- Email: [email protected]
Synthesis and secretion of transferrin by isolated ciliary epithelium of rabbit
BBRC Biochemical and Biophysical Research Communications 305 (2003) 820–825 www.elsevier.com/locate/ybbrc
Synthesis and secretion of transferrin by isolated ciliary epithelium of rabbit Rubens Bertazolli-Filho, Eduardo Miguel Laicine,* and Antonio Haddad Departamento de Biologia Celular e Molecular e Bioagentes Patog^ enicos, Faculdade de Medicina de Ribeir~ ao Preto, USP, 14049-900 Ribeir~ ao Preto, SP, Brazil Received 21 April 2003
Abstract It has been shown that the vitreous contains several intrinsic glycoproteins whose origin remains to be clarified. Isolated ciliary epithelium (CE) was assayed to verify its role in the synthesis and secretion of transferrin for the vitreous body. It was cultured in the presence of [35 S]methionine and the incubation medium was processed for immunoprecipitation. Total RNA from CE was processed for RT-PCR and the amplification products were sequenced. Also, whole preparations of isolated CE were processed for immunolocalization of transferrin. From the incubation assays, a labeled peptide of about 80 kDa was immunopurified that is the expected size of transferrin. The RT-PCR and sequencing experiments detected the presence of transferrin mRNA. Both layers of the CE exhibited transferrin reactivity, following immunohistochemical processing. Taken altogether, these results indicate the CE as one of the possible sources of vitreous intrinsic transferrin. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Rabbit eye; Ciliary epithelium; Transferrin expression; Protein synthesis; Transferrin secretion; Vitreous body; Tissue culture; Immunohistochemistry
The vitreous, a gel-like matrix that occupies the posterior cavity of the mammalian eye, contains soluble proteins and glycoproteins, such as albumin and transferrin, which have been assumed to originate from the plasma [1]. However, several studies indicated that most of the soluble vitreous proteins, with the exception of albumin, are produced within the eye [2–4]. Transferrin, an 80 kDa metalloprotein which is the major iron transporter glycoprotein of the plasma [5], was identified as one of the most abundant intrinsic glycoproteins of the vitreous body [6]. The main source of transferrin of the body is the liver, but there are many extra-hepatic sources particularly in tissues and organ sites, like the eye and brain, where a blood–tissue barrier exists [7,8]. The ciliary body, especially its ciliary epithelium, has been assigned as a possible source of at least part of the vitreous transferrin [9,10]. Retina [11]
* Corresponding author. Fax: +55-16-633-1786. E-mail address: [email protected] (E.M. Laicine).
and lens [12] are also claimed as putative sources of this glycoprotein. The ciliary epithelium is a double-layer of polarized neuroepithelial cells [13], a boundary between the ciliary body stroma and the aqueous humor, inside the posterior chamber of the eye. It is composed of an inner non-pigmented cell layer (NPE), which faces the aqueous humor and an outer pigmented one (PE), in contact with the stroma of the ciliary body. The primary function of the ciliary epithelium is to produce the aqueous humor [14]. Also, it has been implicated as a source of neuropeptides like neurotensin [15] and galanin [16], as well as proteases and anti-proteases [17], among other peptides [18]. Most of these studies were carried out using explants of whole ciliary body or cell lines derived from the epithelial layers. In the present report, isolated ciliary epithelium [19,20] was used to examine its potential to synthesize and secrete transferrin, employing a tissue culture approach used in similar studies with whole explants of ciliary body [9].
0006-291X/03/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0006-291X(03)00825-8
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
Materials and methods Isolation of ciliary epithelium. All rabbits (Orictolagus cuniculus), obtained from local facilities, were handled according to the ARVO statement for the Use of Animal in Ophthalmic and Vision Research. The data from each experimental section presented in this report resulted from at least three independent experiments. Male albino rabbits, weighing about 2 kg, were deeply anesthetized with an intravenous injection of sodium thiopental, and decapitated to facilitate enucleation of the eyes. Then the ciliary bodies were isolated as follows: enucleated eyes, released from surrounding tissues and washed in ice-cold PBS (137 mM NaCl, 2 mM KCl, 0.9 mM CaCl2 , 1.54 mM MgCl2 , 6.5 mM Na2 HPO4 , 1.47 mM KH2 PO4 , pH 7.2), were cut by a frontal section that separated the anterior portions. These were freed of vitreous and the ciliary bodies were excised with aid of ophthalmic spatula. The isolation of the ciliary epithelium was made as described [19,20], with modifications. In short, isolated ciliary bodies were incubated in 5 ml of Hepes–Ringer (115 mM NaCl, 5.6 mM KCl, 38.0 mM Hepes, 1.0 mM glucose, and 0.5 mM EDTA, pH 7.2) during 1 h, with three changes of this solution. At the end of incubation, the ciliary epithelium was detached using an ophthalmic spatula, which was inserted between the stroma and the epithelium. The isolated epithelium was processed as described ahead. Tissue culture procedure. Ciliary epithelia obtained from two eyes were accommodated over the polycarbonate membrane of the basket of a Transwell plate (Costar). The basket was adjusted inside one of the 6 wells filled with 1 ml of methionine-free DMEM, containing 25 lCi of [35 S]methionine (Amersham, >800 Ci/mmol). The incubations were carried out during 21 h, the media recovered, pre-cleared by centrifugation at 16,000g during 10 min at 4 °C, and used for immunoprecipitation. Portions of ciliary epithelium were washed several times in PBS and processed either for morphological observation and immunohistochemistry or biochemical and molecular studies. Morphological analysis. Fragments of fresh isolated ciliary epithelium were fixed in 4% formaldehyde, refixed in osmium tetroxide, both dissolved in 0.1 M SorensenÕs buffer, pH 7.2, and routinely processed for Epon embedding. Semi-thin sections were stained with either toluidine blue or iron hematoxylin [21]. They were examined in an Axiophot (Zeiss) microscope and the images were captured with the CCD-IRIS camera (Sony) and digitalized (Snappy 3.0, Play). Immunohistochemistry. Isolated ciliary epithelia, fresh or after incubation, were fixed in 10% formalin in 0.1 M SorensenÕs buffer, pH 7.2, during 24 h at 4 °C. They were washed several times in TTBS (50 mM Tris, pH 7.2, 0.1% Triton X-100), blocked in 2% BSA in TTBS, and incubated with goat anti-rabbit transferrin antibody (Cappel), diluted 1:200 in the blocking buffer, during 2 h at room temperature. The specimens were rinsed in TTBS and incubated during 1 h at room temperature with either rhodamine- or fluorescein-conjugated anti-goat IgG, diluted 1:200. After washing in TTBS and whole mounted in Fluoromount medium (Southern Biotechnology Associated), the specimens were analyzed by confocal microscopy using a Leica TCS NT system coupled to an inverted DM IRBE Leica microscope. The images were obtained by means of a Tektronix Phaser 450 printer. Reverse transcription-polymerase chain reaction assays. Total RNA was isolated from the ciliary epithelia using Trizol (Gibco), according to
