Sustained effect of bone marrow mononuclear cell therapy in axonal regeneration in a model of optic nerve crush

Author's Accepted Manuscript

Sustained effect of bone marrow mononuclear cell therapy in axonal regeneration in a model of optic nerve crush Camila Zaverucha-do-Valle, Louise Mesentier-Louro, Fernanda Gubert, Nicoli Mortari, Ana Beatriz Padilha, Bruno D. Paredes, Andre Mencalha, Eliana Abdelhay, Camila Teixeira, Fernanda G.M. Ferreira, Fernanda Tovar-Moll, Sergio Augusto Lopes de Souza, Bianca Gutfilen, Rosalia Mendez-Otero, Marcelo F. Santiago

PII: DOI: Reference:

www.elsevier.com/locate/brainres

S0006-8993(14)01187-1 http://dx.doi.org/10.1016/j.brainres.2014.08.070 BRES43756

To appear in: Brain Research

Accepted date: 30 August 2014 Cite this article as: Camila Zaverucha-do-Valle, Louise Mesentier-Louro, Fernanda Gubert, Nicoli Mortari, Ana Beatriz Padilha, Bruno D. Paredes, Andre Mencalha, Eliana Abdelhay, Camila Teixeira, Fernanda G.M. Ferreira, Fernanda Tovar-Moll, Sergio Augusto Lopes de Souza, Bianca Gutfilen, Rosalia Mendez-Otero, Marcelo F. Santiago, Sustained effect of bone marrow mononuclear cell therapy in axonal regeneration in a model of optic nerve crush, Brain Research, http://dx.doi.org/10.1016/j. brainres.2014.08.070 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting galley proof before it is published in its final citable form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Title: Sustained effect of bone marrow mononuclear cell therapy in axonal regeneration in a model of optic nerve crush Running title: Mononuclear bone marrow cells and optic nerve regeneration

Authors: Camila Zaverucha-do-Valle1,2, Louise Mesentier-Louro1,2, Fernanda Gubert1,2, Nicoli Mortari1,2, Ana Beatriz Padilha1,2, Bruno D. Paredes1,2, Andre Mencalha3,4, Eliana Abdelhay3, Camila Teixeira2, Fernanda G. M. Ferreira2,5, Fernanda Tovar-Moll2,5,6, Sergio Augusto Lopes de Souza2,7, Bianca Gutfilen7, Rosalia Mendez-Otero1,2 and Marcelo F. Santiago1,2

1

Instituto de Biofísica Carlos Chagas Filho; Programa de Terapia Celular/PROTECEL;

Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, 21941-902, Brazil. 2

Instituto Nacional de Ciência e Tecnologia de Biologia Estrutural e Bioimagem –

INBEB; Universidade Federal do Rio de Janeiro, Rio de Janeiro, RJ, 21941-902, Brazil. 3

Laboratório de Células-Tronco, Centro Nacional de Transplante de Medula Óssea,

Instituto Nacional de Câncer, Rio de Janeiro, Brazil. 4

Universidade do Estado do Rio de Janeiro, Instituto de Biologia Roberto Alcantara

Gomes, Departamento de Biofísica e Biometria, Rio de Janeiro, Brazil. 5

Instituto D’Or de Pesquisa e Educação (IDOR), Rio de Janeiro, Brazil.

6

Instituto de Ciência Biomédicas; Universidade Federal do Rio de Janeiro, Rio de

Janeiro, RJ, 21941-902, Brazil. 7

Departamento de Radiologia, Escola de Medicina, Universidade Federal do Rio de

Janeiro, Rio de Janeiro, Brazil.



ͳ

Correspondence should be addressed to Camila Zaverucha-do-Valle, Instituto de Biofísica Carlos Chagas Filho, Centro de Ciências da Saúde, Sala G2-028, Cidade Universitária, RJ 21941-902, Rio de Janeiro, Brazil. E-mail: [email protected] Phone: (+5521)2562-6554. Fax: (+5521) 2280-8193.



ʹ

Abstract In adult mammals, the regeneration of the optic nerve is very limited and at the moment there are several groups trying different approaches to increase retinal ganglion cell (RGC) survival and axonal outgrowth. One promising approach is cell therapy. In previous work, we performed intravitreal transplantation of bone-marrow mononuclear cells (BMMCs) after optic nerve crush in adult rats and we demonstrated an increase in RGC survival and axon outgrowth 14 days after injury. In the present work, we investigated if these results could be sustained for a longer period of time. Optic nerve crush was performed in Lister-hooded adult rats and BMMC or saline injections were performed shortly after injury. Neuronal survival and regeneration were evaluated in rats' retina and optic nerve after 28 days. We demonstrated an increase of 5.2 fold in the axon outgrowth 28 days after lesion, but the BMMCs had no effect on RGC survival. In an attempt to prolong RGC survival, we established a new protocol with two BMMC injections, the second one 7 days after the injury. Untreated animals received two injections of saline. We observed that although the axonal outgrowth was still increased after the second BMMC injection, the RGC survival was not significantly different from untreated animals. These results demonstrate that BMMCs transplantation promotes neuroregeneration at least until 28 days after injury. However, the effects on RGC survival previously observed by us at 14 days were not sustained at 28 days and could not be prolonged with a second dose of BMMC. Keywords: optic nerve, bone marrow mononuclear cells, cell therapy, retinal ganglion cell survival, axonal regeneration.



͵

1. Introduction It is well described that in adult mammals most of the retinal ganglion cells (RGCs) fail to regenerate their axons after optic nerve crush or transection and undergo apoptosis. This regeneration failure has been attributable both to the inhibitory environment of the central nervous system and the intrinsic inability of RGCs to regenerate (Schwab et al., 1993, Goldberg, 2004). Because of that, many groups have been testing different approaches in order to promote RGC survival and axonal outgrowth following optic nerve injury. Among these approaches, there is induction of inflammation either by lens puncture or Zymosan injection (Fischer et al., 2000, Leon et al., 2000, Yin et al., 2003) and the stimulation of RGCs intrinsic program to regenerate through, for example, the deletion of the phosphatase and tensin (PTEN) (Park et al., 2008) and/or the deletion of the homolog suppressor of cytokine signaling 3 (SOCS3) (Smith et al., 2009, Sun et al., 2011). The combination of PTEN deletion with Zymosan injection and elevation of intracellular cAMP leads to long distance regeneration and functional recovery (Kurimoto et al., 2010, de Lima et al., 2012). However, these different approaches are not easily translated to clinic. Regarding this, a developing strategy involves cell therapy with the transplantation of bone marrow derived cells or other cell types. Cell therapy has been used in different animal models of neurological diseases and lesions with interesting results (Giraldi-Guimaraes et al., 2009, Ribeiro-Resende et al., 2009, Johnson et al., 2010, Moraes et al., 2012, Suzuki et al., 2012, Vasconcelos-dos-Santos et al., 2012a) and it is beginning to be used in clinical trials (Barbosa da Fonseca et al., 2009, Barbosa da Fonseca et al., 2010, Battistella et al.,



Ͷ

2011, Friedrich et al., 2012, Rost et al., 2012). Interestingly, data from clinical studies suggests that an intravitreal injection of autologous bone-marrow-derived cells into the vitreous cavity is technically feasible and safe (Jonas et al., 2008, Siqueira et al., 2011). In the visual system, bone marrow mesenchymal cells have been transplanted intravitreally in two different models of glaucoma and showed neuroprotective results (Yu et al., 2006, Johnson et al., 2010). It has also been shown that brain-derived neurotrophic factor (BDNF)-secreting mesenchymal cells increases RGC survival in chronically hypertensive rat eyes (Harper et al., 2011) and that modified bone marrow mesenchymal cells increased neuroprotection after optic nerve transection (LevkovitchVerbin et al., 2010). Increased neuronal survival was also obtained after bone marrow mesenchymal cells transplantation in a model of lesion by ischemia/reperfusion (Li et al., 2009). In previous work, our group demonstrated increase in RGC survival and axonal outgrowth 14 days after optic nerve crush and BMMC transplantation (Zaverucha-doValle et al., 2011). We have also identified two proteins - Tax1-binding protein 1 and Synaptotagmin IV – that were up-regulated after optic nerve crush and cell therapy (Mesentier-Louro et al., 2012). However, in most of these studies the effects were analyzed 14 days after treatment and it was important to investigate whether BMMC transplantation effects could still be present after a longer period of time. Therefore, in the present work, we analyzed neuroprotection and axonal regeneration 28 days after nerve injury and BMMC transplantation.

