samples.
The isolation and identification of F. tularensis from natural or animal sources specify the disease cycle in the environment and help us to control the disease in the endemic areas.
Abstract
of
Background: The etiologic agent of tularemia, Francisella tularensis, is transmitted to humans via ingestion of contaminated water or food, arthropods bite, respiratory aerosols, or direct
ro
contact with infected animals body fluids or tissues. In the current study, due to the importance of water in transmitting the disease and the report of the disease in different regions of Iran,
-p
surface water of Kurdistan province were evaluated for the presence of F.tularensis. Materials and Methods: Sampling was carried out in five-counties of Kurdistan province. Sixty-six specimens of surface water were collected. The detection was carried out by targeting
re
ISFtu2 and fopA genes using TaqMan real-time PCR. Moreover, the samples were both cultured and inoculated into NMRI inbreed mice. Spleens of inoculated mice and bacterial isolates were
lP
tested by TaqMan real-time PCR.
Results: Despite the lack of isolation of F. tularensis, the results of the molecular testing indicate the presence of bacteria in surface water. Molecular positivity of one sample (1.51%)
ur na
was confirmed using a real-time PCR for both ISFtu2 and fopA genes. Moreover, 4.54% of the samples were positive for ISFtu2.
Conclusion: Since the in vitro isolation of bacteria from environmental samples is associated with a very low success rate and depends on various environmental parameters, the use of molecular techniques for monitoring of the bacteria in the contaminated areas is fully
Jo
recommended.
Keywords: Tularemia, Real-Time Polymerase Chain Reaction, Surface water, Kurdistan
Introduction Francisella tularensis is a fastidious facultative intracellular gram-negative coccobacilli bacterium. Various subspecies of this bacterium including tularensis (type A), holarctica (type
B), and mediasiatica, cause disease in humans and animals, especially in rodents and lagomorphs. F. novicida is also reported as a human pathogen. Low infectious dose, a high mortality rate in some forms of the diseases, and various transmission routes led to tularemia as one of the most dangerous diseases which placed it in category A of bioterrorism agents [1]. Clinical symptoms in humans are highly dependent on modes of transmission, site of the entrance, and subspecies of this bacterium which includes ulceroglandular, glandular, oculoglandular, pharyngeal, typhoidal, and pneumonic forms. The pharyngeal form of tularemia
of
is often caused by the consumption of contaminated water or food and is associated with cervical and pharyngeal lymphadenopathy. Serologic methods are widely used for tularemia diagnosis. Because of the high risk of laboratory transmission and limitation of cultivation, the culture-
ro
based diagnosis and bacterial isolation are not recommended in low safety level laboratories. F. tularensis circulates in aquatic and terrestrial environments and different animals and vectors
-p
are involved in its life cycle [2]. F.tularensis tularensis type A is the most pathogenic subspecies, while F. tularensis holarctica (type B) is less pathogenic and often spreads through the water.
re
Type A commonly occurs in North America, while type B is more geographically widespread and is seen in North America, Europe, and Asia. Type B hosts are often rodents, especially semi-
lP
aquatic rodents, which live near rivers, lakes, or ponds. F.tularensis is able to survive in aquatic environments for a relatively long time [3, 4]. Recent in vitro studies showed the survival and growth of this bacterium in Acanthamoeba castellanii and Tetrahymena pyriformis. Hence,
ur na
protozoa may have a significant role in the preservation of this bacterium in natural waters [5, 6]. Surface waters are not only important in the survival of F.tularensis in the environment, but it is also considered as one of the most important transmission routes. There are various reports of water-borne tularemia outbreaks in the world [7, 8]. In addition, F.tularensis subsp. holarctica and F. novicida are frequently isolated from contaminated waters along with F. philomiragia [9-
Jo
11]. Contaminated water seems to be a major transmission route in Iran’s neighbors. For example, an epidemiologic study in the Anatolia region of Turkey, from December 2009 to August 2011, was specified that drinking water from natural springs is the most important transmission route of the disease. Also, some water-borne epidemics have been confirmed by real-time PCR in this region [12]. In 2006, following the diagnosis of 26 cases in eastern Georgia, water was reported as the source of contamination, and the agent was isolated from surface waters [7].
Tularemia has been reported in countries neighboring Iran (Turkmenistan, Kazakhstan, Afghanistan, Pakistan, Azerbaijan, and turkey) [13]. Although tularemia was first reported in wild mammals and domestic livestock of Iran in the 1970s, no more study was conducted to understand the epidemiology of the disease until 2011 [14]. Between 1970 and 2011, only one human case was reported in Marivan, a city in Kurdistan province in western Iran [15]. The limited reported cases would be attributed to the weakness of the health system in the diagnosis of disease and the circulation of low virulent strains in Iran [13]. After several decades of
of
inattention to tularemia, seroprevalence studies in southwestern and southeastern regions of Iran showed the infection of different human populations to F.tularensis. For example, tularemia seroprevalence among high-risk groups in Kurdistan province was 14.4 % [16], while, it ranged
ro
from 2.77 to 6.5% in different studies in eastern and western Iran [17-19]. Furthermore, antibodies against F.tularensis have been detected in rodent populations in some regions of Iran
-p
[20]. Also, the bacterial infection to F. tularensis has been identified in rodents and hares of different regions of Iran [21, 22]. The second human case of the disease was reported in Marivan
re
in 2017 [23].
Among the studied provinces in Iran, Kurdistan province is one of the high-risk regions for
lP
tularemia as seropositive human cases (2011 and 2012) and rodent (2017) samples, as well as two clinical cases of tularemia (1980 and 2017), have been reported in this province [15, 23]. Considering the importance of water resources in the survival and transmission of F.tularensis,
ur na
in the current study, the presence of bacteria was studied in surface waters of Kurdistan province.
Materials and methods Sampling
Kurdistan Province located in western Iran, neighboring Iraq (28817 m2, 35° 18′ 40.68″ N, 46°
Jo
59′ 45.6″ E) and contains mountainous areas, broad valleys, and high plains, with mild to cold climates. This territory consists of high lands and lowlands (about 3,300 to 900 meters above sea level) with an annual rainfall of ~500 mm. There are also forested areas (320,000 hectares) in the western region of the province. Sampling was carried out in April and May 2018 from springs, ponds, wetlands, streams, and rivers of different regions of Kurdistan province (Figure 1). Samples were taken in 1.5-liter sterile bottles and transferred to the National Reference Laboratory for Plague, Tularemia and Q fever of Pasteur Institute of Iran, located in Akanlu,
Kabudar-Ahang, Hamadan, by the cold chain. Sample transferring was attempted to carry out in
-p
ro
of
less than 48 hours. Samples were kept at 4°C in the laboratory for further steps.
Figure 1. The geographical location of Kurdistan province (right) and the sampling sites (left).
Sample preparation and DNA extraction
re
The locations of sampling sites and positive samples are demonstrated in the map (left).
lP
Water samples were passed from 0.25 μm cellulose acetate filter papers (Sartorius, Germany) using a vacuum pump and laboratory filtration system (Millipore, USA). The filters were then
ur na
washed with 5 ml sterile PBS using pulse-vortexing for 15 minutes. The samples were centrifuged at 6,000 g for 10 minutes and the pellets were used for DNA extraction. All sample preparation steps were carried out at biosafety level class II plus. DNA extraction was performed using EZ-10 Spin column DNA mini preps kit (Bio-Basic Inc., Canada) according to the
Jo
manufacturer's instructions. Extracted DNAs were stored at -20 °C for further analysis.