821
the manufacturerÕs instructions. To avoid contamination with genomic DNA in the RT preparation, RNA samples were pre-treated with DNase (Promega) before RT, as suggested by the manufacturer. The synthesis of the first complementary DNA strand (RT) was performed with 5 lg of total RNA of each source, using the SuperScript kit (Gibco). The oligonucleotide sets of primers used in PCR amplification and sequencing were synthesized at facilities in the Ribeir~ao Preto School of Medicine. All the sets of primers were designed to span at least one intron, which allow to identify a possible genomic contamination. Primers were chosen based on the published transferrin cDNA nucleotide sequence [22] and were selected using the program DNASTAR (DNASTAR, Inc.), as shown in Table 1. The amplification of the cDNA by PCR was performed using 5 ll of the products from RT, 25 pmol of each primer, 5 ll of reaction buffer, 1 mM of dNTP mixture, and 0.5 ll of Taq polymerase (Gibco, 2.5 U/ll) to a final volume of 50 ll. It was used as the thermal cycler HYBAID (Omnigene) was used, with temperature profiles as follows: initial melting at 94 °C for 2 min, then 32 cycles of 1 min melting at 94 °C, 1 min annealing at 55/59 °C (see Table 1), and 1 min extension at 72 °C. After the last cycle, the polymerization was extended by 10 min, when the chains were completed. The products of amplification (10 ll) were analyzed in 1.2% agarose gels and the positive bands were gel purified, using the kit GFX (Pharmacia). Nucleotide sequencing. The DNA products from PCR were sequenced on both strands in an automated DNA sequencer ABI PRISM 377 Genetic Analyzer, using the BigDye Rhodamine Terminator Cycle sequencing kit (PE Applied Biosystems). Immunoprecipitation and SDS–PAGE. The culture media obtained after the incubations of isolated ciliary epithelium were used for immunoprecipitation employing goat anti-rabbit transferrin antibody (Cappel) plus protein A bound to Sepharose CL4B, as previously described [23]. The immunoprecipitated samples were processed for SDS–PAGE [24] plus fluorography [25], using 10% gels. After electrophoresis, the gels were stained with Coomassie brilliant blue R-250, photographed, impregnated with Amplify (Amersham), dried under vacuum, and exposed against X-OMAT-AR5 film (Kodak), at )80 °C, during different periods of time.
Results Histological analysis of isolated ciliary epithelium The morphological integrity of the isolated ciliary epithelium was evaluated by microscopic examination of semi-thin sections (0.75 lm) of samples obtained before incubation. Fig. 1 is a sample of ciliary epithelium that showed good preservation of the morphology of epithelial cells with clear maintenance of their polarities. The cells of the outer PE layer showed their characteristic cuboidal-shape arrangement (arrow), while those from the NPE inner layer exhibited an also characteristic columnar-shape aspect. The absence of other cell types observed in all the preparations was an important finding to validate the purity of the tissue sample.
Table 1 Transferrin cDNA primers 0
0
Product length (bp)
Annealing temperature (°C)
GenBank
Set one
Upper: 17-mer 5 tcgccaccacccctgag 3 1–17 (exon 1) Lower: 17-mer 50 ggcgtccgcttcgtgtg 30 255–239 (exon 3)
255
59
X58533
Set two
Upper: 22-mer 50 tgacataaactggaacaacctg 30 1385–1407 (exon 12) Lower: 21-mer 50 tttaatgtttgtggaaagtgc 30 2110–2089 (exon 17)
725
55
X58533
822
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
Fig. 1. Semi-thin section of an Epon embedded isolated ciliary epithelium. The arrow points the pigmented outer epithelial cell layer. The asterisk indicates the ciliary zonule. There is good preservation of the epithelium and absence of other additional cell types in the sample. Staining with iron hematoxilin. Bar ¼ 10 lm.
Expression of transferrin mRNA in fresh and postincubation ciliary epithelium The RT-PCR assay was employed to detect the expression of transferrin mRNA in isolated ciliary epithelium. The primers used covered both the 50 region of the message—set one, spanning exon one to three—and the 30 region—set two, spanning exon 12 to exon 17. Therefore, the primers from the set one covered the segment corresponding to the signal peptide and a small portion of the mature transferrin peptide, while set two covered the C-terminal segment of the transferrin peptide. Fig. 2 shows the fragments obtained as amplification products using set one (A, 255 bp) and set two primers (B, 725 bp). They had the expected sizes and the analysis of their sequences indicated identity with the transferrin mRNA sequence already published [22]. These results demonstrated that the cells of isolated ciliary epithelium are able to express transferrin mRNA even after 21 h of incubation.
Fig. 2. Agarose gel electrophoresis of the RT-PCR products obtained using total RNA from ciliary epithelia. (A) DNA fragments obtained after the use of the transferrin primers from set I (Table 1): (1) negative control; (2) liver; (3) fresh ciliary epithelium; and (4) incubated ciliary epithelium. (B) DNA fragments obtained after the use of the transferrin primers from set two (Table 1): (1) negative control; (2) fresh ciliary epithelium; and (3) incubated ciliary epithelium, 1.2% agarose gels. MW, molecular weight markers (1 kb Dna Ladder Plus, Gibco). The size of the DNA amplified products is indicated at right. All the amplified bands were gel purified and sequenced.
Immunoprecipitation assays The culture media that resulted from the incubations of isolated ciliary epithelium in the presence of radioactive methionine were processed for immunoprecipitation with specific antibody against rabbit transferrin in order to detect transferrin as secretory product of the ciliary epithelial cells. Fig. 3 exhibits a representative result of such experiments. The fluorography of the SDS–PAGE gels obtained after the processing of the immunoprecipitates
Fig. 3. Labeled fractions present in extracts of incubation medium obtained after cultivation of isolated ciliary epithelium. Immunoprecipitation was carried out following incubation of explants during 21 h in DMEM containing 25 lCi of [35 S]methionine, using anti-transferrin antibody plus protein A bound to Sepharose CL4B. The resulting immunoprecipitated sample was submitted to SDS–PAGE (10% gels) plus fluorography. The arrow indicates the transferrin band. Molecular weight markers at left. Exposure time: 15 days.
