Targeted silencing of TrkA expression in rat forebrain neurons via the p75 receptor

Neuroscience 153 (2008) 1115–1125

TARGETED SILENCING OF TrkA EXPRESSION IN RAT FOREBRAIN NEURONS VIA THE p75 RECEPTOR D. A. BERHANU* AND R. A. RUSH

fused controls or naive animals. We conclude that p75-receptor-mediated RNAi-induced silencing of genes offers a novel and powerful way to study the function of specific endogenous genes within distinct neuronal subpopulations of the brain. Crown Copyright © 2008 Published by Elsevier Ltd on behalf of IBRO. All rights reserved.

Department of Human Physiology and Centre for Neuroscience, Flinders University of South Australia, GPO Box 2100 Adelaide, SA 5001, Australia

Abstract—Basal forebrain neurons express the neurotrophin receptors, p75NTR and tyrosine kinase receptor A (TrkA). We tested the hypothesis that impairment of memory in rats could be achieved by RNA interference (RNAi) –induced silencing of TrkA specifically within these neurons. A novel fusogenic, karyophilic immunoporter (fkAbp75-ipr) was constructed from the antibody, MC192 (monoclonal antibody to the rat neurotrophin receptor p75NTR, Abp75), poly-L-lysine together with the hemagglutinin 2 and VP1 nuclear localization peptides of influenza and SV40 virus, respectively. Plasmid DNA constructs containing short hairpin sequences inhibitory to tyrosine kinase receptor A expression (TrkAi) and the gene encoding cGFP (green fluorescent protein from coral fish) was produced. These TrkAi plasmids were mixed with the immunoporter, forming the immunogene, TrkAi-fkAbp75. A control TrkAsc complexed with fkAbp75 (TrkAscfkAbp75) immunogene was constructed from a scrambled sequence (TrkAsc) and fkAbp75-ipr. Rats were infused using an osmotic mini-pump into the third ventricle with either TrkAifkAbp75 or TrkAsc-fkAbp75. Naive rats were also included as additional controls. After 7 days, examination of gene expression on forebrain sections of some rats revealed cGFP expression in TrkA neurons. Fifteen to 19 days after infusion, rats were tested in a Morris water maze apparatus. Animals that received TrkAi-fkAbp75 showed significantly impaired spatial memory learning ability compared with naive or TrkAsc-fkAbp75-treated rats. Western blot and immunofluorescence analysis showed that TrkA protein levels and numbers of TrkA positive neurons were reduced by 60% and 55% respectively in TrkAi-fkAbp75-infused rats compared with in-

Key words: shRNA, immunogene, immunoporter, MC192, fusogenic, karyophilic.

Transgenic animal models, based on over-expression or inactivation of a given gene, have been important for understanding neurophysiological mechanisms. For example, mice deficient for the nerve growth factor (NGF) receptor, tyrosine kinase receptor A (TrkA), have been reported to have reduced numbers of central cholinergic neurons and peripheral sympathetic preganglionic neurons (Fagan et al., 1997; Schober et al., 1997). In contrast, mice lacking NGF display loss of sensory and sympathetic neurons but develop with a full complement of basal forebrain cholinergic neurons (Crowley et al., 1994). However, these animal models have experimental limitations that include compensatory developmental adaptations that often lead to an animal model lacking the desired human disease phenotype (Laakso et al., 2002; Salahpour et al., 2007). An alternative to transgenic animals for the study of the function of specific genes is the use of RNA interference (RNAi), a post-transcriptional gene-silencing mechanism based on the degradation of mRNA (Fire et al., 1998; Hannon, 2002). Various forms of this technology have been applied to mammalian brains to investigate gene function in vivo. For example, vector containing short hairpin RNA (shRNA) has been used to down-regulate tyrosine hydroxylase in vivo, while other researchers have used siRNA (small interfering RNA) to down-regulate the neurotrophin receptor, tyrosine kinase receptor B (TrkB) (Valdez et al., 2005) and the dopamine (Thakker et al., 2004) and 5-HT transporters (Thakker et al., 2005) in rodent brain. However, the challenge of cell specific delivery of RNAi reagents to the mammalian nervous system has not been addressed. Systemic administration of naked siRNA is not feasible as siRNAs do not cross the blood– brain barrier (BBB) and are not efficiently internalized into target cells. For example, injection of siRNA into the brain parenchyma failed to show efficacy (Isacson et al., 2003), although in combination with electroporation, this technique has shown some promise (Akaneya et al., 2005; Valdez et al., 2005). Some studies have reported success with a continuous infusion of siRNA into ventricular cerebrospinal fluid (Thakker et al., 2004). A recent study has