TaqMan real-time PCR The TaqMan real-time PCR method was used to detect F. tularensis in the samples. For initial sensitive detection, ISFtu2 gene was targeted. Positive samples were more evaluated by targeting of fopA gene. The primers and probes used for real-time PCR were summarized in table 1. The reaction program was 95°C 10 min (1 cycle), 95°C for 15 sec followed by 60°C for 60 sec (40 cycles). DNA of F. tularensis subspecies holarctica (NCTC 10857) was used as the positive control. For determination of limit of detection, serial dilutions of the positive control were
prepared and as it has been shown in the supplementary file, the cycle threshold (Ct) value of 38 was determined as the positive limit of the test.
In vitro culturing One milliliter of the prepared samples was cultured on cysteine heart agar supplemented with chocolatized blood and several antibiotics (8 × 104 U l-1 Polymyxin B, 2.5 mg l-1 Amphotericin B, 4 mg l-1 Cefepime, 100 mg l-1 of Cycloheximide and 4 mg l-1 Vancomycin) at 37 °C in a 5%
of
CO2 incubator. In addition, the filter papers were also placed on the medium and incubated in the same condition. Primary colonies were subsequently subcultured on the new media to obtain single colonies. Isolates were evaluated by microscopic observation (Phenotypic characteristics)
ro
and real-time PCR. The DNA of suspected colonies was extracted using Roche high pure PCR template preparation kit (Roche, USA) according to the manufacturer's instructions. Extracted
re
-p
DNAs were used as templates for TaqMan real-time PCR.
Animal inoculation
lP
20-25 gram mature male inbred NMRI mice were used for in vivo culture. Prepared samples (0.5 ml in phosphate buffer saline) were intraperitoneally injected into the mice and monitored several times daily for 30 days. Tissue samples were collected from spleen, heart, and bone
ur na
marrow of dead Mice. The surviving mice were euthanized and autopsied after 30th days. The DNA of tissue samples was extracted using Roche high pure PCR template preparation kit (Roche, USA) and evaluated by TaqMan real-time PCR as previously described.
Results
Jo
Overall, 66 samples (Sanandaj 12, Kamyaran 10, Divandarreh 19, Sarvabad 11, and Marivan 14 samples) were taken in this study. All bacterial isolates were negative for F. tularensis. Although some nonspecific pathological signs were observed following injections or infections in some dead and autopsied mice, no indication of tularemia was found in the autopsies. TaqMan realtime PCR data showed positivity for both ISFtu2 and fopA genes in one specimen belonging to spring in Baghan village, Marivan county. DNA extracted from tissue homogenate of inoculated mice with this specimen was also positive. Moreover, two ISFtu2 positive samples were detected
in Marivan (Zrebar Lake) and Divandareh (Yapal village's spring). The samples showed 4.54% and 1.51% positivity for ISFtu2 and fopA genes, respectively.
Discussion In this study, the presence of F. tularensis was indicated in the surface waters of Kurdistan province. There are only two reports of human tularemia in Iran in 1980 and 2017, both of which are from Kurdistan province [15, 23]. Despite a few human reports, high seroprevalence has
of
been reported in residents of Kurdistan province. In 2011-2012, a serological study showed 14.40% seropositivity in this area [16] higher than some countries such as Germany, Canada and
ro
Turkey, as well as other provinces in Iran including Sistan-Baluchestan (6.5%) [17], Chaharmahal Bakhtiari (6%) [26], Ilam (2.77%) [18], and in Lorestan (3.81%) [19]. A serological study of rodents in Kurdistan province in 2017 showed 4.8% seropositivity [20].
-p
These findings indicate the circulation of F.tularensis in this region. Therefore, F.tularensis monitoring in surface waters of Kurdistan province can provide useful information about the
re
ecology of this agent.
The previous study on Kurdistan surface water in 2015 was also confirmed the contamination of
lP
the surface waters of this area, in which 13.08% and 3.85% (of 130 samples) positivity was shown in samples for ISFtu2 and fopA genes, respectively. Positive samples for the fopA gene were from Bijar, Baneh, and Sarvabad [27]. In the present study, the contamination of surface
ur na
water for both ISFtu2 and fopA genes was detected in one sample (1.51%) which was from Marivan. F.tularensis had not been previously detected in surface water of this area. But both reported human cases of Iran [15, 23] belonged to this district. The ISFTu2 gene was selected for initial sensitive detection in this survey [24]. The primary ISFTu2 qPCR assay detects different subspecies of F. tularensis (tularensis, holarctica and mediasiatica) along with F. philomiragia
Jo
and F. novicida. Positive samples were more assessed by targeting the fopA gene that encodes a 23-kDa outer membrane protein in F. tularensis and some other Francisellaceae members [24]. Recent studies showed that the exact discrimination between F. tularensis subspecies and other related species requires more reliable genetic elements [28, 29]. The differentiation between F. tularensis subspecies and F. novicida or F. philomiragia is quite difficult due to the high genetic relationship of these species [29]. As elucidated by the whole-genome analysis, more genetic
elements should be provided by further studies as discriminative molecular markers for exact identification of Francisella species in environmental specimens [29]. Different detection rates observed in our study can explain by the copy number of ISFTu2 gene in the genome. In contrast to the fopA gene, ISFTu2 presents multiple copies in Francisella spp. genomes (12 to 17 copies in subsp. tularensis, 26 to 30 copies in subsp. holarctica, 6 to 18 copies in F. novicida, and 1 to 2 copies in F. philomiragia) [24]. Higher Ct values observed for fopA in comparison to ISFTu2 in the double-positive specimen could be interpreted by this
of
difference. Studies indicate that the detection of F. tularensis in the water samples at endemic areas can vary extensively. For example, during tularemia outbreaks in Çorum, Sivas, and Kocaeli regions of
ro
Turkey (2008, 2009, and 2012), 3.57% of non-chlorinated water specimens were reported positive by culture [30]. But in the 2013 waterborne outbreak in Turkey's Sancaktepe village, the
-p
isolation was not successful from water specimens [31]. In other examples, although F. tularensis was detected in environmental samples in Pakistan (13.1 % and 3.24% in soil) [32,
re
33], Sweden (32% in water and 20% in sediment) [34], and Netherlands (25.92% in water and sediment) [35]. However, in some surveys, despite seropositivity and detection of F. tularensis
lP
in wildlife, no contamination was found in the aquatic samples [36, 37]. We could not isolate F. tularensis from the environmental samples in this study. Tularemia predominantly causes infection in rodents and is highly prevalent during epizootic periods. During interepizootic
ur na
periods it is difficult to isolate the bacteria [14]. Findings highlight the attention to rodent’s activities and carcasses near the sampling site in environmental inspections [38]. Consideration of rodents’ activities, carcasses near the surface waters, and sampling time at epizootic periods may increase the chance of bacterial isolation from the aquatic environment. It is difficult to isolate F.tularensis from the environmental samples [9, 39]. The growth of
Jo
unwanted agents in the environmental samples can interfere or inhibit the growth of F.tularensis due to the production of bacteriocins or the consumption of nutrients needed for the growth of bacteria [40]. F. tularensis are commonly found in cold mountain streams [41]. Temperature considerably affects microorganism fauna and an overgrowth often occurs in the samples taken in warm seasons [9]. Therefore, it is recommended to consider sampling in colder seasons in future studies. In this study, Polymyxin B, Amphotericin B, Cefepime, Cycloheximide, and Vancomycin were used to solve the interfering microorganism’s problem. These antibiotics in
cysteine heart agar with 9% chocolatized sheep blood known as CHAB-PACCV, has been previously developed to isolate F. tularensis from the environmental samples. Nevertheless, in contrast to desirable results obtained in the Petersen et al. study, an overgrowth was observed in a large number of our studied samples. This observation may be explained by the difference in the type and number of microorganisms existed in our samples. Sampling at different time points in large volume could be good approach due to the low amount of this bacterium in large aquatic environments. Previously, a ultrafiltration method has been used to detect and recovery of F.