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
Fig. 4. Cellular distribution of transferrin. In totum preparation of isolated ciliary epithelium, before (A) and after incubation (B). The positive reaction is visible in both layers. In (A), the reaction is more intense in the inner NPE layer (arrow). In (B), the reaction is more homogenous on both cell layers. The (B) is an optical slice with 0.5 lm. The secondary antibody was FITC-bound in (A) and TRITC-bound in (B). Bars ¼ 20 lm.
always revealed a labeled band of about 80 kDa, which corresponds to the expected size of transferrin (arrow). Immunohistochemistry of in totum preparations of isolated ciliary epithelia An indirect immunofluorescence assay using confocal microscopy demonstrated the distribution of transferrin on cells of the isolated ciliary epithelium. Fig. 4A is a sample of freshly isolated ciliary epithelium. Cells from both layers were reactive to the anti-transferrin antibody, particularly the inner nonpigmented one (arrow). It is possible to note the good preservation of the epithelium that kept the polarity and shape of the cells. Fig. 4B illustrates the confocal image of a whole preparation of isolated ciliary epithelium processed for immunocytochemistry after 21 h of incubation. Both layers are labeled although the shape of the cells presented some degree of alteration: the nuclei of the inner and outer layers exhibited globular aspect.
Discussion Since the existence of an intrinsic ocular transferrin was demonstrated [6], few works examined the problem
823
of its origin in the eye. Expression of transferrin mRNA in whole retina has been reported [11] with the suggestion that the transferrin there synthesized would be involved in iron transport through the blood–retinal barrier. However, no evidence of secretion to the vitreous had been presented. Another group [12] described synthesis and secretion of transferrin by lens epithelial cells in vitro and the presence of transferrin mRNA in cultured cells from ciliary epithelia. Remarkably, when the ciliary epithelial cells (PE and NPE) were cultured separately, the transferrin mRNA was detected in Northern blot analysis, but both cell lines were not able to secrete transferrin to the culture media, as assayed by ELISA. Since the CE is a highly polarized and specialized epithelium, the disruption of both layers could lead to a phenotype alteration, changing the protein secretion profile of the CE. Evidence of expression and secretion of transferrin by whole ciliary body in vitro was obtained by our group [10]. Nevertheless, even considering that the immunohistochemical data pointed to the CE as the site of transferrin secretion in ciliary body, the methodology employed was not able to assure it fully. Regarding the rabbit retina, several experiments in our laboratory have detected synthesis and secretion of transferrin in vitro in explants of this eye component, but they did not indicate that neural retina could contribute to the vitreous transferrin pool [26]. It is likely that the vascular portion of the retina, which in rabbits is rich in astrocytes [27,28], does so. Isolated CE has been used successfully in different assays [19,20] and it has been considered to be a reliable approach in accessing the ciliary epithelium functions. In the present report, it was used to carry out a molecular and biochemical analysis upon the capability of this structure to synthesize and secrete transferrin in vitro. The use of the isolated CE avoids the participation of other structures present in explants of ciliary body such as the stroma, which contains plasma-derived proteins due to the high permeability of its blood vessels. In these experiments, it was possible to demonstrate the presence of transferrin mRNA in the isolated CE cells by RTPCR analysis, and detect, by immunopurification, labeled transferrin in the culture media after incubation of explants in the presence of [35 S]methionine. Thus, the main conclusion obtained in this work was that the ciliary epithelium is one of the sources of the vitreous intrinsic transferrin. It also showed that the preservation of the CE structure is probably critical to conserve its secretory capability, at least regarding transferrin, in view of the results obtained with culture of its isolated cells [12]. The absence of secretion under these conditions could be explained by a mechanism which leads to the generation of an alternative transferrin mRNA, probably through an alternative splicing.
824
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
This phenomenon, previously described for transferrin mRNA in a human oligodendrocyte cell line [29], could also explain other unexpected results. For example, no transferrin secretion was observed after injecting into frog oocytes samples of human fetal RNA from the central nervous system, which, not withstanding, was able to trigger synthesis of transferrin in the oocytes [30]. Even so, the molecular mechanisms that would explain the existence of an intracellular non-secreted transferrin [12,30] remain to be clarified. With regard to the role for an intrinsic vitreous transferrin, it is known that the presence of free iron and other transition metals are particularly dangerous for the vitreous integrity, increasing the free radicals production. The intravitreal injection of iron [31] and copper [32] leads to a liquefaction of the vitreous, impairing its proper functions. Since the secreted ocular transferrin is an apotransferrin form, that is, a transferrin devoid of iron, it could act inside the eye, at least in normal conditions, as a free metal chelator, avoiding the generation of increased amount of free radicals. In fact, it was reported that apotransferrin decreases the ocular inflammatory response [33] and that the release of hemoglobin (a source of iron) inside the eye intensifies the ocular inflammatory response to endotoxin [34]. In addition, transferrin inhibits the vitreous liquefaction due to Maillard reaction products that generate free radicals [35].
Acknowledgments This work was supported by Fundacßa~o de Amparo a Pesquisa do Estado de S~ ao Paulo (R.B.-F. and E.M.L.) and Conselho Nacional de Desenvolvimento Cientıfico e Tecnol ogico (A.H.). Gratitude is expressed to Vani M.A. Correa and Maria D. Seabra for their technical help.
References [1] D.A. Swann, Biochemistry of the vitreous, Bull. Soc. Belge Ophtalmol. 223 (1987) 59–72. [2] A. Haddad, J.C. de Almeida, E.M. Laicine, R.S. Fife, G. Pelletier, The origin of the intrinsic glycoproteins of the rabbit vitreous body: an immunohistochemical and autoradiographic study, Exp. Eye Res. 50 (1990) 555–561. [3] A. Haddad, E.M. Laicine, J.C. de Almeida, M.S. Costa, Partial characterization, origin and turnover of glycoproteins of the rabbit vitreous body, Exp. Eye Res. 51 (1990) 139–143. [4] A. Haddad, E.M. Laicine, Studies on the origin of the glycoproteins of the rabbit vitreous body using a protein-synthesis inhibitor and radioactive fucose and amino acids, Ger. J. Ophthalmol. 2 (1993) 127–132. [5] G. de Jong, J.P. van Dijk, H.G. van Eijk, The biology of transferring, Clin. Chim. Acta 190 (1990) 1–46. [6] E.M. Laicine, A. Haddad, Transferrin, one of the major vitreous proteins, is produced within the eye, Exp. Eye Res. 59 (1994) 441– 445.