*Corresponding author. Tel: ⫹61-882043095; fax: ⫹61-882045768. E-mail address: [email protected] (D. A. Berhanu). Abbreviations: Abp75, monoclonal antibody to the rat neurotrophin receptor p75NTR; BBB, blood– brain barrier; cGFP, green fluorescent protein from coral fish; CMV, cytomegaly virus; EDTA, ethylenediaminetetraacetic acid; fAbp75, fusogenic Abp75 immunoporter; FkAbp75, fusogenic karyophilic Abp75; HA2, hemagglutinin 2 peptide; LB, LuriaBertani; mAb, monoclonal antibody; MWMA, Morris water maze apparatus; NGF, nerve growth factor; NHS, normal horse serum; pDNA, plasmid DNA; PEG, polyethylene glycol; PLL, poly-L-lysine; pshRNA, plasmid DNA containing short hairpin RNA sequence; p75NTR, neurotrophin receptor p75NTR; RNAi, RNA interference; SDS-PAGE, sodium dodecyl sulfate–polyacrylamide gel electrophoresis; shRNA, short hairpin RNA; siRNA, small interfering RNA; sulfo-LC-SMPT, 4-sulfosuccinimidyl-[6-methyl-a-(2-pyridyldithio) toluamido] hexanoate; TBS, Tris-buffered saline; TBST, Tris-buffered saline with Tween 20; TrkA, tyrosine kinase receptor A; TrkAi, short hairpin RNAs to tyrosine kinase receptor A; TrkAi-fkAbp75, short hairpin RNAs to tyrosine kinase receptor A complexed with fusogenic karyophilic Abp75; TrkAsc, plasmid DNA with a scrambled sequence; TrkAsc-fkAbp75, TrkAsc complexed with fusogenic karyophilic Abp75; TrkB, tyrosine kinase receptor B; VP1-NLS, VP1 nuclear localization sequence of SV40 virus.

0306-4522/08$32.00⫹0.00 Crown Copyright © 2008 Published by Elsevier Ltd on behalf of IBRO. All rights reserved. doi:10.1016/j.neuroscience.2008.03.025

1115

1116

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

shown that conjugation of siRNA to the peptide Penetratin1, results in efficient delivery to primary neurons in culture (Davidson et al., 2004). Another group examined peripheral administration of plasmid vectors containing short hairpin RNA sequences (pshRNA) coupled with a monoclonal antibody (mAb) specific to the transferrin receptor. The complex then was pegylated and complexed with immunoliposome. This allowed the plasmid to be carried across the BBB to reach the target neurons (Zhang et al., 2002). This technology also has been successfully tested in rodent models of brain cancer. In our laboratory, the MC192 (monoclonal antibody to the rat neurotrophin receptor p75NTR, Abp75) mAb (Chandler et al., 1984) has recently been used to deliver genes to the neurotrophin receptor p75NTR (p75NTR) positive motor neurons of the spinal cord (Barati et al., 2006). The p75NTR and TrkA are co-expressed in regions of rat brains such as in the diagonal band of Broca and medial septum. In these regions, most TrkA neurons (⬎95%) also co-express the p75NTR and vice versa (Gibbs and Pfaff, 1994; Sobreviela et al., 1994). We have taken advantage of this tight receptor association to examine whether it was possible to down-regulate TrkA expression specifically within these neurons using siRNA generating plasmids introduced via the p75 receptor. The siRNA generating plasmids were complexed with a fusogenic, karyophilic immunoporter (fkAbp75) constructed from mAb Abp75, poly-L-lysine (PLL), the hemagglutinin 2 peptide of influenza virus (HA2) and VP1 nuclear localization sequence (VP1-NLS) of SV40 virus and infused into the ventricles of mature rats. We have previously shown that a similar immunogene construct can deliver genes specifically to neurons expressing the p75 receptor (Barati et al., 2006; Berhanu and Rush, manuscript in preparation) and thus is an ideal vehicle to target the TrkA expressing neurons of the basal forebrain.