of
tularensis in large volume tap water (100 liters) [42]. This method can be considered as one of the sample preparation procedures that helps to increase the recovery rate. Based our experience, large debris containing samples, especially collected form lakes and ponds, must be subjected to
ro
a pre-filtration step (40 µm filters) to facilitate the filtration process. However, pre-filtration with filter sizes smaller than 40 microns could remove protozoa that may contain the bacteria, so the
-p
pre-filtration step should be performed with cautions. Due to relative acid resistance of F. tularensis, it has been shown that acid treatments effectively reduce the growth of interfering
re
microorganisms, but can also be effective on less resistant strains of F. tularensis [43]. These considerations are proposed for samples containing a large number of interfering
lP
microorganisms. Temperature is likely to be an important factor for induction to the nonculturable state. The F. tularensis live vaccine strain (LVS) can be recovered from water after starving to 21 days at 8 °C. But at 25 °C, the bacterium does culturable only after one-day
ur na
incubation [41]. F. tularensis viable but nonculturable (VBNC) cells may be the main reason for molecular positivity but culture negativity of the samples in our study. In the present study, wide-area sampling and long distance between the sampling and cultivation sites increased the time between sampling and cultivation over 48h. Although there is no data about environmental samples on-site cultivation, but on-site specimens processing and suitable
Jo
transport system greatly increase the recovery rate of F.tularensis in field specimens [40]. Providing mobile facilities in the field studies and on-site cultivation are fully recommended for future studies.
In this study, as well as attempts to direct isolation, animal inoculation was employed. Isolation of F. tularensis subsp. holarctica has been previously reported from environmental samples with the passage in guinea pigs [4, 44]. The white mouse was also used in some studies [7]. Although, it has been shown Mus musculus is a susceptible host (LD50 = 0.5 CFU), but a very low
infectious dose could not induce the disease and mortality [45]. VBNC cells in the positive sample may also be the reason for tularemia signs that did not occur in the inoculated mice. It has been shown that VNBC cells could not able to induce the disease in mice and different methods like animal passaging could not return these cells to the cultivable state [39]. In brief, considerations about rodents’ activities and carcasses near the sampling sites, optimization of culture media with supplements and antibiotics according to microorganism population in the water, sampling from cold waters especially in low-temperature seasons, large
of
volume re-sampling of molecular positive samples, acid treatment for high-load bacterial specimens, and on-site sample processing and on-site cultivation are recommended for future
ro
studies.
Conclusion
-p
The isolation and identification of F. tularensis from natural or animal sources specify the disease cycle in the environment and help us to control the disease in the endemic areas.
re
However, since the in vitro isolation of bacteria from surface waters is associated with a very low success rate and depends on various environmental parameters, as well as technical
is fully recommended.
ur na
Conflicts of interest
lP
complexity, the use of molecular techniques for studying the bacteria in the contaminated areas
The authors report no conflict of interest in this work.
Acknowledgments
The authors would like to sincerely thank the National Institute for Medical Research
Jo
Development (Grant No. 962556) for their financial support. This study is part of a DVSc thesis of Hossein Ahangari Cohan in the faculty of veterinary sciences, science and research branch, Islamic Azad University. We also like to thanks all who provided support during the course of this research especially Dr. Ahmad Ghasemi, Dr. Saber Esmaeili, and Mr. Amir Hesam Nemati.
References .1 Dennis, D.T., et al., Tularemia as a biological weapon: medical and public health management. JAMA, 2001. 285(21): p. 2763-73. .2 Maurin, M. and M. Gyuranecz, Tularaemia: clinical aspects in Europe. Lancet Infect Dis, 2016. 16(1): p. 113-124. .3 Jellison, W.L., et al., Epizootic Tularemia in the Beaver, Castor canadensis, and the Contamination of Stream Water with Pasteurella tularensis. American Journal of Hygiene, 1942.
of
36(2): p. 168-82. .4 Parker, R.R., et al., Contamination of natural waters and mud with Pasteurella tularensis and
ro
tularemia in beavers and muskrats in the northwestern United States. Bull Natl Inst Health, 1951. 193: p. 1-161.
Appl. Environ .Microbiol., 2003. 69(1): p. 600-606.
-p
.5 Abd, H., et al., Survival and growth of Francisella tularensis in Acanthamoeba castellanii.
re
.6 Thelaus, J., et al., Influence of nutrient status and grazing pressure on the fate of Francisella tularensis in lake water. FEMS Microbiol Ecol, 2009. 67(1): p. 69-80.
lP
.7 Chitadze, N., et al., Water-borne outbreak of oropharyngeal and glandular tularemia in Georgia: investigation and follow-up. Infection, 2009. 37(6): p. 514-21. .8 Jellison, W.L., et al., Tularemia in man from a domestic rural water supply. Public Health
ur na
Rep, 1950. 65(38): p. 1219-26.
.9 Şimşek, H ,.et al., Identification of Francisella tularensis by both culture and real-time TaqMan PCR methods from environmental water specimens in outbreak areas where tularemia cases were not previously reported. European journal of clinical microbiology & infectious diseases, 2012. 31(9): p. 2353-2357.
Jo
.11 Jensen, W.I., C.R. Owen, and W.L. Jellison, Yersinia philomiragia sp. n., a new member of the Pasteurella group of bacteria, naturally pathogenic for the muskrat (Ondatra zibethica). J Bacteriol, 1969. 100(3 :)p. 1237-41. .11 Berrada, Z.L. and S.R. Telford, Diversity of Francisella Species in Environmental Samples from Martha's Vineyard, Massachusetts. Microbial Ecology, 2010. 59(2): p. 277-283. .12 Ulu-Kilic, A., et al., Tularemia in central Anatolia. Infection, 2013. 41(2): p. 391-399.
.13 Zargar, A., M. Maurin, and E. Mostafavi, Tularemia, a re-emerging infectious disease in Iran and neighboring countrie. Epidemiol Health, 2015. 37(0): p. e2015011-0. .14 Arata, A., et al., First detection of tularaemia in domestic and wild mammals in Iran. Bull World Health Organ, 1973. 49(6): p. 597-603. .15 Karimi, Y., F. Salarkia, and M.A. Ghasemi, Tularemia: first human case in Iran. Journal of Medical Council of IRAN, 1981. 8(2): p. 134-141. .16 Esmaeili, S., et al ,.Seroepidemiological survey of tularemia among different groups in
of
western Iran. Int J Infect Dis, 2014. 18: p. 27-31. .17 Esmaeili, S., et al., Serological survey of tularemia among butchers and slaughterhouse
ro
workers in Iran. Transactions of The Royal Society of Tropical Medicine Hygiene, 2014. 108(8): p. 516-518.