[7] J.G. Cunha-Vaz, The blood–ocular barriers: past, present, and future, Doc. Ophthalmol. 93 (1997) 149–157. [8] K. Takata, H. Hirano, M. Kasahara, Transport of glucose across the blood–tissue barriers, Int. Rev. Cytol. 172 (1997) 1– 53. [9] R. Bertazolli-Filho, E.M. Laicine, A. Haddad, Biochemical studies on the secretion of glycoproteins by isolated ciliary body of rabbits, Acta Ophthalmol. Scand. 74 (1996) 343– 347. [10] M.L.P. Rodrigues, R. Bertazolli-Filho, E.M. Laicine, A. Haddad, Transferrin production by the ciliary body of rabbits: a biochemical and immunocytochemical study, Curr. Eye Res. 17 (1998) 694–699. [11] A.A. Davis, R.C. Hunt, Transferrin is made and bound by photoreceptor cells, J. Cell Physiol. 156 (1993) 280–285. [12] M.C. McGahan, J. Harned, M. Goralska, B. Sherry, L.N. Fleisher, Transferrin secretion by lens epithelial cells in culture, Exp. Eye Res. 60 (1995) 667–673. [13] L.J. Rizzolo, Polarization of the Naþ , K(+)–ATPase in epithelia derived from the neuroepithelium, Int. Rev. Cytol. 185 (1999) 195–235. [14] T. Krupin, M. Wax, J. Moolchandani, Aqueous production, Trans. Ophthalmol. Soc. UK 105 (1986) 156–161. [15] J. Ortego, M. Coca-Prados, Molecular characterization and differential gene induction of the neuroendocrine specific genes neurotensin, neurotensin receptor, PC1, PC2 and 7b2 in the human ciliary body epithelium, J. Neurochem. 69 (1997) 1829– 1839. [16] J. Ortego, M. Coca-Prados, Molecular identification and coexpression of galanin and GalR-1 galanin receptor in the human ocular ciliary epithelium: differential modulation of their expression by the activation of a2- and b2-adrenergic receptors in cultured ciliary epithelial cells, J. Neurochem. 71 (1998) 2260– 2270. [17] J. Ortego, J. Escribano, M. Coca-Prados, Gene expression of proteases and protease inhibitors in the human ciliary epithelium and ODM-2 cells, Exp. Eye Res. 65 (1997) 289–299. [18] M. Coca-Prados, J. Escribano, J. Ortego, Differential gene expression in the human ciliary epithelium, Prog. Retin. Eye Res. 18 (1999) 403–429. [19] M.M. Jumblatt, B. Raphael, J.E. Jumblatt, A simple method for the isolation of ciliary epithelium, Exp. Eye Res. 52 (1991) 229– 232. [20] J.M. Wolosin, M. Chen, R.E. Gordon, Z. Stegman, G.A. Butler, Separation of the rabbit ciliary body epithelial layers in viable form: identification of differences in bicarbonate transport, Exp. Eye Res. 56 (1993) 401–409. [21] A. Schantz, A. Schecter, Iron–hematoxylin and safranin O as a polychrome stain for epon sections, Stain Technol. 40 (1965) 279– 282. [22] D.K. Banfield, B.K. Chow, W.D. Funk, K.A. Robertson, T.M. Umelas, R.C. Woodworth, R.T. MacGillivray, The nucleotide sequence of rabbit liver transferrin cDNA, Biochim. Biophys. Acta 1089 (1991) 262–265. [23] I.M. Rosenberg, Protein Analysis and Purification: Benchtop Techniques, Birkh€auser, Boston, 1996. [24] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [25] J.H. Waterborg, H.R. Matthews, Fluorography of polyacrylamide gels containing tritium, in: J.M. Walker (Ed.), Methods in Molecular Biology vol. 1: Proteins, Humana Press, Clifton, NJ, 1984, pp. 147–152. [26] M.L.P. Rodrigues, R. Bertazolli-Filho, E.M. Laicine, A. Haddad, The neural retina synthesizes but does not secrete transferrin, Annals of the XXX Congress of the SBBq-Brazilian Society of Biochemistry and Molecular Biology (2001) 18.
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825 [27] K.R. Zahs, V. Bigornia, C.F. Deschepper, Characterization of ‘‘plasma proteins’’ secreted by cultured rat macroglial cells, Glia 7 (1993) 121–133. [28] A. Haddad, J.J. Salazar, E.M. Laicine, J.M. Ramirez, A. Trivi~ no, A direct contact between astrocyte and vitreous body is possible in the rabbit eye due to discontinuities in the basement membrane of the retinal inner limiting membrane, Braz. J. Med. Biol. Res. 36 (2003) 207–211. [29] G.A. de Arriba Zerpa, M.-C. Saleh, P.M. Fernandez, F. Guillou, A. Espinosa de los Monteros, J. Vellis, M.M. Zakin, B. Baron, Alternative splicing prevents transferrin secretion during differentiation of a human oligodendrocyte cell line, J. Neurosci. Res. 61 (2000) 388–395. [30] K. Mollgard, K.M. Dziegielewska, N.R. Saunders, H. Zakut, H. Soreq, Synthesis and localization of plasma proteins in the developing human brain. Integrity of the fetal blood–brain barrier
[31] [32]
[33] [34]
[35]
825
to endogenous proteins of hepatic origin, Dev. Biol. 128 (1988) 207–221. Y.N. Hui, N. Sorgente, S.J. Ryan, Liquefaction of rabbit vitreous by ferrous ions, Curr. Eye Res. 7 (1988) 655–660. J. Akiba, N. Yanagiya, A. Kakehashi, T. Hikichi, M. Kado, A. Yoshida, N. Ueno, Copper-ion-catalyzed vitreous liquefaction in vivo, Ophthalmic Res. 29 (1997) 37–41. M.C. McGahan, A.M. Grimes, L.N. Fleisher, Transferrin inhibits the ocular inflammatory response, Exp. Eye Res. 58 (1994) 509–511. M.C. McGahan, A.M. Grimes, L.N. Fleisher, Hemoglobin exacerbates the ocular inflammatory response to endotoxin, Graefes Arch. Clin. Exp. Ophthalmol. 234 (1996) 643–647. V. Deguine, M. Menasche, P. Ferrari, L. Fraisse, Y. Pouliquen, L. Robert, Free radical depolymerization of hyaluronan by Maillard reaction products: role in liquefaction of aging vitreous, Int. J. Biol. Macromol. 22 (1998) 17–22.