2. Results



ͷ

2.1. BMMC transplantation increases axonal outgrowth 28 days after injury To evaluate if the effect of BMMC transplantation on regeneration (Zaverucha-do-Valle et al., 2011) was sustained, we analyzed the axonal outgrowth 28 days after injury and cell therapy. For that, we used cholera toxin subunit B conjugated to Alexa-488 (CTB) as anterograde marker to visualize axons. In untreated animals (Figure 1A), we observed a very small number of axons crossing the injury site (*). After BMMC transplantation, we noticed an increase in the number of axons distal to the lesion (Figure 1B) when compared with the untreated group. We quantified the number of CTB-labeled axons extending to 0.5, 1.0, 1.5 and 2mm from the crush site using the formula described by Leon and co-workers (Leon et al., 2000). The untreated animals had a median of 163.9 axons per nerve at 0.5mm; 52.8 axons at 1mm; 2.3 axons at 1.5mm and 0 axons at 2mm from the crush site (n=8). The animals that received BMMC transplantation had a median of 819.2 axons per nerve at 0.5mm (n=5); 454.9 axons at 1mm (n=5); 304.5 axons at 1.5mm (n=4) and 15.8 axons at 2mm (n=3) from the crush site. BMMC transplantation generated a 5-fold significant increase (p<0.01) in the number of CTB-labeled axons at 0.5mm from the crush site, a 8.6-fold significant increase (p<0.01) in the number of CTB-labeled axons at 1mm from the crush site and a 129.8-fold significant increase (p<0.05) in the number of CTB-labeled axons at 1.5mm from the crush site. At the distance of 2mm from the injury site, there was no statistically significant difference between the two conditions (p>0.05). Figure 1C shows the quantified data. These results were confirmed by using GAP-43 staining. We quantified the number of GAP-43+ axons located at 0.5, 1.0, 1.5 and 2mm from the injury site and we estimated



͸

the number of axons per nerve using the formula described by (Leon et al., 2000). The untreated animals had a median of 220.9 axons per nerve at 0.5mm (n=3); 46.7 axons at 1mm (n=8); 41 axons at 1.5mm (n=3) and 0 axons at 2mm (n=8) from the crush site. The BMMC-treated animals had a median of 583.5 axons per nerve at 0.5mm (n=4); 258.9 axons at 1mm (n=10); 65.6 axons at 1.5mm (n=5) and 21 axons at 2mm (n=10) from the crush site. We observed a significant increase in the number of GAP-43+ axons located at 1mm from the crush site after BMMC transplantation. Figure 1D shows the quantified data.

2.2. The BMMC transplantation effect on RGC survival is not sustained 28 days after injury To evaluate if the effect of BMMC transplantation on neuroprotection (Zaverucha-doValle et al., 2011) was also sustained, we analyzed RGC survival 28 days after injury and cell therapy. For that, we used the retrograde tracer DiI or the antibody Tuj1. Figure 2A illustrates DiI labeled RGCs and virtually intact axonal bundles in the contralateral, uninjured retinas. In contrast, twenty-eight days after optic nerve crush, the number of surviving RGCs is very small, both in the untreated and the treated conditions (Figure 2B-C). Figure 2G shows the quantification of the data. Untreated animals (n=8) showed a survival of 15.95 ά1.78% RGCs and BMMC-treated animals (n=9) had a survival of 13.45 ά1.18% RGCs compared to contralateral uninjured retinas. These results were confirmed by using another technique to label RGCs, the Tuj1 antibody. Using this technique, we can notice that virtually all RGCs are labeled in the uninjured retinas (Figure 2D). After optic nerve crush, there is a great reduction in the



͹

number of surviving RGCs, both in untreated and treated conditions (Figure 2E-F). Figure 2H shows the quantification of the data. Untreated animals had 12.71 ά 1.91% of Tuj1+ RGCs and BMMC-treated animals had 11.58 ά 2.19% of Tuj1+ RGCs compared to contralateral uninjured retinas. However, we observed that, in BMMC-treated retinas, RGC cells stained with Tuj1 exhibit a typical morphology, brighter staining and more intact axons in several of the analyzed retinas (arrows and arrowheads in Figure 2E-F), suggesting that the treatment may have other beneficial effects that are not related to cell survival. These results suggest that although we verified a difference on axonal outgrowth comparing treated to untreated animals 28 days after injury, the number of surviving RGCs is similar in both conditions. This suggests that there are probably different mechanisms related to axon regeneration and neuronal protection.

2.3. Expression of trophic factors one day after optic nerve crush In order to investigate possible mechanisms related to the observed effects, we analyzed mRNA levels of different trophic factors that have been previously associated to optic nerve regeneration. We analyzed the mRNA levels of FGF-2 (Sapieha et al., 2003), vascular endothelial growth factor (VEGF)(Kilic et al., 2006) ciliary neurotrophic factor (CNTF) (Weise et al., 2000, Muller et al., 2007, Muller et al., 2009), BDNF (MansourRobaey et al., 1994, Isenmann et al., 1998, Galindo-Romero et al., 2013) and oncomodulin (Yin et al., 2006, Yin et al., 2009) by real time PCR 1 day after optic nerve crush. We chose a time point when the BMMCs would still be present to select a factor to be further analyzed 28 days after the injury. Figure 3 shows the quantified data. Values



ͺ

were normalized with mRNA levels in control retinas and GAPDH was used as loading control. We can notice that there was a significant increase in FGF-2 mRNA levels (Figure 3A) in BMMC-treated animals one day after injury compared with untreated animals. For the other analyzed factors, there were no statistically significant differences between treated and untreated animals.

2.4. FGF-2 expression in the retina 28 days after optic nerve crush As the FGF-2 was the only analyzed factor that was up-regulated after cell therapy one day after injury, we analyzed the expression of this factor in the retina 28 days after the injury by imunohistochemistry. In previous work, our group showed that there is an increase in FGF-2 expression in the treated animals 14 days after the crush (Zaveruchado-Valle et al., 2011) and we speculated that this increase could be related to the BMMC effects on RGC survival and axon outgrowth. After 28 days, we observed FGF-2 expression both in the inner nuclear layer and in the nerve fiber layer in both untreated (Figure 4A) and treated animals (Figure 4B). We quantified the fluorescence intensity in the different retinal layers of untreated and BMMC-treated animals, and we observed there was no difference between the groups. This suggests that the increased expression of FGF-2 in BMMC-treated animals observed 14 days after injury was not sustained. Figure 4C shows the quantified data.

2.5. Transplanted cells do not remain in the eye for a long period of time



ͻ

To investigate the fate of transplanted cells, we used different techniques. For short-term tracking, we either labeled the BMMCs with a radioisotope (99mTc) and analyzed by scintigraphy or we labeled them with a fluorescent dye (CellTrace) and analyzed by flow cytometry. Figure 5 shows that one hour after optic nerve crush and cell transplantation 99m

Tc activity was not found in any other organ of the body and was restricted to the eye,

suggesting that BMMCs do not enter the bloodstream shortly after transplantation. This can be seen in the sagittal (Figure 5A), coronal (Figure 5B) and horizontal (Figure 5C) planes. In the transversal plane of the torax (Figure 5D), we can note the absence of activity in other organs. In Figure 5E we can see the

99m

Tc activity combined with a CT

image. Because of the short half-life of the 99mTc, its activity could not be detected for a longer period of time. Animals that received CellTrace-labeled BMMCs were analyzed one and three days after optic nerve crush and cell transplantation by flow cytometry. In Figure 5F we can notice that prior to transplantation, most of the BMMCs were labeled with Cell Trace, demonstrating the efficiency of labeling. In Figure 5G we can see that there is no unspecific staining in uninjured eyes and in Figures 5H-I there is a huge decrease in the number of transplanted cells in the eye of the host from one (Figure 5H) to three days (Figure 5I) after the injection. For a long-term tracking, we labeled the BMMCs with SPION and analyzed them by in vivo MRI 1, 5 and 14 days after optic nerve crush and cell transplantation. In Figure 6AD, we can see the dextran-coating (in green) of the dissociated BMMC labeled with SPION before transplantation. Nuclei are stained with TO-PRO-3 (in green). We can note that although the efficiency of SPION incorporation seems high, each cell can only



ͳͲ

incorporate a few particles. In Figure 6E, we can see that one day after optic nerve crush and BMMC injection, there is a high number of dextran-labeled cells (in red) in the vitreous body. Nuclei are stained with TO-PRO-3 (in green). Figure 6F shows MRI images 1, 5 and 14 days after unilateral optic nerve crush (left eye) and injection of SPION-labeled BMMCs. The signal of the iron in the transplanted cells is more evident one day after injection and it appears as a hypointense, dark spot close to the lens (arrows). This can be seen in the coronal, horizontal and sagittal planes. Five days after transplantation, we can note a decrease in the hypointense signal, which is more evident in the coronal plane. Finally, 14 days after the injection, the hypointense signal derived from the transplanted cells is almost absent, suggesting that there is a fast decrease in the number of BMMC cells in the eye.