EXPERIMENTAL PROCEDURES Production of Abp75 Abp75 is a mAb that recognizes the rat form of p75NTR (Chandler et al., 1984). This antibody was produced from hybridoma cells and purified using protein G according to the manufacturer’s recommended protocol (Amersham Biosciences, Sydney, NSW, Australia). The fusogenic HA2 peptide of influenza virus has been reported to increase the transfection in vivo when coupled to a non-viral vector (Wagner et al., 1992; Ishii et al., 1996; NavarroQuiroga et al., 2002). To construct a fusogenic non-viral gene targeting immunoporter, the purified Abp75 was coupled with PLL and HA2 peptide as outlined below.

Activation of Abp75 and HA2 with 4-sulfosuccinimidyl-[6-methyl-a-(2-pyridyldithio) toluamido] hexanoate (sulfo-LC-SMPT) Abp75 was activated with sulfo-LC-SMPT (Pierce, Melbourne, VIC, Australia) as follows (Thorpe et al., 1987). Briefly, Abp75 was mixed with sulfo-LC-SMPT at molar ratio of 1:20, respectively. Ten milligrams of Abp75 (4 mg/ml) was added into 0.8 mg of sulfo-LC-SMPT (Pierce) in 250 ␮l of N,N-dimethylformamide (Auspep, Melbourne, VIC, Australia), degassed and flushed with nitrogen gas for 10 min. The mixture was incubated at room temperature for 1 h with slow

shaking. The activated Abp75 was desalted using a Sephadex-25 (Pharmacia Fine Chemicals, Sydney, NSW, Australia) in activation buffer containing 80 mM Na2HPO4, 20 mM NaH2PO4.2H2O, 150 mM NaCl and 20 mM EDTA which was pH 7.5 and concentrated to 3 mg/ml with PEG (polyethylene glycol; Sigma, Sydney, NSW, Australia). The HA2 peptide (GLFEAIAEFIEGGWEGLIEGCAKKK; Chemicon, Melbourne, VIC, Australia) was activated with sulfo-LCSMPT as above, concentrated to 1 mg/ml, desalted with a Centricon membrane with molecular cut off 1 kDa (Pall Life Sciences, Sydney, NSW, Australia).

Activation of PLL with Traut’s reagent Activation of PLL using Traut’s reagent (Ghosh et al., 1990) was carried out at 1:20 molar ratio, respectively. Eight milligrams of PLL was dissolved in 2 ml of activation buffer and mixed with 0.5 milligrams of Traut’s reagent in 100 ␮l of Traut’s reagent buffer containing 50 mM triethanolamine, 400 mM NaCl and 8 mM EDTA, pH 7.5. The mixture was degassed, flushed with nitrogen gas and incubated at room temperature as above. The activated PLL was desalted using a Sephadex G-25 column and concentrated using PEG to 3 mg/ml.