Synthesis and secretion of transferrin by isolated ciliary epithelium of rabbit Rubens Bertazolli-Filho, Eduardo Miguel Laicine,* and Antonio Haddad Departamento de Biologia Celular e Molecular e Bioagentes Patog^ enicos, Faculdade de Medicina de Ribeir~ ao Preto, USP, 14049-900 Ribeir~ ao Preto, SP, Brazil Received 21 April 2003
Abstract It has been shown that the vitreous contains several intrinsic glycoproteins whose origin remains to be clarified. Isolated ciliary epithelium (CE) was assayed to verify its role in the synthesis and secretion of transferrin for the vitreous body. It was cultured in the presence of [35 S]methionine and the incubation medium was processed for immunoprecipitation. Total RNA from CE was processed for RT-PCR and the amplification products were sequenced. Also, whole preparations of isolated CE were processed for immunolocalization of transferrin. From the incubation assays, a labeled peptide of about 80 kDa was immunopurified that is the expected size of transferrin. The RT-PCR and sequencing experiments detected the presence of transferrin mRNA. Both layers of the CE exhibited transferrin reactivity, following immunohistochemical processing. Taken altogether, these results indicate the CE as one of the possible sources of vitreous intrinsic transferrin. Ó 2003 Elsevier Science (USA). All rights reserved. Keywords: Rabbit eye; Ciliary epithelium; Transferrin expression; Protein synthesis; Transferrin secretion; Vitreous body; Tissue culture; Immunohistochemistry
The vitreous, a gel-like matrix that occupies the posterior cavity of the mammalian eye, contains soluble proteins and glycoproteins, such as albumin and transferrin, which have been assumed to originate from the plasma [1]. However, several studies indicated that most of the soluble vitreous proteins, with the exception of albumin, are produced within the eye [2–4]. Transferrin, an 80 kDa metalloprotein which is the major iron transporter glycoprotein of the plasma [5], was identified as one of the most abundant intrinsic glycoproteins of the vitreous body [6]. The main source of transferrin of the body is the liver, but there are many extra-hepatic sources particularly in tissues and organ sites, like the eye and brain, where a blood–tissue barrier exists [7,8]. The ciliary body, especially its ciliary epithelium, has been assigned as a possible source of at least part of the vitreous transferrin [9,10]. Retina [11]
* Corresponding author. Fax: +55-16-633-1786. E-mail address: [email protected] (E.M. Laicine).
and lens [12] are also claimed as putative sources of this glycoprotein. The ciliary epithelium is a double-layer of polarized neuroepithelial cells [13], a boundary between the ciliary body stroma and the aqueous humor, inside the posterior chamber of the eye. It is composed of an inner non-pigmented cell layer (NPE), which faces the aqueous humor and an outer pigmented one (PE), in contact with the stroma of the ciliary body. The primary function of the ciliary epithelium is to produce the aqueous humor [14]. Also, it has been implicated as a source of neuropeptides like neurotensin [15] and galanin [16], as well as proteases and anti-proteases [17], among other peptides [18]. Most of these studies were carried out using explants of whole ciliary body or cell lines derived from the epithelial layers. In the present report, isolated ciliary epithelium [19,20] was used to examine its potential to synthesize and secrete transferrin, employing a tissue culture approach used in similar studies with whole explants of ciliary body [9].
0006-291X/03/$ - see front matter Ó 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0006-291X(03)00825-8
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
Materials and methods Isolation of ciliary epithelium. All rabbits (Orictolagus cuniculus), obtained from local facilities, were handled according to the ARVO statement for the Use of Animal in Ophthalmic and Vision Research. The data from each experimental section presented in this report resulted from at least three independent experiments. Male albino rabbits, weighing about 2 kg, were deeply anesthetized with an intravenous injection of sodium thiopental, and decapitated to facilitate enucleation of the eyes. Then the ciliary bodies were isolated as follows: enucleated eyes, released from surrounding tissues and washed in ice-cold PBS (137 mM NaCl, 2 mM KCl, 0.9 mM CaCl2 , 1.54 mM MgCl2 , 6.5 mM Na2 HPO4 , 1.47 mM KH2 PO4 , pH 7.2), were cut by a frontal section that separated the anterior portions. These were freed of vitreous and the ciliary bodies were excised with aid of ophthalmic spatula. The isolation of the ciliary epithelium was made as described [19,20], with modifications. In short, isolated ciliary bodies were incubated in 5 ml of Hepes–Ringer (115 mM NaCl, 5.6 mM KCl, 38.0 mM Hepes, 1.0 mM glucose, and 0.5 mM EDTA, pH 7.2) during 1 h, with three changes of this solution. At the end of incubation, the ciliary epithelium was detached using an ophthalmic spatula, which was inserted between the stroma and the epithelium. The isolated epithelium was processed as described ahead. Tissue culture procedure. Ciliary epithelia obtained from two eyes were accommodated over the polycarbonate membrane of the basket of a Transwell plate (Costar). The basket was adjusted inside one of the 6 wells filled with 1 ml of methionine-free DMEM, containing 25 lCi of [35 S]methionine (Amersham, >800 Ci/mmol). The incubations were carried out during 21 h, the media recovered, pre-cleared by centrifugation at 16,000g during 10 min at 4 °C, and used for immunoprecipitation. Portions of ciliary epithelium were washed several times in PBS and processed either for morphological observation and immunohistochemistry or biochemical and molecular studies. Morphological analysis. Fragments of fresh isolated ciliary epithelium were fixed in 4% formaldehyde, refixed in osmium tetroxide, both dissolved in 0.1 M SorensenÕs buffer, pH 7.2, and routinely processed for Epon embedding. Semi-thin sections were stained with either toluidine blue or iron hematoxylin [21]. They were examined in an Axiophot (Zeiss) microscope and the images were captured with the CCD-IRIS camera (Sony) and digitalized (Snappy 3.0, Play). Immunohistochemistry. Isolated ciliary epithelia, fresh or after incubation, were fixed in 10% formalin in 0.1 M SorensenÕs buffer, pH 7.2, during 24 h at 4 °C. They were washed several times in TTBS (50 mM Tris, pH 7.2, 0.1% Triton X-100), blocked in 2% BSA in TTBS, and incubated with goat anti-rabbit transferrin antibody (Cappel), diluted 1:200 in the blocking buffer, during 2 h at room temperature. The specimens were rinsed in TTBS and incubated during 1 h at room temperature with either rhodamine- or fluorescein-conjugated anti-goat IgG, diluted 1:200. After washing in TTBS and whole mounted in Fluoromount medium (Southern Biotechnology Associated), the specimens were analyzed by confocal microscopy using a Leica TCS NT system coupled to an inverted DM IRBE Leica microscope. The images were obtained by means of a Tektronix Phaser 450 printer. Reverse transcription-polymerase chain reaction assays. Total RNA was isolated from the ciliary epithelia using Trizol (Gibco), according to