2.6. A second BMMC injection does not prolong RGC survival 28 days after injury As the number of cells that remain in the eye 14 days after injection is very small, we speculated that the transitory effect of BMMC transplantation on RGC survival could be related to the short persistence of these cells in the eye. Therefore, we performed a second injection of BMMCs 7 days after the first one to verify if a new exposure to the transplanted cells could prolong RGC survival. Untreated animals received two injections of saline at the same time points. Animals were analyzed 28 days after optic nerve crush. Twenty-eight days after injury, we can notice that there is no statistically significant difference between the animals that received two injections of BMMCs (Figure 7B) when compared to animals that received two injections of saline (Figure 7A). Animals that received two saline injections (n=8) had a mean of 12.76 ά1.83% RGCs and animals



ͳͳ

that received two BMMC injections (n=14) had a mean of 16.01 ά 1.56% RGCs compared to contralateral uninjured retinas. Figure 7C shows the quantification of the data. This demonstrates that a second injection of BMMC does not prolong RGC survival. Besides quantifying neuronal survival on these animals, we also analyzed the axonal outgrowth by GAP-43 staining. As previously done, we quantified the number of GAP43+ axons located at 0.5, 1.0, 1.5 and 2mm from the injury site. Animals that received two injections of saline had a median of 264.1 axons per nerve at 0.5mm (n=6); 176.9 axons at 1mm (n=6); 27.2 axons at 1.5mm (n=6) and 0 axons at 2mm (n=6) from the crush site. Animals that received two injections of BMMC had a median of 967.7 axons per nerve at 0.5mm (n=8); 620.3 axons at 1mm (n=10); 124.9 axons at 1.5mm (n=10) and 20.3 axons at 2mm (n=10) from the crush site. The two injections of BMMC generated a 3.6-fold significant increase (p<0.05) in the number of GAP-43+ axons at 0.5mm from the crush site, a 3.5-fold significant increase (p<0.05) in the number of GAP-43+ axons at 1mm from the crush site and a 4.6-fold significant increase (p<0.05) in the number of GAP-43+ axons at 1.5mm from the crush site when compared to two saline injections. At the distance of 2mm from the injury site, there was no statistically significant difference between the two conditions (p>0.05). Figure 7D shows the quantified data. Interestingly, comparing the median of the number of axons located at 1mm from the crush site after one (454.9 axons) or two BMMC injections (620.3 axons), we can notice that after two injections, there is a higher number of axons at this distance. The difference



ͳʹ

is statistically significant (p<0.05), demonstrating that a second dose of BMMC improves the effect of a single dose on axonal regeneration (Supplemental Figure 1A). However, comparing the median of the number of axons located at 1mm from the crush site after one (46.73 axons) or two saline injections (176.9 axons), there is also a statistically significant difference (p<0.05) (Supplemental Figure 1B), suggesting a possible role of inflammation in these results. To verified if a second injection of BMMC increased the persistence of the cells in the eye, we labeled the BMMCs again with SPION and analyzed the animals that received two BMMC injections by in vivo MRI 1, 8 and 14 days after optic nerve crush. Figure 8 shows MRI images of coronal, horizontal and sagittal planes 1, 8 and 14 days after unilateral optic nerve crush (left eye). Labeled cells were injected at the same day of optic nerve crush and 7 days after the first injection. Similar to what we observed after a single BMMC injection, the signal of the transplanted cells is more evident one day after injection and it decreases in the subsequent days. By comparing Figure 8 to Figure 6F, we can notice that two weeks after optic nerve crush, the iron signal from the SPION BMMC is very similar after one (Figure 6F) or two injections (Figure 8), suggesting that a second dose of BMMC does not increase persistence of the transplanted cells in the eye.

3. Discussion In previous work, our group demonstrated that BMMC transplantation increases RGC survival and axonal outgrowth 14 days after optic nerve crush (Zaverucha-do-Valle et al., 2011). In the present work, we investigated if this effect was sustained for a longer period of time and we analyzed the effect of a second injection of BMMC.



ͳ͵

Although other studies have used bone marrow-derived mesenchymal cells for cell therapy in the visual system with (Johnson et al., 2010, Levkovitch-Verbin et al., 2010), we used BMMCs because these cells can be easily transplanted from donor to recipient without cell culture, making translation to clinic simpler. Another potential advantage of using these cells is that they are a heterogeneous population and cell types other than the mesenchymal cells may also play a role in the treatment. We have previously characterized that the BMMC fraction we inject has around 24% of lymphocytes, 55% of granulocytes and 16% of monocytes (Gubert et al., 2013) and these cells can release cytokines and/or growth factors in response to stimulus. Our group has demonstrated, for example, increased in BDNF and FGF-2 levels after global ischemia and sciatic nerve injury respectively in animals that received BMMC transplantation (Ribeiro de Resende et al., 2012, Gubert et al., 2013). It is also possible that paracrine interactions between mesenchymal cells and other bone marrow-derived cells might be beneficial. We analyzed both RGC survival and axonal outgrowth 28 days after optic nerve crush. We observed that BMMC-treated animals had a higher number of axons located at 0.5, 1 and 1.5mm from the crush site when compared to untreated animals at this time point. If we compare the median of the number of axons located at 0.5, 1.0 and 1.5mm from the crush site 14 days (Zaverucha-do-Valle et al., 2011) and 28 days after optic nerve crush and cell therapy, we can notice that the median is always higher at the longest time point (423.8 axons versus 819.2 axons at 0.5mm; 174.6 axons versus 454.9 at 1mm; 77.1 axons versus 304.5 axons at 1.5mm). This comparison suggests that the axons continue to grow from 14 to 28 days after injury.



ͳͶ

However, 28 days after optic nerve crush, the number of RGCs that remained alive was similar in treated and untreated animals, suggesting that the BMMC effect on RGC survival was transient. This is not the first report of a therapy that promotes axonal outgrowth without promoting retinal ganglion cell survival. Yin and co-workers, for example, showed that oncomodulin released from microspheres promotes regeneration in the optic nerve, but the protein does not improve neuronal survival in vitro (Yin et al., 2006). It has also been shown that FGF-2 up-regulation in adult RGCs by gene delivery has a transient effect on RGC survival following optic nerve crush (Sapieha et al., 2003). Fourteen days after the injury, the authors demonstrated increased axonal outgrowth following FGF-2 up-regulation in spite of low RGC survival (Sapieha et al., 2003). There are different reports showing that promoting RGC survival is not enough to improve axonal regeneration (Lodovichi et al., 2001, Inoue et al., 2002), suggesting that neuronal survival and axonal outgrowth follow different pathways. In order to investigate possible factors that could be responsible for the BMMC effect, we analyzed the mRNA levels of FGF-2, VEGF, CNTF, BDNF and oncomodulin and we demonstrated an increase in FGF-2 mRNA levels 1 day after optic nerve crush. This increase is still evident 14 days after optic nerve crush (Zaverucha-do-Valle et al., 2011), but after 28 days, the FGF-2 levels are very similar in treated and untreated animals. Therefore, the effects of BMMC transplantation on RGC survival could be related to FGF-2 release and, consequently, would be transitory. Analyzing the permanence of transplanted cells in the eye by MRI, we demonstrated that the number of BMMCs in the eye is very low 14 days after transplantation. Therefore, the



ͳͷ

transitory effects on neuroprotection could be associated to the short persistence of the transplanted cells in the eye that is probably due to their low integration into the retina. This low integration has been reported in different models (Yu et al., 2006, Johnson et al., 2010). Short-term effects on RGC survival have also been shown after cell therapy in other models. Wu and co-workers, for example, have shown increased neuronal survival 7 days after optic nerve transection and injection of olfactory ensheathing cells into the ocular stumps, but these effects were not sustained after 14 days (Wu et al., 2010). In an attempt to prolong the effects on RGC survival, we performed a second injection of BMMC 7 days after the first one. We verified that even with the second dose, there was still no statistically significant difference on RGC survival between treated and untreated animals. That was not the first report showing that multiple cell injections did not improve the therapy outcome. Omori and co-workers, for example, injected a single dose or multiple doses of human mesenchymal stem cells systemically after cerebral artery occlusion in rats and verified that the single dose had the greatest therapeutic effect when compared to the multiple injections (Omori et al., 2008). Similarly, Zhang and coworkers showed that multiple injections (either two or three injections) of bone marrow cells did not decrease the infarct size in a model of myocardial infarction (Zhang et al., 2011). A possible explanation for the lack of effect of the second injection on RGC survival is that the window of treatment is very narrow since the RGCs activate apoptotic pathways and start to die within the first days after optic nerve injury. Therapy should act on early time points to avoid the entrance of cells in the degenerative process. Once the cells are