-p
.18 Esmaeili, S., et al., Epidemiological survey of tularemia in Ilam Province, west of Iran. BMC Infectious Diseases, 2019. 19(1): p. 502.
re
.19 Esmaeili, S., et al., Seroepidemiological study of Q fever, brucellosis and tularemia in butchers and slaughterhouses workers in Lorestan, western of Iran. Comparative Immunology,
lP
Microbiology and Infectious Diseases, 2019.
.21 Mostafavi, E., et al., A Field Study of Plague and Tularemia in Rodents, Western Iran. Vector Borne Zoonotic Dis, 2017. 17(4): p. 247-253.
ur na
.21 Pourhossein, B., et al., Tularemia and plague survey in rodents in an earthquake zone in southeastern Iran. Epidemiol Health, 2015. 37: p. e2015050. .22 Mostafavi, E., et al., Molecular Survey of Tularemia and Plague in Small Mammals From Iran. Front Cell Infect Microbiol, 2018. 8: p. 215. .23 Rohani, M., et al., A case report of human tularemia from Iran. Iranian Journal of
Jo
Microbiology, 2018. 10(4): p. 250.
.24 Versage, J.L., et al., Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. Journal of clinical microbiology, 2003. 41(12): p. 5492-5499. .25 Bushon, R., et al., Statistical assessment of DNA extraction reagent lot variability in real‐time quantitative PCR. 2010. 50(3): p. 276-282.
.26 Khoshdel, A., et al., First seroprevalence survey of children with tularemia infection in Chaharmahal va Bakhtiari province, Iran. Iranian Journal of Pathology, 2014. 9(1): p.27-23 . .27 Rohani, M., et al., The prevalence of Francisella spp. in different natural surface water samples collected from northwest of Iran. Iranian journal of microbiology, 2019. 11(1): p. 19. .28 Kingry, L.C. and J.M. Petersen, Comparative review of Francisella tularensis and Francisella novicida. Frontiers in cellular and infection microbiology, 2014. 4: p. 35. .29 Challacombe, J.F., et al., Whole-genome relationships among Francisella bacteria of diverse
of
origins define new species and provide specific regions for detection. Appl. Environ. Microbiol., 2017. 83(3): p. e02589-16.
ro
.31 Karadenizli, A., et al., Genomic analyses of Francisella tularensis strains confirm disease transmission from drinking water sources, Turkey, 2008, 2009 and 2012. Eurosurveillance, 2015.
-p
20(21): p. 21136.
.31 Aktas, D., et al., Oropharyngeal Tularemia Outbreak Associated with Drinking Contaminated
re
Tap Water, Turkey, July-September 2013. Emerg Infect Dis, 2015. 21(12): p. 2194-6. .32 Shabbir, M.Z., et al., Prevalence and distribution of soil-borne zoonotic pathogens in Lahore
lP
district of Pakistan. Front Microbiol, 2015. 6: p. 917.
.33 Muhammad, J., et al., Cross Sectional Study and Risk Factors Analysis of Francisella
89.
ur na
tularensis in Soil Samples in Punjab Province of Pakistan. Front Cell Infect Microbiol, 2019. 9: p.
.34 Broman, T., et al., Molecular Detection of Persistent Francisella tularensis Subspecies holarctica in Natural Waters. Int J Microbiol, 2011. 2011. .35 Janse, I., et al., Environmental surveillance during an outbreak of tularaemia in hares, the Netherlands, 2015. Euro Surveill, 2017. 22(35.)
Jo
.36 Gyuranecz, M., et al., Investigation of the ecology of Francisella tularensis during an interepizootic period. Vector Borne Zoonotic Dis, 2011. 11(8): p. 1031-5. .37 Grunow, R., et al., Surveillance of tularaemia in Kosovo, 2001 to 2010. Euro Surveill, 2012. 17(28.) .38 Schulze, C., et al., High and novel genetic diversity of Francisella tularensis in Germany and indication of environmental persistence. Epidemiol Infect, 2016. 144(14): p. 3025-3036.
.39 Forsman, M., et al., Francisella tularensis does not manifest virulence in viable but nonculturable state. FEMS Microbiology Ecology, 2000. 31(3): p. 217-224. .41 Petersen, J., et al., Direct isolation of Francisella spp. from environmental samples. Letters in applied microbiology, 2009. 48(6): p. 663-667. .41 Gilbert, S.E. and L.J. Rose, Survival and persistence of nonspore-forming biothreat agents in water. Lett Appl Microbiol, 2012. 55(3): p. 189-94. .42 Francy, D.S., et al., Comparison of traditional and molecular analytical methods for
of
detecting biological agents in raw and drinking water following ultrafiltration. 2009. 107(5): p. 1479-1491.
ro
.43 Humrighouse, B.W., N.J. Adcock, and E.W. Rice, Use of Acid Treatment and a Selective Medium To Enhance the Recovery of Francisella tularensis from Water. Applied and
-p
Environmental Microbiology, 2011. 77(18): p. 6729-6732.
.44 Kantardjiev, T., et al., Tularemia outbreak, Bulgaria, 1997-2005. Emerg Infect Dis, 2006 .
re
:)4(12p. 678-80.
.45 Bandouchova, H., et al., Susceptibility of selected murine and microtine species to infection
lP
by a wild strain of Francisella tularensis subsp. holoarctica. Veterinarni Medicina, 2009. 54(2): p.
Jo
ur na
64-74.
Table 1. Primers and probes used in TaqMan real-time PCR. Gene
Product
Primer & Probe Sequences (5′→3′)
length (nt)
Ref.
Forward: TTGGTAGATCAGTTGGTAGGATAACC ISFtu2
Reverse: TGAGTTTTATCCTCTGACAACAATATTTC
97
[24]
87
[25]
Probe: FAM-AAAATCCATGCTATGACTGATGCTTTAGGTAATCCA-TAMRA Forward: AACAATGGCACCTAGTAATATTTCTGG fopA
Reverse: CCACCAAAGAACCATGTTAAACC
Jo
ur na
lP
re
-p
ro
of
Probe: FAM-TGGCAGAGCGGGTACTAACATGATTGGT-TAMRA
PII:
S0147-9571(20)30007-2
DOI:
https://doi.org/10.1016/j.cimid.2020.101419
Reference:
CIMID 101419
To appear in:
Comparative Immunology, Microbiology and Infectious Diseases
Received Date:
20 November 2019
Revised Date:
1 January 2020
Accepted Date:
6 January 2020
Please cite this article as: Ahangari Cohan H, Jamshidian M, Rohani M, Moravedji M, Mostafavi E, Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran, Comparative Immunology, Microbiology and Infectious Diseases (2020), doi: https://doi.org/10.1016/j.cimid.2020.101419
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.