Construction of a fusogenic immunoporter The activated Abp75, HA2 and PLL were mixed in a ratio of 1:0.5:1 (moles/moles/moles), degassed, flushed with nitrogen gas as above and incubated at 4 °C overnight to form the fusogenic Abp75 immunoporter (fAbp75-ipr). Twenty millimoles of cysteine (Sigma) was added to fAbp75-ipr and incubated for 2 h at room temperature to block the unreacted groups and the immunoporter purified using a Sephacryl-200 column (length, 80 cm; radius, 0.5 cm) using an activation buffer. The fAbp75-ipr was dialyzed against a 0.9% saline at 4 °C.

Design of shRNA to TrkA The complete sequence of the gene encoding for rat TrkA (GenBank accession number NM-021589) was examined to select appropriate siRNA targets for TrkA. This sequence was analyzed using the target finder and design tool provided by GenScript (NJ, USA) to select siRNA targets for TrkA. Four regions of 120 –141, 164 –185 1735–1756 and 2263–2284 of the gene sequence were selected. The sequences in these regions did not show near matches to any other known sequence on a Blast search including those of the receptors homologues to TrkB and TrkC, confirming their sequence specificity to TrkA only. These siRNAs (shown in italics and underlined) were synthesized in the form of shRNAs as follows; shRNA1;GGATCCCGTCAACGAAGTCACCAGACCGCTTGATATCCGGCGGTCTGGTGACTTCGTTGATTTTTTCCAAAAGCTT (120 –141), shRNA2;GGATCCCGTTTCCACATAGAGCTCCGTCATTGATATCCGTGACGGAGCTCTATGTGGAAATTTTTTCCAAAAGCTT (264 –285), shRNA3;GGATCCCGTCTGCCTCACGATGGAAGTCCTTGATATCCGGGACTTCCATCGTGAGGCAGATTTTTTCCAAAAGCTT (1735–1756) and shRNA4; GGATCCCGTCGATCGCCTCAGTGTTGGAGTTGATATCCGCTCCAACACTGAGGCGATCGATTTTTTCCAAAAGCTT (2263–2284). In addition, a scrambled sequence (shRNAsc) with no near-exact match to any known sequence was designed as control (ATCCCGTCGCACTCGTAGTGAGTACATT TTGATATCCGAATGTACTCACTACGAGTGCGTTTTTTCCAAAAGCTT). Each of the above shRNA was inserted into the pRNAT (GenScript) non-viral vector under the U6.1 promoter resulting in pshRNA1– 4 and pshRNAsc respectively. The pRNAT vector also has the gene encoding for cGFP (green fluorescent protein from coral fish) under the cytomegaly virus (CMV) promoter. A plasmid DNA (pDNA) was isolated from each of the pshRNA1– 4 and pshRNAsc constructs. Moreover, further control shRNA plasmids containing mutated sequences (shown in small letters below) at the silencing

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

1117

The pshRNA1– 4 (collectively referred to as tyrosine kinase receptor A expression inhibitors; TrkAi), pshRNAsc (plasmid DNA with a scrambled sequence, TrkAsc) and the pshRNAm1– 4 (mutated TrkAi; TrkAmi) were transformed separately in JM109 E. coli cells and were plated on different neomycin containing Luria-Bertani (LB) plates. A single colony was picked from each LB plate, inoculated into LB medium and incubated at 37 °C overnight. pDNA was isolated using a Qiagen Ultra Pure and Endotoxin Free kit for each of the above pshRNAs, as recommended by the manufacturer (Qiagen, Melbourne, VIC, Australia).