ͳ͸

committed to die, it might be too late to promote survival. Our results suggest that BMMC transplantation does not prevent cell death but, instead, delays it, explaining why RGCs are more preserved 14 days after the lesion but not after 28 days. For that reason, giving an additional injection of BMMCs 7 days after the first treatment may be too late to improve survival. Interestingly, although the second BMMC injection did not improve RGC survival, we can notice an effect on axonal outgrowth. By comparing the median of the number of axons located at 1mm from the crush site after one or two BMMC injections, there is a higher number of axons after two injections. This demonstrates that a second dose of BMMC improves the effect of a single dose on axonal regeneration. However, as mentioned previously, two injections of saline also generates a higher number of axons at 1mm from the crush site than one injection of saline. This suggest that although we excluded from the analysis animals that had lens injury, the additional injection of vehicle by itself improved axonal outgrowth, possibly by inducing a low inflammatory process. Therefore, a single injection of BMMCs followed by a second injection of vehicle may be a good option to improve axonal regeneration. However, it is important to mention that performing a second injection increases the chances of injuring the lens and/or damaging the retina and the risk should be considered for clinical purposes. In conclusion, cell therapy using bone marrow mononuclear cells improves axonal outgrowth and this effect is sustained at least up to 28 days after optic nerve crush. In previous work, we demonstrated that a few axons were able to reach the brain 60 days after treatment, suggesting that the BMMC transplantation on axonal outgrowth is



ͳ͹

prolonged (Zaverucha-do-Valle et al., 2011). However, at this time point, RGC survival is similar in untreated and treated animals, suggesting that neuronal survival and axonal regeneration follow different pathways. A second dose of BMMC could not rescue the retinal ganglion cells. Therefore, in order to achieve long-term effects on neuroprotection, it would be important to find other types of cells that could persist in the tissue for a longer period of time. It has been demonstrated that bone marrow-derived mesenchymal cells can survive in the brain for at least 60 days (Moraes et al., 2012) and in the vitreous cavity for at least 5 weeks (Johnson et al., 2010). Both BMMC and mesenchymal cells express growth factors ((Yu et al., 2006, Li et al., 2009, Zaverucha-do-Valle et al., 2011, Ribeiro de Resende et al., 2012, Johnson et al., 2014) and both populations have been used in different models with similar results ((de Vasconcelos Dos Santos et al., 2010, Lindoso et al., 2011, Abreu et al., 2013). Therefore, it would be interesting to analyze if mesenchymal cells could prolong RGC survival. Alternatively, it would also be interesting to combine cell therapy using BMMC with other strategies to increase RGC survival, such as lens injury (Fischer et al., 2000, Leon et al., 2000) zymosan injection (Yin et al., 2003), bcl-2 overexpression (Chierzi et al., 1999) or PTEN and SOCS-3 deletion (Park et al., 2008, Smith et al., 2009, Sun et al., 2011).

4. Experimental Procedure 4.1. Bone Marrow Mononuclear Cell Extraction All the experiments were performed according to the ARVO Statement for the Use of



ͳͺ

Animals in Ophthalmic and Vision Research and the protocols were approved by the Committee for the Use of Experimental Animals of our Institution. Bone marrow mononuclear cell extraction was performed as previously described (Zaverucha-do-Valle et al., 2011, Vasconcelos-dos-Santos et al., 2012a). Briefly, the bone marrow was extruded from their tibias and femurs of syngeneic donor Lister-hooded adult rats. The isolated bone marrow was dissociated in DMEM-F12 (GIBCO BRL, Grand Island, NY, USA) and separated by density gradient on Histopaque 1083 (Sigma, St. Louis, MO, USA). The mononuclear fraction was then collected, washed three times with phosphatebuffered saline (PBS) and resuspended in saline (0.9% NaCl).

4.2. Optic nerve crush and intraocular injections Optic nerve was crushed in a procedure similar to previously described (Berry et al., 1996). Briefly, Lister-hood adult rats (3-5 months old) were anesthetized with ketamine (50 mg/kg) and xylazine (5 mg/kg) and an incision was made in the skin under a stereoscopic microscope. The left optic nerve was exposed, the epineurium was opened and the optic nerve was crushed 1mm behind the eye with angled tweezers for 15 seconds avoiding injury to the ophthalmic artery. Immediately after the optic nerve crush, we injected 5l of saline or 5 x 106 BMMCs ressuspended in 5l of saline using a 5-l Hamilton syringe avoiding injury to the lens. Animals that received two injections of saline or BMMCs had the first injection immediately after the crush and the second injection after 7 days. The second injection was always performed in the side of the eye opposite to the first injection to avoid further damage. Lesion was always performed in one eye and the contralateral eye was used as control. Animals were kept in a warm cage



ͳͻ

for anesthesia recovery and received food and water ad libitum after being transferred to animal facility.

4.3. BMMC labeling with Cell Trace and flow cytometry For flow cytometry analyses, BMMCs were labeled with the fluorescent dye CellTrace™ FarRed DDAO-SE (2.5 μg/mL) (Invitrogen) for 40 min at 37 °C and 5%/95% CO2/air. After incubation, cells were washed three times in PBS and prepared for administration as described previously. One and 3 days after optic nerve crush and BMMC transplantation, animals were euthanized. The vitreous body and the retina were isolated and retina was dissociated using a papain digestion protocol. Briefly, retinas were incubated in papain solution (Worthington Biochemical Corporation, Lakewood, NJ, USA) for 30 minutes at 37oC and 5%/95% CO2/air. Cells were then washed there times in DMEM-F12 (GIBCO BRL, Grand Island, NY, USA) and resuspended in PBS for flow cytometry analyses. Cells were incubated with DAPI to verify cell viability and were analyzed in a BD FACS Aria II flow cytometer (BD Biosciences). Acquired data were analyzed by FlowJo v.7.6.4 software (FlowJo, USA).

4.4. BMMC labeling with 99mTechnetium (99mTc) and in vivo scintigraphy For short-term track of the transplanted cells, BMMCs were labeled with 99mTc following protocols described previously (Carvalho et al., 2008, Quintanilha et al., 2008, Vasconcelos-dos-Santos et al., 2012b). Briefly, 500 L of sterile SnCl2 solution was added to the cell suspension in 0.9% NaCl and the mixture was incubated at room



ʹͲ

temperature for 10 min. Then, 5 mCi of

99m

Tc was added and the incubation continued

for another 10 min. After centrifugation (500×g for 5 min), the supernatant was removed and the cells were resuspended in 0.9% NaCl. Viability of the labeled cells was assessed by the trypan blue exclusion test, and was estimated to be greater than 93% in all cases. Labeling efficiency (%) was calculated by the activity in the pellet divided by the sum of the radioactivity in the pellet plus supernatant, and was estimated to be greater than 90% in all cases. A total of 5x 106 99mTc-BMMCs were injected direct into the vitreous body of adult rats as previously described. Whole-body and localized scintigraphies were performed in these animals one hour after injection for qualitative biodistribution in a dedicated small animal SPECT/CT camera (Triumph, Gamma-medica ideas, Canada) equipped with a high-resolution collimator and diagnostic CT.

4.5. BMMC labeling with SPION and in vivo magnetic resonance imaging (MRI)  For long-term track of the transplanted cells, BMMCs were labeled with superparamagnetic iron oxide (SPION) particles (FeraTrack Contrast Particles, Milteny Biotec, Bergisch Gladbach, Germany). We used the protocol described by the manufacturer and cells were incubated with the particles for 3h, at 37oC and 5%/95% CO2/air. After this period of time, cells were washed three times with PBS and were resuspended in saline for further injection. BMMCs labeled with SPION were tracked in vivo by MRI scanning 1, 5, 9, 14 or 16 days after optic nerve crush and cell transplantation. For MRI, animals were anesthetized by intraperitoneal injection of ketamine (50 mg/Kg) and xylazine (15 mg/Kg) and positioned in the MRI coil. Images were acquired in a 7- T magnetic resonance scanner (7T/210



ʹͳ

horizontal Varian scanner, Agilent Technologies, Palo Alto, CA, USA), using fast spin echo (FSE) proton density (PD) sequences (matrix: 192x192, slice thickness: 0.5mm; 15 continuous slices) in the axial (TR/TE: 1500/11 ms; field of view: 30 x 30 cm), coronal (TR/TE: 2100/11 ms; field of view: 30 x 30.5 cm) and sagittal (TR/TE: 1500/11 ms; field of view: 30 x 30.5 cm) planes. Data processing was performed using MRIcron.