Surveillance of Francisella tularensis in surface water of Kurdistan province, west of Iran Hossein Ahangari Cohan1, Mahmoud Jamshidian1, Mahdi Rohani2,3, Meysam Moravedji4, Ehsan Mostafavi3,5* 1
Department of Pathobiology, Science and Research Branch, Islamic Azad University, Tehran,
Iran 3
Department of Microbiology, Pasteur Institute of Iran, Tehran, Iran
of
2
National Reference Laboratory for Plague, Tularemia and Q fever, Research Centre for
Emerging and Reemerging infectious diseases, Pasteur Institute of Iran, Akanlu, Kabudar4
ro
Ahang, Hamadan, Iran
Department of clinical sciences, Faculty of veterinary medicine, Islamic Azad University,
5
-p
Sanandaj Branch, Iran
Department of Epidemiology and Biostatics, Research Centre for Emerging and Reemerging
re
infectious diseases, Pasteur Institute of Iran, Tehran, Iran
lP
*Corresponding author:
National Reference Laboratory for Plague, Tularemia and Q Fever, Research Centre for Emerging and Reemerging Infectious Diseases, Pasteur Institute of Iran, Akanlu, Kabudar-
ur na
Ahang, Hamadan, Iran, Email: [email protected]
Highlights
Isolation of F. tularensis from surface water using in vitro and in vivo culturing methods is associated with a very low success rate and depends on various environmental
Jo
parameters.
Considerations about rodents’ activities and carcasses near the sampling sites, optimization of culture media with supplements and antibiotics according to microorganism population in the water, sampling from cold waters specially in lowtemperature seasons, large volume re-sampling of molecular positive samples, acid treatment for high-load bacterial specimens, and on-site sample processing and on-site
cultivation can improve the chance of isolation of F. tularensis from environmental samples.
The isolation and identification of F. tularensis from natural or animal sources specify the disease cycle in the environment and help us to control the disease in the endemic areas.
Abstract
of
Background: The etiologic agent of tularemia, Francisella tularensis, is transmitted to humans via ingestion of contaminated water or food, arthropods bite, respiratory aerosols, or direct
ro
contact with infected animals body fluids or tissues. In the current study, due to the importance of water in transmitting the disease and the report of the disease in different regions of Iran,
-p
surface water of Kurdistan province were evaluated for the presence of F.tularensis. Materials and Methods: Sampling was carried out in five-counties of Kurdistan province. Sixty-six specimens of surface water were collected. The detection was carried out by targeting
re
ISFtu2 and fopA genes using TaqMan real-time PCR. Moreover, the samples were both cultured and inoculated into NMRI inbreed mice. Spleens of inoculated mice and bacterial isolates were
lP
tested by TaqMan real-time PCR.
Results: Despite the lack of isolation of F. tularensis, the results of the molecular testing indicate the presence of bacteria in surface water. Molecular positivity of one sample (1.51%)
ur na
was confirmed using a real-time PCR for both ISFtu2 and fopA genes. Moreover, 4.54% of the samples were positive for ISFtu2.
Conclusion: Since the in vitro isolation of bacteria from environmental samples is associated with a very low success rate and depends on various environmental parameters, the use of molecular techniques for monitoring of the bacteria in the contaminated areas is fully
Jo
recommended.
Keywords: Tularemia, Real-Time Polymerase Chain Reaction, Surface water, Kurdistan
Introduction Francisella tularensis is a fastidious facultative intracellular gram-negative coccobacilli bacterium. Various subspecies of this bacterium including tularensis (type A), holarctica (type
B), and mediasiatica, cause disease in humans and animals, especially in rodents and lagomorphs. F. novicida is also reported as a human pathogen. Low infectious dose, a high mortality rate in some forms of the diseases, and various transmission routes led to tularemia as one of the most dangerous diseases which placed it in category A of bioterrorism agents [1]. Clinical symptoms in humans are highly dependent on modes of transmission, site of the entrance, and subspecies of this bacterium which includes ulceroglandular, glandular, oculoglandular, pharyngeal, typhoidal, and pneumonic forms. The pharyngeal form of tularemia
of
is often caused by the consumption of contaminated water or food and is associated with cervical and pharyngeal lymphadenopathy. Serologic methods are widely used for tularemia diagnosis. Because of the high risk of laboratory transmission and limitation of cultivation, the culture-
ro
based diagnosis and bacterial isolation are not recommended in low safety level laboratories. F. tularensis circulates in aquatic and terrestrial environments and different animals and vectors
-p
are involved in its life cycle [2]. F.tularensis tularensis type A is the most pathogenic subspecies, while F. tularensis holarctica (type B) is less pathogenic and often spreads through the water.
re
Type A commonly occurs in North America, while type B is more geographically widespread and is seen in North America, Europe, and Asia. Type B hosts are often rodents, especially semi-
lP
aquatic rodents, which live near rivers, lakes, or ponds. F.tularensis is able to survive in aquatic environments for a relatively long time [3, 4]. Recent in vitro studies showed the survival and growth of this bacterium in Acanthamoeba castellanii and Tetrahymena pyriformis. Hence,
ur na
protozoa may have a significant role in the preservation of this bacterium in natural waters [5, 6]. Surface waters are not only important in the survival of F.tularensis in the environment, but it is also considered as one of the most important transmission routes. There are various reports of water-borne tularemia outbreaks in the world [7, 8]. In addition, F.tularensis subsp. holarctica and F. novicida are frequently isolated from contaminated waters along with F. philomiragia [9-
Jo
11]. Contaminated water seems to be a major transmission route in Iran’s neighbors. For example, an epidemiologic study in the Anatolia region of Turkey, from December 2009 to August 2011, was specified that drinking water from natural springs is the most important transmission route of the disease. Also, some water-borne epidemics have been confirmed by real-time PCR in this region [12]. In 2006, following the diagnosis of 26 cases in eastern Georgia, water was reported as the source of contamination, and the agent was isolated from surface waters [7].
Tularemia has been reported in countries neighboring Iran (Turkmenistan, Kazakhstan, Afghanistan, Pakistan, Azerbaijan, and turkey) [13]. Although tularemia was first reported in wild mammals and domestic livestock of Iran in the 1970s, no more study was conducted to understand the epidemiology of the disease until 2011 [14]. Between 1970 and 2011, only one human case was reported in Marivan, a city in Kurdistan province in western Iran [15]. The limited reported cases would be attributed to the weakness of the health system in the diagnosis of disease and the circulation of low virulent strains in Iran [13]. After several decades of
of
inattention to tularemia, seroprevalence studies in southwestern and southeastern regions of Iran showed the infection of different human populations to F.tularensis. For example, tularemia seroprevalence among high-risk groups in Kurdistan province was 14.4 % [16], while, it ranged
ro
from 2.77 to 6.5% in different studies in eastern and western Iran [17-19]. Furthermore, antibodies against F.tularensis have been detected in rodent populations in some regions of Iran
-p
[20]. Also, the bacterial infection to F. tularensis has been identified in rodents and hares of different regions of Iran [21, 22]. The second human case of the disease was reported in Marivan
re
in 2017 [23].
Among the studied provinces in Iran, Kurdistan province is one of the high-risk regions for
lP
tularemia as seropositive human cases (2011 and 2012) and rodent (2017) samples, as well as two clinical cases of tularemia (1980 and 2017), have been reported in this province [15, 23]. Considering the importance of water resources in the survival and transmission of F.tularensis,
ur na
in the current study, the presence of bacteria was studied in surface waters of Kurdistan province.
Materials and methods Sampling
Kurdistan Province located in western Iran, neighboring Iraq (28817 m2, 35° 18′ 40.68″ N, 46°
Jo
59′ 45.6″ E) and contains mountainous areas, broad valleys, and high plains, with mild to cold climates. This territory consists of high lands and lowlands (about 3,300 to 900 meters above sea level) with an annual rainfall of ~500 mm. There are also forested areas (320,000 hectares) in the western region of the province. Sampling was carried out in April and May 2018 from springs, ponds, wetlands, streams, and rivers of different regions of Kurdistan province (Figure 1). Samples were taken in 1.5-liter sterile bottles and transferred to the National Reference Laboratory for Plague, Tularemia and Q fever of Pasteur Institute of Iran, located in Akanlu,
Kabudar-Ahang, Hamadan, by the cold chain. Sample transferring was attempted to carry out in
-p
ro
of
less than 48 hours. Samples were kept at 4°C in the laboratory for further steps.