821
the manufacturerÕs instructions. To avoid contamination with genomic DNA in the RT preparation, RNA samples were pre-treated with DNase (Promega) before RT, as suggested by the manufacturer. The synthesis of the first complementary DNA strand (RT) was performed with 5 lg of total RNA of each source, using the SuperScript kit (Gibco). The oligonucleotide sets of primers used in PCR amplification and sequencing were synthesized at facilities in the Ribeir~ao Preto School of Medicine. All the sets of primers were designed to span at least one intron, which allow to identify a possible genomic contamination. Primers were chosen based on the published transferrin cDNA nucleotide sequence [22] and were selected using the program DNASTAR (DNASTAR, Inc.), as shown in Table 1. The amplification of the cDNA by PCR was performed using 5 ll of the products from RT, 25 pmol of each primer, 5 ll of reaction buffer, 1 mM of dNTP mixture, and 0.5 ll of Taq polymerase (Gibco, 2.5 U/ll) to a final volume of 50 ll. It was used as the thermal cycler HYBAID (Omnigene) was used, with temperature profiles as follows: initial melting at 94 °C for 2 min, then 32 cycles of 1 min melting at 94 °C, 1 min annealing at 55/59 °C (see Table 1), and 1 min extension at 72 °C. After the last cycle, the polymerization was extended by 10 min, when the chains were completed. The products of amplification (10 ll) were analyzed in 1.2% agarose gels and the positive bands were gel purified, using the kit GFX (Pharmacia). Nucleotide sequencing. The DNA products from PCR were sequenced on both strands in an automated DNA sequencer ABI PRISM 377 Genetic Analyzer, using the BigDye Rhodamine Terminator Cycle sequencing kit (PE Applied Biosystems). Immunoprecipitation and SDS–PAGE. The culture media obtained after the incubations of isolated ciliary epithelium were used for immunoprecipitation employing goat anti-rabbit transferrin antibody (Cappel) plus protein A bound to Sepharose CL4B, as previously described [23]. The immunoprecipitated samples were processed for SDS–PAGE [24] plus fluorography [25], using 10% gels. After electrophoresis, the gels were stained with Coomassie brilliant blue R-250, photographed, impregnated with Amplify (Amersham), dried under vacuum, and exposed against X-OMAT-AR5 film (Kodak), at )80 °C, during different periods of time.
Results Histological analysis of isolated ciliary epithelium The morphological integrity of the isolated ciliary epithelium was evaluated by microscopic examination of semi-thin sections (0.75 lm) of samples obtained before incubation. Fig. 1 is a sample of ciliary epithelium that showed good preservation of the morphology of epithelial cells with clear maintenance of their polarities. The cells of the outer PE layer showed their characteristic cuboidal-shape arrangement (arrow), while those from the NPE inner layer exhibited an also characteristic columnar-shape aspect. The absence of other cell types observed in all the preparations was an important finding to validate the purity of the tissue sample.
Table 1 Transferrin cDNA primers 0
0
Product length (bp)
Annealing temperature (°C)
GenBank
Set one
Upper: 17-mer 5 tcgccaccacccctgag 3 1–17 (exon 1) Lower: 17-mer 50 ggcgtccgcttcgtgtg 30 255–239 (exon 3)
255
59
X58533
Set two
Upper: 22-mer 50 tgacataaactggaacaacctg 30 1385–1407 (exon 12) Lower: 21-mer 50 tttaatgtttgtggaaagtgc 30 2110–2089 (exon 17)
725
55
X58533
822
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
Fig. 1. Semi-thin section of an Epon embedded isolated ciliary epithelium. The arrow points the pigmented outer epithelial cell layer. The asterisk indicates the ciliary zonule. There is good preservation of the epithelium and absence of other additional cell types in the sample. Staining with iron hematoxilin. Bar ¼ 10 lm.
Expression of transferrin mRNA in fresh and postincubation ciliary epithelium The RT-PCR assay was employed to detect the expression of transferrin mRNA in isolated ciliary epithelium. The primers used covered both the 50 region of the message—set one, spanning exon one to three—and the 30 region—set two, spanning exon 12 to exon 17. Therefore, the primers from the set one covered the segment corresponding to the signal peptide and a small portion of the mature transferrin peptide, while set two covered the C-terminal segment of the transferrin peptide. Fig. 2 shows the fragments obtained as amplification products using set one (A, 255 bp) and set two primers (B, 725 bp). They had the expected sizes and the analysis of their sequences indicated identity with the transferrin mRNA sequence already published [22]. These results demonstrated that the cells of isolated ciliary epithelium are able to express transferrin mRNA even after 21 h of incubation.
Fig. 2. Agarose gel electrophoresis of the RT-PCR products obtained using total RNA from ciliary epithelia. (A) DNA fragments obtained after the use of the transferrin primers from set I (Table 1): (1) negative control; (2) liver; (3) fresh ciliary epithelium; and (4) incubated ciliary epithelium. (B) DNA fragments obtained after the use of the transferrin primers from set two (Table 1): (1) negative control; (2) fresh ciliary epithelium; and (3) incubated ciliary epithelium, 1.2% agarose gels. MW, molecular weight markers (1 kb Dna Ladder Plus, Gibco). The size of the DNA amplified products is indicated at right. All the amplified bands were gel purified and sequenced.
Immunoprecipitation assays The culture media that resulted from the incubations of isolated ciliary epithelium in the presence of radioactive methionine were processed for immunoprecipitation with specific antibody against rabbit transferrin in order to detect transferrin as secretory product of the ciliary epithelial cells. Fig. 3 exhibits a representative result of such experiments. The fluorography of the SDS–PAGE gels obtained after the processing of the immunoprecipitates
Fig. 3. Labeled fractions present in extracts of incubation medium obtained after cultivation of isolated ciliary epithelium. Immunoprecipitation was carried out following incubation of explants during 21 h in DMEM containing 25 lCi of [35 S]methionine, using anti-transferrin antibody plus protein A bound to Sepharose CL4B. The resulting immunoprecipitated sample was submitted to SDS–PAGE (10% gels) plus fluorography. The arrow indicates the transferrin band. Molecular weight markers at left. Exposure time: 15 days.