4.6. Immunohistochemistry Twenty-eight days after optic nerve crush, animals were euthanized and perfused with saline followed by 4% paraformaldehyde and 4% paraformaldehyde with 10% sucrose. Eyes were then removed with the optic nerve attached. For retinal ganglion cell survival analysis, retinas were dissected, flat mounted and washed 3 times with 0.1% Triton X100 in PBS. Flat-mounted retinas were then incubated in 5% normal goat serum (Sigma) in PBS at room temperature for 1 hour and in Tuj1 antibody (1:500 in 0.1% Triton X-100 in PBS, Covance Inc., USA) at room temperature for 3 hours followed by incubation at 4oC overnight. The retinas were washed in PBS and then incubated with Cy3-conjugated goat anti-mouse IgG (1:1000, Jackson ImmunoResearch Lab. Inc., West Grove, PA, USA) for 2 h at room temperature. After washing (three times in PBS), retinas were mounted with VectaShield (Vector, Burlingame, CA, USA) onto glass slides and photographed on a Zeiss Axiovert 200M microscope equipped with an Apotome slide (Zeiss). To quantify RGC survival, we took 10 pictures of regions radially distributed at 1 mm from the optic disc, using a 40× 0.75 NA objective. Counts were made by a blind observer. The statistical analysis was done using GraphPad Prism 5.02 (1992– 2004 GraphPad Software, Inc.), using an unpaired two- tailed t-test.



ʹʹ

For axonal outgrowth and basic fibroblast growth factor (FGF-2) expression analysis, nerves and eyes were embedded in optimal cutting temperature (OCT) compound (Tissue- Tek, Sakura, Japan) and cut longitudinally on a cryostat (Leica CM 1850, Microsystems Nussloch GmbH, Germany) at 14–20m thickness. Sections were collected on gelatin-coated slides. For immunohistochemistry analysis, sections were washed 3 times in PBS, incubated in 5% normal goat serum (Sigma) in PBS for 30 min at room temperature and incubated with primary antibodies overnight at 4oC. Sections were then washed 3 times and incubated with the appropriate secondary antibodies for 2 hours at room temperature. Nerves were stained with anti-growth-associated protein 43 (GAP43) antibody (1:50; Santa Cruz Biotechnology, Santa Cruz, CA, USA) followed by Cy3conjugated goat anti-rabbit IgG (1:1000, Jackson ImmunoResearch Lab. Inc., West Grove, PA, USA) or Alexa 488-conjugated goat anti-rabbit IgG (1:200; Invitrogen Inc., Carlsbad, CA, USA). Retinas were stained with anti-FGF-2 antibody (1:100, EMD Millipore, Germany) followed by Cy3-conjugated goat anti-mouse IgG (1:1000, Jackson ImmunoResearch Lab. Inc., West Grove, PA, USA). In some cases the tissues were incubated with Sytox Green (500nM; Invitrogen), bisbenzimide (0.01% in PBS, Sigma) or TO-PRO®-3 (1:1000, Invitrogen Inc) for nuclei counterstaining. After washing (three times in PBS), the slides were mounted with VectaShield (Vector Laboratories) and analyzed by confocal microscopy (Zeiss, LSM 510 META). To visualize the SPIONs in the transplanted cells, we used an antibody against their dextran-coating. For that, both retinas of transplanted animals and dissociated cells plated on glass coverslips were washed 3 times with 0.1% Triton X-100 in PBS and incubated in 5% normal goat serum (Sigma) in PBS for 30 min at room temperature. The primary



ʹ͵

antibody (anti-dextran, 1:1000, StemCell Technologies, Vancouver, BC, Canada) was incubated overnight at 4 °C. After that, the cells or the tissue were washed with 0.1% Triton X-100 in PBS and incubated with the secondary antibody (Alexa488-anti-mouse, 1:1000, Invitrogen Inc) and TO-PRO®-3 to label nuclei (1:1000, Invitrogen Inc) for 2 h at room temperature. After washing, the slides were mounted with VectaShield (Vector Laboratories) and analyzed by confocal microscopy (Zeiss, LSM 510 META).

4.7. Fluorescence intensity quantification Twenty-eight days after optic nerve crush, retinas from untreated and BMMC-treated animals were labeled with anti-FGF-2 antibody and nuclei were counterstained with TOPRO-3 as described above. For fluorescence intensity quantification, Z stack images from the central and peripheral retinas were acquired using a confocal microscope (Zeiss LSM 510 Meta). We analyzed two images from each slice and three slices per animal. All the immunostaining reactions were performed simultaneously. Individual slices of each stack were analyzed using Image J software (NIH). Fluorescence intensity was measured separately in the nerve fiber layer (NFL) and ganglion cell layer (GCL), in the inner plexiform layer (IPL) and in the inner nuclear layer (INL), outer plexiform layer (OPL) and outer nuclear layer (ONL). The quantified only the FGF-2 labeling signal and the nuclei stained was used only for identification of retinal layer. The average mean gray value per stack of BMMC-treated and untreated animals were acquired and used for statistical analysis. Quantifications were performed by a blind observer.

4.8. Retrograde labeling of retinal ganglion cells In a different set of animals, retinal ganglion cell survival was quantified by retrograde 

ʹͶ

labeling using the lipophilic tracer DiI (1,1-dioctadecyl-3,3,3,3-tetramethylindocarbocyanine perchlorate, Invitrogen) (n=16). DiI labeling was performed as previously described (Zaverucha-do-Valle et al., 2011). Briefly, 4 l of DiI (2.5% in dimethylformamide, Sigma) was delivered stereotaxically (6.3 mm posterior from Bregma; 1.2 mm lateral and 3.5 mm ventral) bilaterally into the superior colliculi 7 days before the optic nerve crush. For quantification of RGC survival, 28 days after optic nerve crush, animals were euthanized and the retinas were dissected without fixation, flat mounted, and fixed onto gelatinized glass slides with 4% paraformaldehyde for 15 min at room temperature. Retinas were then washed three times with PBS, covered with coverslips and photographed on a Zeiss Axiovert 200M microscope equipped with structured illumination microscopy (Apotome) and a MRm digital camera (Zeiss).

4.9. Ganglion cell axon labeling and quantification of axon outgrowth For retinal ganglion cell axon labeling, we injected 4 l of Cholera Toxin B subunit conjugated to Alexa488 (CTB) (Invitrogen, 0.2% diluted in PBS with 1% DMSO) into the vitreous body 26 days after optic nerve crush. Two days after injection, animals were perfused, optic nerves were dissected and histological preparation was similar to what was described above. For quantification of axon outgrowth, we counted the number of GAP-43+ axons or CTBlabeled axons located at 0.5, 1, 1.5 and 2mm from the injury site. The total number of axons per nerve was calculated by using the formula described by Leon and co-workers (Leon et al., 2000). Statistical analysis was done using GraphPad Prism 5.02 (1992– 2004 GraphPad Software, Inc.) using a nonparametric unpaired one-tailed Mann-Whitney test.



ʹͷ

4.10. Real Time quantitative PCR Analysis of mRNA levels changes was carried out by real-time quantitative polymerase chain reaction. Total mRNA was obtained from retina by TRIzol reagent (Invitrogen) according to the manufacturer’s protocol and stored at – 70 ° C. A total of 2 g RNA was treated with DNAse Amplification grade I (Invitrogen), to remove genomic DNA contaminant, and then reverse transcribed to complementary DNA (cDNA) with Superscript II Reverse Transcriptase ® (Invitrogen) and Oligo-dT18 (Invitrogen). Reactions were performed in 10 uL with final concentration of 1 x of Power SYBR Green PCR Master Mix (Applied biosystems), 0,5 uM of each forward and reverse primers and completed 2,5 uL of cDNA diluted five folds. Reactions were carry out in Rotor Gene-Q 6000 thermocycler (Qiagen) with hot-start stage step of 10 min at 95o C followed by 45 cycles of 20s at 95°C and 40s at 60°C. The dissociation curve was used to determine the PCR efficiency and specific amplification and primer-dimer formation. The GAPDH mRNA levels were used as reference for normalization reactions. Sequence primers used were: BDNF 5’-

ATGGTTATTTCATACTTCGGTTGC and 5’-

CCGTGGACGTTTGCTTCTT; FGF2 5’-AGGAAGATGGACGGCTGCTG and 5’GCCCAGTTCGTTTCAGTGCC; CNTF 5’-TGAAGACAGAAGCAAACCAGC and 5’AGAACGGCTACAGAGGTCCC; VEGF 5’-GAGTATATCTTCAAGCCGTCCTGT and

5’-ATCTGCATAGTGACGTTGCTCTC;

ATCAAGAAGGTGGTGAAGCAGG

and

GAPDH

5’-

5’-AGGTGGAAGAGTGGGAGTTGCT.