Figure 1. The geographical location of Kurdistan province (right) and the sampling sites (left).
Sample preparation and DNA extraction
re
The locations of sampling sites and positive samples are demonstrated in the map (left).
lP
Water samples were passed from 0.25 μm cellulose acetate filter papers (Sartorius, Germany) using a vacuum pump and laboratory filtration system (Millipore, USA). The filters were then
ur na
washed with 5 ml sterile PBS using pulse-vortexing for 15 minutes. The samples were centrifuged at 6,000 g for 10 minutes and the pellets were used for DNA extraction. All sample preparation steps were carried out at biosafety level class II plus. DNA extraction was performed using EZ-10 Spin column DNA mini preps kit (Bio-Basic Inc., Canada) according to the
Jo
manufacturer's instructions. Extracted DNAs were stored at -20 °C for further analysis.
TaqMan real-time PCR The TaqMan real-time PCR method was used to detect F. tularensis in the samples. For initial sensitive detection, ISFtu2 gene was targeted. Positive samples were more evaluated by targeting of fopA gene. The primers and probes used for real-time PCR were summarized in table 1. The reaction program was 95°C 10 min (1 cycle), 95°C for 15 sec followed by 60°C for 60 sec (40 cycles). DNA of F. tularensis subspecies holarctica (NCTC 10857) was used as the positive control. For determination of limit of detection, serial dilutions of the positive control were
prepared and as it has been shown in the supplementary file, the cycle threshold (Ct) value of 38 was determined as the positive limit of the test.
In vitro culturing One milliliter of the prepared samples was cultured on cysteine heart agar supplemented with chocolatized blood and several antibiotics (8 × 104 U l-1 Polymyxin B, 2.5 mg l-1 Amphotericin B, 4 mg l-1 Cefepime, 100 mg l-1 of Cycloheximide and 4 mg l-1 Vancomycin) at 37 °C in a 5%
of
CO2 incubator. In addition, the filter papers were also placed on the medium and incubated in the same condition. Primary colonies were subsequently subcultured on the new media to obtain single colonies. Isolates were evaluated by microscopic observation (Phenotypic characteristics)
ro
and real-time PCR. The DNA of suspected colonies was extracted using Roche high pure PCR template preparation kit (Roche, USA) according to the manufacturer's instructions. Extracted
re
-p
DNAs were used as templates for TaqMan real-time PCR.
Animal inoculation
lP
20-25 gram mature male inbred NMRI mice were used for in vivo culture. Prepared samples (0.5 ml in phosphate buffer saline) were intraperitoneally injected into the mice and monitored several times daily for 30 days. Tissue samples were collected from spleen, heart, and bone
ur na
marrow of dead Mice. The surviving mice were euthanized and autopsied after 30th days. The DNA of tissue samples was extracted using Roche high pure PCR template preparation kit (Roche, USA) and evaluated by TaqMan real-time PCR as previously described.
Results
Jo
Overall, 66 samples (Sanandaj 12, Kamyaran 10, Divandarreh 19, Sarvabad 11, and Marivan 14 samples) were taken in this study. All bacterial isolates were negative for F. tularensis. Although some nonspecific pathological signs were observed following injections or infections in some dead and autopsied mice, no indication of tularemia was found in the autopsies. TaqMan realtime PCR data showed positivity for both ISFtu2 and fopA genes in one specimen belonging to spring in Baghan village, Marivan county. DNA extracted from tissue homogenate of inoculated mice with this specimen was also positive. Moreover, two ISFtu2 positive samples were detected
in Marivan (Zrebar Lake) and Divandareh (Yapal village's spring). The samples showed 4.54% and 1.51% positivity for ISFtu2 and fopA genes, respectively.
Discussion In this study, the presence of F. tularensis was indicated in the surface waters of Kurdistan province. There are only two reports of human tularemia in Iran in 1980 and 2017, both of which are from Kurdistan province [15, 23]. Despite a few human reports, high seroprevalence has
of
been reported in residents of Kurdistan province. In 2011-2012, a serological study showed 14.40% seropositivity in this area [16] higher than some countries such as Germany, Canada and
ro
Turkey, as well as other provinces in Iran including Sistan-Baluchestan (6.5%) [17], Chaharmahal Bakhtiari (6%) [26], Ilam (2.77%) [18], and in Lorestan (3.81%) [19]. A serological study of rodents in Kurdistan province in 2017 showed 4.8% seropositivity [20].
-p
These findings indicate the circulation of F.tularensis in this region. Therefore, F.tularensis monitoring in surface waters of Kurdistan province can provide useful information about the
re
ecology of this agent.
The previous study on Kurdistan surface water in 2015 was also confirmed the contamination of
lP
the surface waters of this area, in which 13.08% and 3.85% (of 130 samples) positivity was shown in samples for ISFtu2 and fopA genes, respectively. Positive samples for the fopA gene were from Bijar, Baneh, and Sarvabad [27]. In the present study, the contamination of surface
ur na
water for both ISFtu2 and fopA genes was detected in one sample (1.51%) which was from Marivan. F.tularensis had not been previously detected in surface water of this area. But both reported human cases of Iran [15, 23] belonged to this district. The ISFTu2 gene was selected for initial sensitive detection in this survey [24]. The primary ISFTu2 qPCR assay detects different subspecies of F. tularensis (tularensis, holarctica and mediasiatica) along with F. philomiragia
Jo
and F. novicida. Positive samples were more assessed by targeting the fopA gene that encodes a 23-kDa outer membrane protein in F. tularensis and some other Francisellaceae members [24]. Recent studies showed that the exact discrimination between F. tularensis subspecies and other related species requires more reliable genetic elements [28, 29]. The differentiation between F. tularensis subspecies and F. novicida or F. philomiragia is quite difficult due to the high genetic relationship of these species [29]. As elucidated by the whole-genome analysis, more genetic
elements should be provided by further studies as discriminative molecular markers for exact identification of Francisella species in environmental specimens [29]. Different detection rates observed in our study can explain by the copy number of ISFTu2 gene in the genome. In contrast to the fopA gene, ISFTu2 presents multiple copies in Francisella spp. genomes (12 to 17 copies in subsp. tularensis, 26 to 30 copies in subsp. holarctica, 6 to 18 copies in F. novicida, and 1 to 2 copies in F. philomiragia) [24]. Higher Ct values observed for fopA in comparison to ISFTu2 in the double-positive specimen could be interpreted by this
of
difference. Studies indicate that the detection of F. tularensis in the water samples at endemic areas can vary extensively. For example, during tularemia outbreaks in Çorum, Sivas, and Kocaeli regions of
ro
Turkey (2008, 2009, and 2012), 3.57% of non-chlorinated water specimens were reported positive by culture [30]. But in the 2013 waterborne outbreak in Turkey's Sancaktepe village, the
-p
isolation was not successful from water specimens [31]. In other examples, although F. tularensis was detected in environmental samples in Pakistan (13.1 % and 3.24% in soil) [32,
re
33], Sweden (32% in water and 20% in sediment) [34], and Netherlands (25.92% in water and sediment) [35]. However, in some surveys, despite seropositivity and detection of F. tularensis
lP
in wildlife, no contamination was found in the aquatic samples [36, 37]. We could not isolate F. tularensis from the environmental samples in this study. Tularemia predominantly causes infection in rodents and is highly prevalent during epizootic periods. During interepizootic
ur na
periods it is difficult to isolate the bacteria [14]. Findings highlight the attention to rodent’s activities and carcasses near the sampling site in environmental inspections [38]. Consideration of rodents’ activities, carcasses near the surface waters, and sampling time at epizootic periods may increase the chance of bacterial isolation from the aquatic environment. It is difficult to isolate F.tularensis from the environmental samples [9, 39]. The growth of
Jo
unwanted agents in the environmental samples can interfere or inhibit the growth of F.tularensis due to the production of bacteriocins or the consumption of nutrients needed for the growth of bacteria [40]. F. tularensis are commonly found in cold mountain streams [41]. Temperature considerably affects microorganism fauna and an overgrowth often occurs in the samples taken in warm seasons [9]. Therefore, it is recommended to consider sampling in colder seasons in future studies. In this study, Polymyxin B, Amphotericin B, Cefepime, Cycloheximide, and Vancomycin were used to solve the interfering microorganism’s problem. These antibiotics in
cysteine heart agar with 9% chocolatized sheep blood known as CHAB-PACCV, has been previously developed to isolate F. tularensis from the environmental samples. Nevertheless, in contrast to desirable results obtained in the Petersen et al. study, an overgrowth was observed in a large number of our studied samples. This observation may be explained by the difference in the type and number of microorganisms existed in our samples. Sampling at different time points in large volume could be good approach due to the low amount of this bacterium in large aquatic environments. Previously, a ultrafiltration method has been used to detect and recovery of F.