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
Fig. 4. Cellular distribution of transferrin. In totum preparation of isolated ciliary epithelium, before (A) and after incubation (B). The positive reaction is visible in both layers. In (A), the reaction is more intense in the inner NPE layer (arrow). In (B), the reaction is more homogenous on both cell layers. The (B) is an optical slice with 0.5 lm. The secondary antibody was FITC-bound in (A) and TRITC-bound in (B). Bars ¼ 20 lm.
always revealed a labeled band of about 80 kDa, which corresponds to the expected size of transferrin (arrow). Immunohistochemistry of in totum preparations of isolated ciliary epithelia An indirect immunofluorescence assay using confocal microscopy demonstrated the distribution of transferrin on cells of the isolated ciliary epithelium. Fig. 4A is a sample of freshly isolated ciliary epithelium. Cells from both layers were reactive to the anti-transferrin antibody, particularly the inner nonpigmented one (arrow). It is possible to note the good preservation of the epithelium that kept the polarity and shape of the cells. Fig. 4B illustrates the confocal image of a whole preparation of isolated ciliary epithelium processed for immunocytochemistry after 21 h of incubation. Both layers are labeled although the shape of the cells presented some degree of alteration: the nuclei of the inner and outer layers exhibited globular aspect.
Discussion Since the existence of an intrinsic ocular transferrin was demonstrated [6], few works examined the problem
823
of its origin in the eye. Expression of transferrin mRNA in whole retina has been reported [11] with the suggestion that the transferrin there synthesized would be involved in iron transport through the blood–retinal barrier. However, no evidence of secretion to the vitreous had been presented. Another group [12] described synthesis and secretion of transferrin by lens epithelial cells in vitro and the presence of transferrin mRNA in cultured cells from ciliary epithelia. Remarkably, when the ciliary epithelial cells (PE and NPE) were cultured separately, the transferrin mRNA was detected in Northern blot analysis, but both cell lines were not able to secrete transferrin to the culture media, as assayed by ELISA. Since the CE is a highly polarized and specialized epithelium, the disruption of both layers could lead to a phenotype alteration, changing the protein secretion profile of the CE. Evidence of expression and secretion of transferrin by whole ciliary body in vitro was obtained by our group [10]. Nevertheless, even considering that the immunohistochemical data pointed to the CE as the site of transferrin secretion in ciliary body, the methodology employed was not able to assure it fully. Regarding the rabbit retina, several experiments in our laboratory have detected synthesis and secretion of transferrin in vitro in explants of this eye component, but they did not indicate that neural retina could contribute to the vitreous transferrin pool [26]. It is likely that the vascular portion of the retina, which in rabbits is rich in astrocytes [27,28], does so. Isolated CE has been used successfully in different assays [19,20] and it has been considered to be a reliable approach in accessing the ciliary epithelium functions. In the present report, it was used to carry out a molecular and biochemical analysis upon the capability of this structure to synthesize and secrete transferrin in vitro. The use of the isolated CE avoids the participation of other structures present in explants of ciliary body such as the stroma, which contains plasma-derived proteins due to the high permeability of its blood vessels. In these experiments, it was possible to demonstrate the presence of transferrin mRNA in the isolated CE cells by RTPCR analysis, and detect, by immunopurification, labeled transferrin in the culture media after incubation of explants in the presence of [35 S]methionine. Thus, the main conclusion obtained in this work was that the ciliary epithelium is one of the sources of the vitreous intrinsic transferrin. It also showed that the preservation of the CE structure is probably critical to conserve its secretory capability, at least regarding transferrin, in view of the results obtained with culture of its isolated cells [12]. The absence of secretion under these conditions could be explained by a mechanism which leads to the generation of an alternative transferrin mRNA, probably through an alternative splicing.
824
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825
This phenomenon, previously described for transferrin mRNA in a human oligodendrocyte cell line [29], could also explain other unexpected results. For example, no transferrin secretion was observed after injecting into frog oocytes samples of human fetal RNA from the central nervous system, which, not withstanding, was able to trigger synthesis of transferrin in the oocytes [30]. Even so, the molecular mechanisms that would explain the existence of an intracellular non-secreted transferrin [12,30] remain to be clarified. With regard to the role for an intrinsic vitreous transferrin, it is known that the presence of free iron and other transition metals are particularly dangerous for the vitreous integrity, increasing the free radicals production. The intravitreal injection of iron [31] and copper [32] leads to a liquefaction of the vitreous, impairing its proper functions. Since the secreted ocular transferrin is an apotransferrin form, that is, a transferrin devoid of iron, it could act inside the eye, at least in normal conditions, as a free metal chelator, avoiding the generation of increased amount of free radicals. In fact, it was reported that apotransferrin decreases the ocular inflammatory response [33] and that the release of hemoglobin (a source of iron) inside the eye intensifies the ocular inflammatory response to endotoxin [34]. In addition, transferrin inhibits the vitreous liquefaction due to Maillard reaction products that generate free radicals [35].
Acknowledgments This work was supported by Fundacßa~o de Amparo a Pesquisa do Estado de S~ ao Paulo (R.B.-F. and E.M.L.) and Conselho Nacional de Desenvolvimento Cientıfico e Tecnol ogico (A.H.). Gratitude is expressed to Vani M.A. Correa and Maria D. Seabra for their technical help.
References [1] D.A. Swann, Biochemistry of the vitreous, Bull. Soc. Belge Ophtalmol. 223 (1987) 59–72. [2] A. Haddad, J.C. de Almeida, E.M. Laicine, R.S. Fife, G. Pelletier, The origin of the intrinsic glycoproteins of the rabbit vitreous body: an immunohistochemical and autoradiographic study, Exp. Eye Res. 50 (1990) 555–561. [3] A. Haddad, E.M. Laicine, J.C. de Almeida, M.S. Costa, Partial characterization, origin and turnover of glycoproteins of the rabbit vitreous body, Exp. Eye Res. 51 (1990) 139–143. [4] A. Haddad, E.M. Laicine, Studies on the origin of the glycoproteins of the rabbit vitreous body using a protein-synthesis inhibitor and radioactive fucose and amino acids, Ger. J. Ophthalmol. 2 (1993) 127–132. [5] G. de Jong, J.P. van Dijk, H.G. van Eijk, The biology of transferring, Clin. Chim. Acta 190 (1990) 1–46. [6] E.M. Laicine, A. Haddad, Transferrin, one of the major vitreous proteins, is produced within the eye, Exp. Eye Res. 59 (1994) 441– 445.