Fold-expression was calculated using the Delta delta cycle threshold (DDCt) method (Livak and Schmittgen, 2001).



ʹ͸

Acknowledgments This study was supported by grants from the Conselho Nacional de Desenvolvimento Científico e Tecnológico, Coordenação de Aperfeiçoamento de Pessoal de Nível Superior, Fundação Carlos Chagas Filho de Amparo à Pesquisa do Estado do Rio de Janeiro, and the Brazilian Ministry of Health. We thank Felipe Marins and Suelen Serio for technical assistance.

References Abreu, S.C., Antunes, M.A., de Castro, J.C., de Oliveira, M.V., Bandeira, E., Ornellas, D.S., Diaz, B.L., Morales, M.M., Xisto, D.G., Rocco, P.R., 2013. Bone marrowderived mononuclear cells vs. mesenchymal stromal cells in experimental allergic asthma. Respir Physiol Neurobiol. 187, 190-198. Barbosa da Fonseca, L.M., Battistella, V., de Freitas, G.R., Gutfilen, B., Dos Santos Goldenberg, R.C., Maiolino, A., Wajnberg, E., Rosado de Castro, P.H., MendezOtero, R., Andre, C., 2009. Early tissue distribution of bone marrow mononuclear cells after intra-arterial delivery in a patient with chronic stroke. Circulation. 120, 539-541. Barbosa da Fonseca, L.M., Gutfilen, B., Rosado de Castro, P.H., Battistella, V., Goldenberg, R.C., Kasai-Brunswick, T., Chagas, C.L., Wajnberg, E., Maiolino, A., Salles Xavier, S., Andre, C., Mendez-Otero, R., de Freitas, G.R., 2010. Migration and homing of bone-marrow mononuclear cells in chronic ischemic stroke after intra-arterial injection. Exp Neurol. 221, 122-128.



ʹ͹

Battistella, V., de Freitas, G.R., da Fonseca, L.M., Mercante, D., Gutfilen, B., Goldenberg, R.C., Dias, J.V., Kasai-Brunswick, T.H., Wajnberg, E., Rosado-deCastro, P.H., Alves-Leon, S.V., Mendez-Otero, R., Andre, C., 2011. Safety of autologous bone marrow mononuclear cell transplantation in patients with nonacute ischemic stroke. Regen Med. 6, 45-52. Berry, M., Carlile, J., Hunter, A., 1996. Peripheral nerve explants grafted into the vitreous body of the eye promote the regeneration of retinal ganglion cell axons severed in the optic nerve. J Neurocytol. 25, 147-170. Carvalho, A.B., Quintanilha, L.F., Dias, J.V., Paredes, B.D., Mannheimer, E.G., Carvalho, F.G., Asensi, K.D., Gutfilen, B., Fonseca, L.M., Resende, C.M., Rezende, G.F., Takiya, C.M., de Carvalho, A.C., Goldenberg, R.C., 2008. Bone marrow multipotent mesenchymal stromal cells do not reduce fibrosis or improve function in a rat model of severe chronic liver injury. Stem Cells. 26, 1307-1314. Chierzi, S., Strettoi, E., Cenni, M.C., Maffei, L., 1999. Optic nerve crush: axonal responses in wild-type and bcl-2 transgenic mice. J Neurosci. 19, 8367-8376. de Lima, S., Koriyama, Y., Kurimoto, T., Oliveira, J.T., Yin, Y., Li, Y., Gilbert, H.Y., Fagiolini, M., Martinez, A.M., Benowitz, L., 2012. Full-length axon regeneration in the adult mouse optic nerve and partial recovery of simple visual behaviors. Proc Natl Acad Sci U S A. 109, 9149-9154. de Vasconcelos Dos Santos, A., da Costa Reis, J., Diaz Paredes, B., Moraes, L., Jasmin, Giraldi-Guimaraes, A., Mendez-Otero, R., 2010. Therapeutic window for treatment of cortical ischemia with bone marrow-derived cells in rats. Brain Res. 1306, 149-158.



ʹͺ

Fischer, D., Pavlidis, M., Thanos, S., 2000. Cataractogenic lens injury prevents traumatic ganglion cell death and promotes axonal regeneration both in vivo and in culture. Invest Ophthalmol Vis Sci. 41, 3943-3954. Friedrich, M.A., Martins, M.P., Araujo, M.D., Klamt, C., Vedolin, L., Garicochea, B., Raupp, E.F., Sartori El Ammar, J., Machado, D.C., Costa, J.C., Nogueira, R.G., Rosado-de-Castro, P.H., Mendez-Otero, R., Freitas, G.R., 2012. Intra-arterial infusion of autologous bone marrow mononuclear cells in patients with moderate to severe middle cerebral artery acute ischemic stroke. Cell Transplant. 21 Suppl 1, S13-21. Galindo-Romero, C., Valiente-Soriano, F.J., Jimenez-Lopez, M., Garcia-Ayuso, D., Villegas-Perez, M.P., Vidal-Sanz, M., Agudo-Barriuso, M., 2013. Effect of brainderived neurotrophic factor on mouse axotomized retinal ganglion cells and phagocytic microglia. Invest Ophthalmol Vis Sci. 54, 974-985. Giraldi-Guimaraes, A., Rezende-Lima, M., Bruno, F.P., Mendez-Otero, R., 2009. Treatment with bone marrow mononuclear cells induces functional recovery and decreases neurodegeneration after sensorimotor cortical ischemia in rats. Brain Res. Goldberg, J.L., 2004. Intrinsic neuronal regulation of axon and dendrite growth. Curr Opin Neurobiol. 14, 551-557. Gubert, F., Zaverucha-do-Valle, C., Figueiredo, F.R., Bargas-Rega, M., Paredes, B.D., Mencalha, A.L., Abdelhay, E., Gutfilen, B., Barbosa da Fonseca, L.M., MendezOtero, R., Santiago, M.F., 2013. Bone-marrow cell therapy induces differentiation of radial glia-like cells and rescues the number of oligodendrocyte progenitors in



ʹͻ

the subventricular zone after global cerebral ischemia. Stem Cell Res. 10, 241256. Harper, M.M., Grozdanic, S.D., Blits, B., Kuehn, M.H., Zamzow, D., Buss, J.E., Kardon, R.H., Sakaguchi, D.S., 2011. Transplantation of BDNF-secreting mesenchymal stem cells provides neuroprotection in chronically hypertensive rat eyes. Invest Ophthalmol Vis Sci. 52, 4506-4515. Inoue, T., Hosokawa, M., Morigiwa, K., Ohashi, Y., Fukuda, Y., 2002. Bcl-2 overexpression does not enhance in vivo axonal regeneration of retinal ganglion cells after peripheral nerve transplantation in adult mice. J Neurosci. 22, 44684477. Isenmann, S., Klocker, N., Gravel, C., Bahr, M., 1998. Short communication: protection of axotomized retinal ganglion cells by adenovirally delivered BDNF in vivo. Eur J Neurosci. 10, 2751-2756. Johnson, T.V., Bull, N.D., Hunt, D.P., Marina, N., Tomarev, S.I., Martin, K.R., 2010. Neuroprotective effects of intravitreal mesenchymal stem cell transplantation in experimental glaucoma. Invest Ophthalmol Vis Sci. 51, 2051-2059. Johnson, T.V., DeKorver, N.W., Levasseur, V.A., Osborne, A., Tassoni, A., Lorber, B., Heller, J.P., Villasmil, R., Bull, N.D., Martin, K.R., Tomarev, S.I., 2014. Identification of retinal ganglion cell neuroprotection conferred by plateletderived growth factor through analysis of the mesenchymal stem cell secretome. Brain. 137, 503-519. Kilic, U., Kilic, E., Jarve, A., Guo, Z., Spudich, A., Bieber, K., Barzena, U., Bassetti, C.L., Marti, H.H., Hermann, D.M., 2006. Human vascular endothelial growth