of
tularensis in large volume tap water (100 liters) [42]. This method can be considered as one of the sample preparation procedures that helps to increase the recovery rate. Based our experience, large debris containing samples, especially collected form lakes and ponds, must be subjected to
ro
a pre-filtration step (40 µm filters) to facilitate the filtration process. However, pre-filtration with filter sizes smaller than 40 microns could remove protozoa that may contain the bacteria, so the
-p
pre-filtration step should be performed with cautions. Due to relative acid resistance of F. tularensis, it has been shown that acid treatments effectively reduce the growth of interfering
re
microorganisms, but can also be effective on less resistant strains of F. tularensis [43]. These considerations are proposed for samples containing a large number of interfering
lP
microorganisms. Temperature is likely to be an important factor for induction to the nonculturable state. The F. tularensis live vaccine strain (LVS) can be recovered from water after starving to 21 days at 8 °C. But at 25 °C, the bacterium does culturable only after one-day
ur na
incubation [41]. F. tularensis viable but nonculturable (VBNC) cells may be the main reason for molecular positivity but culture negativity of the samples in our study. In the present study, wide-area sampling and long distance between the sampling and cultivation sites increased the time between sampling and cultivation over 48h. Although there is no data about environmental samples on-site cultivation, but on-site specimens processing and suitable
Jo
transport system greatly increase the recovery rate of F.tularensis in field specimens [40]. Providing mobile facilities in the field studies and on-site cultivation are fully recommended for future studies.
In this study, as well as attempts to direct isolation, animal inoculation was employed. Isolation of F. tularensis subsp. holarctica has been previously reported from environmental samples with the passage in guinea pigs [4, 44]. The white mouse was also used in some studies [7]. Although, it has been shown Mus musculus is a susceptible host (LD50 = 0.5 CFU), but a very low
infectious dose could not induce the disease and mortality [45]. VBNC cells in the positive sample may also be the reason for tularemia signs that did not occur in the inoculated mice. It has been shown that VNBC cells could not able to induce the disease in mice and different methods like animal passaging could not return these cells to the cultivable state [39]. In brief, considerations about rodents’ activities and carcasses near the sampling sites, optimization of culture media with supplements and antibiotics according to microorganism population in the water, sampling from cold waters especially in low-temperature seasons, large
of
volume re-sampling of molecular positive samples, acid treatment for high-load bacterial specimens, and on-site sample processing and on-site cultivation are recommended for future
ro
studies.
Conclusion
-p
The isolation and identification of F. tularensis from natural or animal sources specify the disease cycle in the environment and help us to control the disease in the endemic areas.
re
However, since the in vitro isolation of bacteria from surface waters is associated with a very low success rate and depends on various environmental parameters, as well as technical
is fully recommended.
ur na
Conflicts of interest
lP
complexity, the use of molecular techniques for studying the bacteria in the contaminated areas
The authors report no conflict of interest in this work.
Acknowledgments
The authors would like to sincerely thank the National Institute for Medical Research
Jo
Development (Grant No. 962556) for their financial support. This study is part of a DVSc thesis of Hossein Ahangari Cohan in the faculty of veterinary sciences, science and research branch, Islamic Azad University. We also like to thanks all who provided support during the course of this research especially Dr. Ahmad Ghasemi, Dr. Saber Esmaeili, and Mr. Amir Hesam Nemati.
References .1 Dennis, D.T., et al., Tularemia as a biological weapon: medical and public health management. JAMA, 2001. 285(21): p. 2763-73. .2 Maurin, M. and M. Gyuranecz, Tularaemia: clinical aspects in Europe. Lancet Infect Dis, 2016. 16(1): p. 113-124. .3 Jellison, W.L., et al., Epizootic Tularemia in the Beaver, Castor canadensis, and the Contamination of Stream Water with Pasteurella tularensis. American Journal of Hygiene, 1942.
of
36(2): p. 168-82. .4 Parker, R.R., et al., Contamination of natural waters and mud with Pasteurella tularensis and
ro
tularemia in beavers and muskrats in the northwestern United States. Bull Natl Inst Health, 1951. 193: p. 1-161.
Appl. Environ .Microbiol., 2003. 69(1): p. 600-606.
-p
.5 Abd, H., et al., Survival and growth of Francisella tularensis in Acanthamoeba castellanii.
re
.6 Thelaus, J., et al., Influence of nutrient status and grazing pressure on the fate of Francisella tularensis in lake water. FEMS Microbiol Ecol, 2009. 67(1): p. 69-80.
lP
.7 Chitadze, N., et al., Water-borne outbreak of oropharyngeal and glandular tularemia in Georgia: investigation and follow-up. Infection, 2009. 37(6): p. 514-21. .8 Jellison, W.L., et al., Tularemia in man from a domestic rural water supply. Public Health
ur na
Rep, 1950. 65(38): p. 1219-26.
.9 Şimşek, H ,.et al., Identification of Francisella tularensis by both culture and real-time TaqMan PCR methods from environmental water specimens in outbreak areas where tularemia cases were not previously reported. European journal of clinical microbiology & infectious diseases, 2012. 31(9): p. 2353-2357.
Jo
.11 Jensen, W.I., C.R. Owen, and W.L. Jellison, Yersinia philomiragia sp. n., a new member of the Pasteurella group of bacteria, naturally pathogenic for the muskrat (Ondatra zibethica). J Bacteriol, 1969. 100(3 :)p. 1237-41. .11 Berrada, Z.L. and S.R. Telford, Diversity of Francisella Species in Environmental Samples from Martha's Vineyard, Massachusetts. Microbial Ecology, 2010. 59(2): p. 277-283. .12 Ulu-Kilic, A., et al., Tularemia in central Anatolia. Infection, 2013. 41(2): p. 391-399.