[7] J.G. Cunha-Vaz, The blood–ocular barriers: past, present, and future, Doc. Ophthalmol. 93 (1997) 149–157. [8] K. Takata, H. Hirano, M. Kasahara, Transport of glucose across the blood–tissue barriers, Int. Rev. Cytol. 172 (1997) 1– 53. [9] R. Bertazolli-Filho, E.M. Laicine, A. Haddad, Biochemical studies on the secretion of glycoproteins by isolated ciliary body of rabbits, Acta Ophthalmol. Scand. 74 (1996) 343– 347. [10] M.L.P. Rodrigues, R. Bertazolli-Filho, E.M. Laicine, A. Haddad, Transferrin production by the ciliary body of rabbits: a biochemical and immunocytochemical study, Curr. Eye Res. 17 (1998) 694–699. [11] A.A. Davis, R.C. Hunt, Transferrin is made and bound by photoreceptor cells, J. Cell Physiol. 156 (1993) 280–285. [12] M.C. McGahan, J. Harned, M. Goralska, B. Sherry, L.N. Fleisher, Transferrin secretion by lens epithelial cells in culture, Exp. Eye Res. 60 (1995) 667–673. [13] L.J. Rizzolo, Polarization of the Naþ , K(+)–ATPase in epithelia derived from the neuroepithelium, Int. Rev. Cytol. 185 (1999) 195–235. [14] T. Krupin, M. Wax, J. Moolchandani, Aqueous production, Trans. Ophthalmol. Soc. UK 105 (1986) 156–161. [15] J. Ortego, M. Coca-Prados, Molecular characterization and differential gene induction of the neuroendocrine specific genes neurotensin, neurotensin receptor, PC1, PC2 and 7b2 in the human ciliary body epithelium, J. Neurochem. 69 (1997) 1829– 1839. [16] J. Ortego, M. Coca-Prados, Molecular identification and coexpression of galanin and GalR-1 galanin receptor in the human ocular ciliary epithelium: differential modulation of their expression by the activation of a2- and b2-adrenergic receptors in cultured ciliary epithelial cells, J. Neurochem. 71 (1998) 2260– 2270. [17] J. Ortego, J. Escribano, M. Coca-Prados, Gene expression of proteases and protease inhibitors in the human ciliary epithelium and ODM-2 cells, Exp. Eye Res. 65 (1997) 289–299. [18] M. Coca-Prados, J. Escribano, J. Ortego, Differential gene expression in the human ciliary epithelium, Prog. Retin. Eye Res. 18 (1999) 403–429. [19] M.M. Jumblatt, B. Raphael, J.E. Jumblatt, A simple method for the isolation of ciliary epithelium, Exp. Eye Res. 52 (1991) 229– 232. [20] J.M. Wolosin, M. Chen, R.E. Gordon, Z. Stegman, G.A. Butler, Separation of the rabbit ciliary body epithelial layers in viable form: identification of differences in bicarbonate transport, Exp. Eye Res. 56 (1993) 401–409. [21] A. Schantz, A. Schecter, Iron–hematoxylin and safranin O as a polychrome stain for epon sections, Stain Technol. 40 (1965) 279– 282. [22] D.K. Banfield, B.K. Chow, W.D. Funk, K.A. Robertson, T.M. Umelas, R.C. Woodworth, R.T. MacGillivray, The nucleotide sequence of rabbit liver transferrin cDNA, Biochim. Biophys. Acta 1089 (1991) 262–265. [23] I.M. Rosenberg, Protein Analysis and Purification: Benchtop Techniques, Birkh€auser, Boston, 1996. [24] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680–685. [25] J.H. Waterborg, H.R. Matthews, Fluorography of polyacrylamide gels containing tritium, in: J.M. Walker (Ed.), Methods in Molecular Biology vol. 1: Proteins, Humana Press, Clifton, NJ, 1984, pp. 147–152. [26] M.L.P. Rodrigues, R. Bertazolli-Filho, E.M. Laicine, A. Haddad, The neural retina synthesizes but does not secrete transferrin, Annals of the XXX Congress of the SBBq-Brazilian Society of Biochemistry and Molecular Biology (2001) 18.
R. Bertazolli-Filho et al. / Biochemical and Biophysical Research Communications 305 (2003) 820–825 [27] K.R. Zahs, V. Bigornia, C.F. Deschepper, Characterization of ‘‘plasma proteins’’ secreted by cultured rat macroglial cells, Glia 7 (1993) 121–133. [28] A. Haddad, J.J. Salazar, E.M. Laicine, J.M. Ramirez, A. Trivi~ no, A direct contact between astrocyte and vitreous body is possible in the rabbit eye due to discontinuities in the basement membrane of the retinal inner limiting membrane, Braz. J. Med. Biol. Res. 36 (2003) 207–211. [29] G.A. de Arriba Zerpa, M.-C. Saleh, P.M. Fernandez, F. Guillou, A. Espinosa de los Monteros, J. Vellis, M.M. Zakin, B. Baron, Alternative splicing prevents transferrin secretion during differentiation of a human oligodendrocyte cell line, J. Neurosci. Res. 61 (2000) 388–395. [30] K. Mollgard, K.M. Dziegielewska, N.R. Saunders, H. Zakut, H. Soreq, Synthesis and localization of plasma proteins in the developing human brain. Integrity of the fetal blood–brain barrier
[31] [32]
[33] [34]
[35]
825
to endogenous proteins of hepatic origin, Dev. Biol. 128 (1988) 207–221. Y.N. Hui, N. Sorgente, S.J. Ryan, Liquefaction of rabbit vitreous by ferrous ions, Curr. Eye Res. 7 (1988) 655–660. J. Akiba, N. Yanagiya, A. Kakehashi, T. Hikichi, M. Kado, A. Yoshida, N. Ueno, Copper-ion-catalyzed vitreous liquefaction in vivo, Ophthalmic Res. 29 (1997) 37–41. M.C. McGahan, A.M. Grimes, L.N. Fleisher, Transferrin inhibits the ocular inflammatory response, Exp. Eye Res. 58 (1994) 509–511. M.C. McGahan, A.M. Grimes, L.N. Fleisher, Hemoglobin exacerbates the ocular inflammatory response to endotoxin, Graefes Arch. Clin. Exp. Ophthalmol. 234 (1996) 643–647. V. Deguine, M. Menasche, P. Ferrari, L. Fraisse, Y. Pouliquen, L. Robert, Free radical depolymerization of hyaluronan by Maillard reaction products: role in liquefaction of aging vitreous, Int. J. Biol. Macromol. 22 (1998) 17–22.