͵Ͳ

factor protects axotomized retinal ganglion cells in vivo by activating ERK-1/2 and Akt pathways. J Neurosci. 26, 12439-12446. Kurimoto, T., Yin, Y., Omura, K., Gilbert, H.Y., Kim, D., Cen, L.P., Moko, L., Kugler, S., Benowitz, L.I., 2010. Long-distance axon regeneration in the mature optic nerve: contributions of oncomodulin, cAMP, and pten gene deletion. J Neurosci. 30, 15654-15663. Leon, S., Yin, Y., Nguyen, J., Irwin, N., Benowitz, L.I., 2000. Lens injury stimulates axon regeneration in the mature rat optic nerve. J Neurosci. 20, 4615-4626. Levkovitch-Verbin, H., Sadan, O., Vander, S., Rosner, M., Barhum, Y., Melamed, E., Offen, D., Melamed, S., 2010. Intravitreal injections of neurotrophic factors secreting mesenchymal stem cells are neuroprotective in rat eyes following optic nerve transection. Invest Ophthalmol Vis Sci. 51, 6394-6400. Li, N., Li, X.R., Yuan, J.Q., 2009. Effects of bone-marrow mesenchymal stem cells transplanted into vitreous cavity of rat injured by ischemia/reperfusion. Graefes Arch Clin Exp Ophthalmol. 247, 503-514. Lindoso, R.S., Araujo, D.S., Adao-Novaes, J., Mariante, R.M., Verdoorn, K.S., FragelMadeira, L., Caruso-Neves, C., Linden, R., Vieyra, A., Einicker-Lamas, M., 2011. Paracrine interaction between bone marrow-derived stem cells and renal epithelial cells. Cell Physiol Biochem. 28, 267-278. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25, 402408.



͵ͳ

Lodovichi, C., Di Cristo, G., Cenni, M.C., Maffei, L., 2001. Bcl-2 overexpression per se does not promote regeneration of neonatal crushed optic fibers. Eur J Neurosci. 13, 833-838. Mansour-Robaey, S., Clarke, D.B., Wang, Y.C., Bray, G.M., Aguayo, A.J., 1994. Effects of ocular injury and administration of brain-derived neurotrophic factor on survival and regrowth of axotomized retinal ganglion cells. Proc Natl Acad Sci U S A. 91, 1632-1636. Mesentier-Louro, L.A., Coronel, J., Zaverucha-do-Valle, C., Mencalha, A., Paredes, B.D., Abdelhay, E., Mendez-Otero, R., Santiago, M.F., 2012. Cell therapy modulates expression of Tax1-binding protein 1 and synaptotagmin IV in a model of optic nerve lesion. Invest Ophthalmol Vis Sci. 53, 4720-4729. Moraes, L., Vasconcelos-dos-Santos, A., Santana, F.C., Godoy, M.A., Rosado-de-Castro, P.H., Jasmin, Azevedo-Pereira, R.L., Cintra, W.M., Gasparetto, E.L., Santiago, M.F., Mendez-Otero, R., 2012. Neuroprotective effects and magnetic resonance imaging of mesenchymal stem cells labeled with SPION in a rat model of Huntington's disease. Stem Cell Res. 9, 143-155. Muller, A., Hauk, T.G., Fischer, D., 2007. Astrocyte-derived CNTF switches mature RGCs to a regenerative state following inflammatory stimulation. Brain. 130, 3308-3320. Muller, A., Hauk, T.G., Leibinger, M., Marienfeld, R., Fischer, D., 2009. Exogenous CNTF stimulates axon regeneration of retinal ganglion cells partially via endogenous CNTF. Mol Cell Neurosci. 41, 233-246.



͵ʹ

Omori, Y., Honmou, O., Harada, K., Suzuki, J., Houkin, K., Kocsis, J.D., 2008. Optimization of a therapeutic protocol for intravenous injection of human mesenchymal stem cells after cerebral ischemia in adult rats. Brain Res. 1236, 3038. Park, K.K., Liu, K., Hu, Y., Smith, P.D., Wang, C., Cai, B., Xu, B., Connolly, L., Kramvis, I., Sahin, M., He, Z., 2008. Promoting axon regeneration in the adult CNS by modulation of the PTEN/mTOR pathway. Science. 322, 963-966. Quintanilha, L.F., Mannheimer, E.G., Carvalho, A.B., Paredes, B.D., Dias, J.V., Almeida, A.S., Gutfilen, B., Barbosa da Fonseca, L.M., Resende, C.M., Rezende, G.F., Campos de Carvalho, A.C., Goldenberg, R.C., 2008. Bone marrow cell transplant does not prevent or reverse murine liver cirrhosis. Cell Transplant. 17, 943-953. Ribeiro de Resende, V.T., Carrier-Ruiz, A., Lemes, R.M., Reis, R.A., Mendez-Otero, R., 2012. Bone marrow-derived fibroblast growth factor-2 induces glial cell proliferation in the regenerating peripheral nervous system. Mol Neurodegener. 7, 34. Ribeiro-Resende, V.T., Pimentel-Coelho, P.M., Mesentier-Louro, L.A., Mendez, R.M., Mello-Silva, J.P., Cabral-da-Silva, M.C., de Mello, F.G., de Melo Reis, R.A., Mendez-Otero, R., 2009. Trophic activity derived from bone marrow mononuclear cells increases peripheral nerve regeneration by acting on both neuronal and glial cell populations. Neuroscience. 159, 540-549. Rost, N.S., Smith, E.E., Nogueira, R.G., Fitzpatrick, K.M., Yoo, A.J., Hirsch, J.A., Schwamm, L.H., 2012. Implementation of a patient selection protocol for intra-



͵͵

arterial therapy increases treatment rates in patients with acute ischemic stroke. J Neurointerv Surg. Sapieha, P.S., Peltier, M., Rendahl, K.G., Manning, W.C., Di Polo, A., 2003. Fibroblast growth factor-2 gene delivery stimulates axon growth by adult retinal ganglion cells after acute optic nerve injury. Mol Cell Neurosci. 24, 656-672. Schwab, M.E., Kapfhammer, J.P., Bandtlow, C.E., 1993. Inhibitors of neurite growth. Annu Rev Neurosci. 16, 565-595. Smith, P.D., Sun, F., Park, K.K., Cai, B., Wang, C., Kuwako, K., Martinez-Carrasco, I., Connolly, L., He, Z., 2009. SOCS3 deletion promotes optic nerve regeneration in vivo. Neuron. 64, 617-623. Sun, F., Park, K.K., Belin, S., Wang, D., Lu, T., Chen, G., Zhang, K., Yeung, C., Feng, G., Yankner, B.A., He, Z., 2011. Sustained axon regeneration induced by codeletion of PTEN and SOCS3. Nature. 480, 372-375. Suzuki, J., Sasaki, M., Harada, K., Bando, M., Kataoka, Y., Onodera, R., Mikami, T., Wanibuchi, M., Mikuni, N., Kocsis, J.D., Honmou, O., 2012. Bilateral Cortical Hyperactivity Detected by fMRI Associates with Improved Motor Function Following Intravenous Infusion of Mesenchymal Stem Cells in a Rat Stroke Model. Brain Res. Vasconcelos-dos-Santos, A., Rosado-de-Castro, P.H., Lopes de Souza, S.A., da Costa Silva, J., Ramos, A.B., Rodriguez de Freitas, G., Barbosa da Fonseca, L.M., Gutfilen,

B.,

Mendez-Otero,

R.,

2012a.

Intravenous

and

intra-arterial

administration of bone marrow mononuclear cells after focal cerebral ischemia: Is there a difference in biodistribution and efficacy? Stem Cell Res. 9, 1-8.



͵Ͷ

Vasconcelos-dos-Santos, A.i., Rosado-de-Castro, P.H., Lopes de Souza, S.A., da Costa Silva, J., Ramos, A.B., Rodriguez de Freitas, G., Barbosa da Fonseca, L.M., Gutfilen,

B.,

Mendez-Otero,

R.,

2012b.