.13 Zargar, A., M. Maurin, and E. Mostafavi, Tularemia, a re-emerging infectious disease in Iran and neighboring countrie. Epidemiol Health, 2015. 37(0): p. e2015011-0. .14 Arata, A., et al., First detection of tularaemia in domestic and wild mammals in Iran. Bull World Health Organ, 1973. 49(6): p. 597-603. .15 Karimi, Y., F. Salarkia, and M.A. Ghasemi, Tularemia: first human case in Iran. Journal of Medical Council of IRAN, 1981. 8(2): p. 134-141. .16 Esmaeili, S., et al ,.Seroepidemiological survey of tularemia among different groups in
of
western Iran. Int J Infect Dis, 2014. 18: p. 27-31. .17 Esmaeili, S., et al., Serological survey of tularemia among butchers and slaughterhouse
ro
workers in Iran. Transactions of The Royal Society of Tropical Medicine Hygiene, 2014. 108(8): p. 516-518.
-p
.18 Esmaeili, S., et al., Epidemiological survey of tularemia in Ilam Province, west of Iran. BMC Infectious Diseases, 2019. 19(1): p. 502.
re
.19 Esmaeili, S., et al., Seroepidemiological study of Q fever, brucellosis and tularemia in butchers and slaughterhouses workers in Lorestan, western of Iran. Comparative Immunology,
lP
Microbiology and Infectious Diseases, 2019.
.21 Mostafavi, E., et al., A Field Study of Plague and Tularemia in Rodents, Western Iran. Vector Borne Zoonotic Dis, 2017. 17(4): p. 247-253.
ur na
.21 Pourhossein, B., et al., Tularemia and plague survey in rodents in an earthquake zone in southeastern Iran. Epidemiol Health, 2015. 37: p. e2015050. .22 Mostafavi, E., et al., Molecular Survey of Tularemia and Plague in Small Mammals From Iran. Front Cell Infect Microbiol, 2018. 8: p. 215. .23 Rohani, M., et al., A case report of human tularemia from Iran. Iranian Journal of
Jo
Microbiology, 2018. 10(4): p. 250.
.24 Versage, J.L., et al., Development of a multitarget real-time TaqMan PCR assay for enhanced detection of Francisella tularensis in complex specimens. Journal of clinical microbiology, 2003. 41(12): p. 5492-5499. .25 Bushon, R., et al., Statistical assessment of DNA extraction reagent lot variability in real‐time quantitative PCR. 2010. 50(3): p. 276-282.
.26 Khoshdel, A., et al., First seroprevalence survey of children with tularemia infection in Chaharmahal va Bakhtiari province, Iran. Iranian Journal of Pathology, 2014. 9(1): p.27-23 . .27 Rohani, M., et al., The prevalence of Francisella spp. in different natural surface water samples collected from northwest of Iran. Iranian journal of microbiology, 2019. 11(1): p. 19. .28 Kingry, L.C. and J.M. Petersen, Comparative review of Francisella tularensis and Francisella novicida. Frontiers in cellular and infection microbiology, 2014. 4: p. 35. .29 Challacombe, J.F., et al., Whole-genome relationships among Francisella bacteria of diverse
of
origins define new species and provide specific regions for detection. Appl. Environ. Microbiol., 2017. 83(3): p. e02589-16.
ro
.31 Karadenizli, A., et al., Genomic analyses of Francisella tularensis strains confirm disease transmission from drinking water sources, Turkey, 2008, 2009 and 2012. Eurosurveillance, 2015.
-p
20(21): p. 21136.
.31 Aktas, D., et al., Oropharyngeal Tularemia Outbreak Associated with Drinking Contaminated
re
Tap Water, Turkey, July-September 2013. Emerg Infect Dis, 2015. 21(12): p. 2194-6. .32 Shabbir, M.Z., et al., Prevalence and distribution of soil-borne zoonotic pathogens in Lahore
lP
district of Pakistan. Front Microbiol, 2015. 6: p. 917.
.33 Muhammad, J., et al., Cross Sectional Study and Risk Factors Analysis of Francisella
89.
ur na
tularensis in Soil Samples in Punjab Province of Pakistan. Front Cell Infect Microbiol, 2019. 9: p.
.34 Broman, T., et al., Molecular Detection of Persistent Francisella tularensis Subspecies holarctica in Natural Waters. Int J Microbiol, 2011. 2011. .35 Janse, I., et al., Environmental surveillance during an outbreak of tularaemia in hares, the Netherlands, 2015. Euro Surveill, 2017. 22(35.)
Jo
.36 Gyuranecz, M., et al., Investigation of the ecology of Francisella tularensis during an interepizootic period. Vector Borne Zoonotic Dis, 2011. 11(8): p. 1031-5. .37 Grunow, R., et al., Surveillance of tularaemia in Kosovo, 2001 to 2010. Euro Surveill, 2012. 17(28.) .38 Schulze, C., et al., High and novel genetic diversity of Francisella tularensis in Germany and indication of environmental persistence. Epidemiol Infect, 2016. 144(14): p. 3025-3036.
.39 Forsman, M., et al., Francisella tularensis does not manifest virulence in viable but nonculturable state. FEMS Microbiology Ecology, 2000. 31(3): p. 217-224. .41 Petersen, J., et al., Direct isolation of Francisella spp. from environmental samples. Letters in applied microbiology, 2009. 48(6): p. 663-667. .41 Gilbert, S.E. and L.J. Rose, Survival and persistence of nonspore-forming biothreat agents in water. Lett Appl Microbiol, 2012. 55(3): p. 189-94. .42 Francy, D.S., et al., Comparison of traditional and molecular analytical methods for
of
detecting biological agents in raw and drinking water following ultrafiltration. 2009. 107(5): p. 1479-1491.
ro
.43 Humrighouse, B.W., N.J. Adcock, and E.W. Rice, Use of Acid Treatment and a Selective Medium To Enhance the Recovery of Francisella tularensis from Water. Applied and
-p
Environmental Microbiology, 2011. 77(18): p. 6729-6732.
.44 Kantardjiev, T., et al., Tularemia outbreak, Bulgaria, 1997-2005. Emerg Infect Dis, 2006 .
re
:)4(12p. 678-80.
.45 Bandouchova, H., et al., Susceptibility of selected murine and microtine species to infection
lP
by a wild strain of Francisella tularensis subsp. holoarctica. Veterinarni Medicina, 2009. 54(2): p.
Jo
ur na
64-74.
Table 1. Primers and probes used in TaqMan real-time PCR. Gene
Product
Primer & Probe Sequences (5′→3′)
length (nt)
Ref.
Forward: TTGGTAGATCAGTTGGTAGGATAACC ISFtu2
Reverse: TGAGTTTTATCCTCTGACAACAATATTTC
97
[24]
87
[25]
Probe: FAM-AAAATCCATGCTATGACTGATGCTTTAGGTAATCCA-TAMRA Forward: AACAATGGCACCTAGTAATATTTCTGG fopA
Reverse: CCACCAAAGAACCATGTTAAACC
Jo
ur na
lP
re
-p
ro
of
Probe: FAM-TGGCAGAGCGGGTACTAACATGATTGGT-TAMRA