menting it with auto-polymerizing acrylic resin (Heraeus Kulzer, Germany). This cannula was connected to the s.c. implanted osmotic mini-pump (Alzet) for an infusion into the third ventricle. Rats were infused (n⫽10 for each group) at a flow rate of 6 ␮l (20 ␮g) of TrkAi or TrkAsc/day (Alzet model, 2004). Naive untreated rats were also included in this study. Two rats from each group were killed 7 days after infusion to examine the transfer and expression of cGFP, including naive rats, as a negative control. The remaining eight rats/group were kept for behavioral analysis for a total of 20 days. Another control group of animals (n⫽4) was also infused with an equal quantity of TrkAm-fkAbp75. These rats were killed 20 days after surgery and their forebrains examined biochemically using Western blot as described below. Rats were tested for their ability to learn in the spatial memory task three times a day for 5 days (days 15–19 post injection) in the Morris water maze apparatus (MWMA) (Morris et al., 1982) using a computer-based video tracking system (Stoelting, IL, USA). At the termination of each group of animals, the volume of saline and the amount of TrkAi or TrkAsc which remained in each mini-pump were determined to ensure each animal received the intended amount of either TrkAi or TrkAsc.

Construction of the fusogenic, karyophilic immunogene

Testing of the spatial memory of rats using the MWMA

VP1-NLS (MAPTKRKGSCPGAAPNKPK; Chemicon) of SV40 virus has been shown to improve transfection in vivo when coupled to a non-viral vector (Wagner et al., 1992; Ishii et al., 1996; Navarro-Quiroga et al., 2002). In this experiment, the fusogenic immunoporter, fAbp75-ipr was mixed with TrkAi and VP1-NLS at a ratio of (w/w/w) 0.5:1:0.19 and incubated at room temperature for 30 min to form the fusogenic, karyophilic immunogene (TrkAifkAbp75). Control immunogenes, TrkAsc complexed with fusogenic karyophilic Abp75 (TrkAsc-fkAbp75) were constructed from the fAbp75, TrkAsc (pDNA containing a scrambled sequence) and VP1-NLS components and also from TrkAm, fAbp75 and VP1-NLS resulting in TrkAm-fkAbp75.

The MWMA used in this experiment consisted of a cylindrical tank 120 cm in diameter, 45 cm deep and filled with room temperature water at 25 °C and to a depth of 30 cm. The water was made opaque by the addition of 0.05% powdered skim milk. The tank was divided into four equally spaced quadrants (north, south, east and west). A plastic circular escape platform (10 cm in diameter) was placed in the bottom of the tank in the southwest quadrant 2 cm below the surface and invisible from above water. The tank was located in the corner of a room containing four external light sources (one in each quadrant) which could be used by the rats for orientation. Rats were trained in the MWMA three times per day over five consecutive days. On each trial, the rats were placed in the water facing the wall of the tank at one of four designated starting points and given 60 s to find the platform and climb onto it. Rats were then allowed to rest on the platform for the subsequent 5 min before being placed for the next test. The latency to find the hidden platform and the distance swum were recorded by a computer-based video tracking system (Stoelting).

site (pshRNAm) were synthesized as follows: pshRNAm1, GGATCCCGTCATGTGTAGAGGCAGACCGCTTGATATCCGGCGGTCTGcctctacacaTGATTTTTTCCAAAAGCTT; pshRNAm2, GGATCCCGTTTTGTGTAGAGCCTCCGTCATTGATATCCGTGACGGAGgctctacacaAAATTTTTTCCAAAAGCTT; pshRNAm3, GGATCCCGTCTTGTGTAGAGGGGAAGTCCTTGATATCCGGGACTTCCcctctacacaAGATTTTTTCCAAAAGCTT; pshRNAm4, GGATCCCGTCTGTGTAGAGGGTGTTGGAGTTGATATCCGCTCCAACACcctctacacaGATTTTTTCCAAAAGCTT.

Isolation of shRNA generating pDNA

Animals All animal procedures were performed with protocols approved by Flinders University Animal Welfare Committee and conformed to the guidelines for the ethical use of animals issued by the National Health and Medical Research Council of Australia. All surgical procedures were performed with care to minimize pain and discomfort. Animals were kept on a 9- to 12-h light/dark cycle. All surgical procedures were performed with an i.p. injection of pentobarbitone (55 mg/kg body weight). After surgery rats were killed with an overdose i.p. injection of pentobarbitone (370 mg/kg body weight). Care was also taken to minimize the number of animals used in each experiment.