Intravenous

and

intra-arterial

administration of bone marrow mononuclear cells after focal cerebral ischemia: Is there a difference in biodistribution and efficacy? Stem Cell Research. 9, 1-8. Weise, J., Isenmann, S., Klocker, N., Kugler, S., Hirsch, S., Gravel, C., Bahr, M., 2000. Adenovirus-mediated expression of ciliary neurotrophic factor (CNTF) rescues axotomized rat retinal ganglion cells but does not support axonal regeneration in vivo. Neurobiol Dis. 7, 212-223. Wu, M.M., Fan, D.G., Tadmori, I., Yang, H., Furman, M., Jiao, X.Y., Young, W., Sun, D., You, S.W., 2010. Death of axotomized retinal ganglion cells delayed after intraoptic nerve transplantation of olfactory ensheathing cells in adult rats. Cell Transplant. 19, 159-166. Yin, Y., Cui, Q., Gilbert, H.Y., Yang, Y., Yang, Z., Berlinicke, C., Li, Z., Zaverucha-doValle, C., He, H., Petkova, V., Zack, D.J., Benowitz, L.I., 2009. Oncomodulin links inflammation to optic nerve regeneration. Proc Natl Acad Sci U S A. 106, 19587-19592. Yin, Y., Cui, Q., Li, Y., Irwin, N., Fischer, D., Harvey, A.R., Benowitz, L.I., 2003. Macrophage-derived factors stimulate optic nerve regeneration. J Neurosci. 23, 2284-2293. Yin, Y., Henzl, M.T., Lorber, B., Nakazawa, T., Thomas, T.T., Jiang, F., Langer, R., Benowitz, L.I., 2006. Oncomodulin is a macrophage-derived signal for axon regeneration in retinal ganglion cells. Nat Neurosci. 9, 843-852.



͵ͷ

Yu, S., Tanabe, T., Dezawa, M., Ishikawa, H., Yoshimura, N., 2006. Effects of bone marrow stromal cell injection in an experimental glaucoma model. Biochem Biophys Res Commun. 344, 1071-1079. Zaverucha-do-Valle, C., Gubert, F., Bargas-Rega, M., Coronel, J.L., Mesentier-Louro, L.A., Mencalha, A., Abdelhay, E., Santiago, M.F., Mendez-Otero, R., 2011. Bone marrow mononuclear cells increase retinal ganglion cell survival and axon regeneration in the adult rat. Cell Transplant. 20, 391-406. Zhang, Y., Sievers, R.E., Prasad, M., Mirsky, R., Shih, H., Wong, M.L., Angeli, F.S., Ye, J., Takagawa, J., Koskenvuo, J.W., Springer, M.L., Grossman, W., Boyle, A.J., Yeghiazarians, Y., 2011. Timing of bone marrow cell therapy is more important than repeated injections after myocardial infarction. Cardiovasc Pathol. 20, 204212.

Figure legends: Figure 1. BMMC transplantation increases axonal outgrowth 28 days after optic nerve crush. (A-B) Photomontage of confocal projection images of longitudinal sections of optic nerve labeled with CTB injected into the vitreous body 2 days before euthanasia. Animals were analyzed 28 days after injury and saline injection (A) or BMMC transplantation (B). In untreated animals (A), the axons do not extend much passing the injury site (*), while in treated animals, there is an increased axonal extension (B). (C) Quantification of the number of CTB labeled axons located at 0.5, 1, 1.5 and 2mm from the crush site 28 days after the injury. (D) Quantification of the number of GAP-43+



͵͸

axons located at 0.5, 1, 1.5 and 2mm from the crush site 28 days after the injury. The values of the graphs represent the means ± standard error of the mean. Scale bar: 125m.

Figure 2. BMMC transplantation does not sustain RGC survival 28 days after optic nerve crush injury. (A-F) Confocal projection images of flat-mounted retinas retrograde labeled with DiI injected into the superior colliculus 7 days before the injury (A-C) or labeled with Tuj1 antibody (D-F). (A and D) Control retina with no injury. We can notice a high number of RGCs and intact axonal bundles. (B and E) Twenty-eight days after optic nerve injury, there is a great reduction in the number of RGCs (arrowheads) and thinning of axon bundles (arrows). (C and F) In treated animals, the number of surviving RGCs is similar to untreated ones. However, cell morphology (arrowheads) and integrity of axon bundles (arrows) revealed by Tuj1 staining are qualitatively better preserved. (GH) Quantification of RGC survival 28 days after the crush using DiI retrograde labeling (G) or Tuj1 labeling (H). (% of DiI+ or Tuj1+ RGCs relative to normal). For DiI labeling, n=8 (crush+saline) and n=9 (crush+BMMC). For Tuj1 labeling, n=4 (crush+saline) and n=6 (crush+BMMC). Scale bar: 50m.

Figure 3. mRNA levels of trophic factors after optic nerve crush and cell therapy. Quantification of FGF-2 (A), BDNF (B), Oncomodulin (C), CNTF (D), VEGF (E) and mRNA levels by real time RT-PCR 1 day after injury. We can note that 1 day after injury there is a significant increase in FGF-2 mRNA levels after cell therapy (p<0.05). Values of the graphs represent the means ± standard error of the mean. Values were normalized to the control group mean and GAPDH was used as loading control.



͵͹

Figure 4. FGF-2 expression in the retina 28 days after optic nerve crush. (A and B) Confocal photomicrographs of FGF-2 immunostaining in the retina 28 days after optic nerve crush and saline injection (A) or BMMC transplantation (C). In both conditions, FGF-2 (red) is expressed in the inner nuclear layer (INL) and in the nerve fiber layer (NFL). Nuclei are counterstained with TO-PRO-3 (blue). (C) Quantification of FGF-2 labeling fluorescence intensity 28 days after injury. Scale bar: 20m.

Figure 5. Analysis of BMMC transplanted cells by sintigraphy and flow citometry. In order to trace the fate of transplanted cells shortly after injection, BMMCs were labeled with 99mTc prior to transplantation. Whole-body and localized scintigraphies were performed in these animals for qualitative biodistribution in a dedicated small animal SPECT/CT camera equipped with a high-resolution collimator and diagnostic CT one hour after injection. In the sagittal (A), coronal (B) and horizontal (C) planes, we can see that the 99mTc activity is restricted to the eye. (D) In the transversal plane of the torax, we can note the absence of activity in other organs. (E)

99m

Tc signal combined with CT

image. (F-I) BMMCs were labeled with CellTrace prior to transplantation and analyzed by flow cytometry. Images show representative dotplots and the mean ± SEM of 3 distinct experiments. (F) CellTrace+ BMMCs before injection were 99.7%. (G) Retina and vitreous of an uninjured and non-injected eye had no CellTrace+ cells (0.00%). (H-I) CellTrace+ cells 1 day after injection in the injured eye were 1.3 ± 0.66% (H) and dramatically reduced to 0.14 ± 0.1% after 3 days (I).



͵ͺ

Figure 6. The transplanted cells do not remain in the eye for a long period of time (A-D) Cells were labeled with FeraTrackTM for 3h, fixed and immunostained with antidextran antibody to identify dextran coated particles (A, red). (B) nuclei stained with TOPRO-3 (green). (C) Bright field. (D) Merged imaged of (A) and (B). (E) One day after nerve injury and BMMC injection, these cells are found in the vitreous body as dextranpositive cells (red). Nuclei were stained with TOPRO-3 (green). (F) Detection of FeraTrack-labeled BMMCs by in vivo MRI. BMMCs were labeled with FeraTrackTM and injected in the vitreous body of the left eye after optic nerve crush. In the Figure, we can see representative images of coronal, horizontal and sagittal planes at different survival times. Arrows indicate hypointense (black) spots corresponding to FeraTrack-labeled cells in the vitreous body of the left eye. We can see that 14 days after the injection only a few cells remain in the eye. Scale bar: 50m (A-D) and 250m (E).

Figure 7. A second BMMC injection does not prolong RGC survival. Attempting to increase RGC survival in a long term, we performed a second BMMC transplantation 7 days after the first one. The untreated group received two saline injections in the same time points. (A-B) Confocal projection images of flat-mounted retinas labeled with Tuj1 antibody 28 days after optic nerve crush and two saline (A) or BMMC (B) injections. We can note that there is a reduction in the number of surviving RGC both in the untreated (A) and the treated group (B). (C) Quantification of the ganglion cell survival 28 days after the crush. (D) Quantification of the axonal outgrowth (GAP-43+ axons) 28 days after the crush. Scale bar: 50m.



͵ͻ

Figure 8. A second BMMC injection does not prolong the persistence of the transplanted cells in the host eye. Detection of FeraTrack-labeled BMMCs by in vivo MRI. In the Figure, we can see representative images of coronal, horizontal and sagittal (ipsilateral to the injury) planes at different survival times. Arrows indicate hypointense (black) spots corresponding to FeraTrack-labeled cells in the vitreous body of the left eye.

Highlights x

BMMCs transplantation increases axonal outgrowth 28 days after optic nerve crush;

x

28 days after injury, there was no increase in neuronal survival after treatment;

x

FGF-2 levels were increased 1 day after crush and treatment but not after 28 days;

x

BMMCs have a short-term persistence in the eye;

x

A second injection of BMMCs does not increase their persistence or RGC survival.





ͶͲ

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

Figure 8