Intraventricular infusion of TrkAi-fkAbp75, TrkAsc-fkAbp75 or TrkAm-fkAbp75 One hundred fifty micrograms of each plasmid pshRNA1-4 was transferred to a tube to make a total of 600 ␮g of TrkAi plasmid. This TrkAi plasmid mixture was combined with fAbp75 and VP1NLS as described above forming, TrkAi-fkAbp75 in a total volume of 180 ␮l of saline. The same amount of TrkAsc was also mixed with fAbp75 and VP1-NLS resulting in the control immunogene, TrkAsc-fkAbp75. TrkAi-fkAbp75 and TrkAsc-fkAbp75 were then transferred into separate osmotic mini-pumps (Alzet, Sydney, NSW, Australia). Adult Sprague-Dawley rats weighing 270 –300 g were anesthetized with an i.p. injection of pentobarbitone (55 mg/kg body weight). A brain-infusion cannula was stereotaxically positioned (antero-posterior, 0.5 mm; mediolateral, 0 mm; dorsoventral; ⫺4 mm to Bregma) (Paxinos et al., 1985) by ce-

Detection of cGFP expression in forebrain TrkA positive neurons Rats (n⫽2/group) that received infusion for 7 days or kept without treatment for the same period of time were killed with an i.p. injection of pentobarbitone (370 mg/kg body weight). A straight incision was made over the thoracic region to expose the heart. A cannula was inserted into the left ventricle for perfusion, and the left atrium removed with scissors. A washout and dilation of the circulation was performed with 0.1 M Tris-buffered saline (TBS), pH 7.4 containing 1% sodium nitrite (Sigma) for 15 min. Brains were fixed for 15 min with 4% paraformaldehyde, pH 7.4 (Sigma) containing 5% picric acid (Sigma) in TBS, removed and fixed further for 3 h at room temperature in the same fixative. Following cryoprotection in 25% sucrose in TBS, pH 7.4, the forebrain (anterior: bregma ⫺2.8 to1.7 mm) was dissected out and frozen in optimal cutting temperature embedding medium and sectioned at 40 ␮m thickness using a cryostat (Leica, Cryo Cut 1800). One in every three sections was collected separately and processed for immunohistochemistry as follows. Sections were washed with TBS for 20 min and incubated with blocking buffer containing 20% normal horse serum (NHS) and 1% Tween 20 in TBS for 4 h at room temperature. The sections were incubated with rabbit anti-

1118

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

GFP and goat anti-TrkA primary antibodies (1:250 dilutions; Chemicon) in TBS buffer containing 0.1% Tween 20, 1% NHS for 48 h at 4 °C. After subsequent washing, sections were stained with Cy2 anti-rabbit and Cy3 anti-goat secondary antibodies (1: 400 dilutions; both from Jackson Immunoresearch, PA, USA). Later, sections were washed and mounted onto glass slides. Buffered glycerol was added onto the sections, coverslipped, dried on air and visualized under an immunofluorescence BX50 microscope (Olympus, Japan).

Detection of reduction of TrkA positive neurons Four animals from each group were examined for TrkA immunohistochemistry using every third section collected separately. Briefly, sections were blocked and incubated with goat anti-TrkA (1:250, Chemicon) primary antibodies. After several TBS washing steps, sections were stained with Cy3-conjugated anti-goat secondary antibodies (1:400; Jackson Immunoresearch). Sections were washed and visualized under a fluorescence microscope as above. Counting of TrkA immunoreactive neurons was performed manually on the screen of an apple computer connected to a coolSNAP camera (Photometrics, Japan). Only TrkA positive neurons with a clear cell body were counted in 11–13 sections per animal.

Quantification of TrkA proteins reduction in the forebrain To test the effect of TrkAi infusion on the TrkA protein level, four rats/group were killed with an overdose i.p. injection of pentobarbitone (370 mg/kg body weight). The forebrains (Bregma A⫽⫺2.8 –1.7 mm) of these rats were removed and assayed for TrkA, TrkB and ␤-tubulin III protein content using a quantitative Western blot. Briefly, forebrain tissues were homogenized with an ice-cold homogenization buffer containing 20 mm tris, 1% Triton X-100, 1 mm EDTA, pH 7.4 and cocktails of protease inhibitors (Roche Diagnostics, Germany). The forebrain homogenates were cleaned with a 2-D gel clean up kit (Biorad, Sydney, NSW, Australia). The protein concentration of each homogenate was determined with an EZQ protein quantification kit (Invitrogen, Australia). These samples were aliquoted and reduced with 0.1 mM dithiothreitol by boiling for 5 min at 100 °C. Fifty micrograms of each sample was loaded and separated using gradient (4 –20%) sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDSPAGE) and transferred to polyvinylidene fluoride membranes (Amersham Biosciences). Membranes were blocked in TBST (Tris-buffered saline containing 0.01% Tween-20 and 0.05% skim milk) for 2 h at room temperature followed by incubation with either goat anti-TrkA (1:250; Chemicon), mouse anti-␤-tubulin III (1: 1000; Promega, Australia) or rabbit anti-TrkB (1:500; produced in-house) primary antibodies. After several rinses in TBS, the blots were incubated for 2 h at room temperature in TBST containing alkaline-phosphatase conjugated secondary antibody (1:5000; Biorad Laboratories). The membranes were washed five times with TBS. Later, each blot was exposed to fluorescent substrate (Amersham Biosciences) for 5 min. The blots were scanned using a Typhoon scanner (Amersham Biosciences). Quantitative densitometry of bands was performed using ImageQuant TL V.2003 (Amersham Biosciences) software. TrkA bands were normalized to ␤-tubulin III.

Evaluation and data analysis TrkA and cGFP immunoreactive neurons were evaluated using 4, 10 and 20⫻ magnifications of BX50 microscope. Statistical analysis was performed using one-way analysis of variance followed by unpaired Student’s t-test on commercial software (PRISM GraphPad version 4). For all analyses, values are given mean⫾standard error (S.E.M.) and significance levels were set at P⬍0.05.

RESULTS Pilot experiments using a single shRNA generating plasmid An initial experiment was performed to determine whether a single shRNA species could achieve sufficient knockdown of the TrkA protein to result in a behavioral deficit. Four rats were infused for 3 weeks with the TrkAi1-fkAbp75 immunogene carrying the single shRNA1-generating plasmid, using a protocol identical to that described in the Experimental Procedures above. The animals were examined using the same behavioral and Western blot analysis as described above. TrkA protein levels decreased significantly by 35% (P⬍0.05), without changes in either the TrkB or ␤-tubulin III protein levels. However, although these animals showed a trend toward a learning deficit in the Morris water maze test, this trend did not reach significance at the P⬍0.05 level. Thus, all subsequent experiments were performed with the use of four shRNA-generating plasmids combined, with the objective of achieving a greater reduction in the targeted TrkA protein level sufficient to lead to behavioral impairment. Confirmation of targeted delivery The TrkAi and TrkAsc immunogenes were infused into the third ventricle using fkAbp75 as a targeting to neurons expressing the p75NTR. Previous studies have shown that p75 and TrkA are co-expressed in almost all the basal forebrain neurons (Gibbs and Pfaff, 1994; Sobreviela et al., 1994). Seven days after infusion, immunofluorescence was performed to detect cGFP expression in two animals. This was to confirm the transfer of TrkAi and TrkAsc specifically to neurons expressing the TrkA receptor. We have previously demonstrated that intraventricular injection of an immunogene incorporating the MC192 antibody to the p75 receptor leads to expression of other exogenous gene within neurons expressing the p75 with little expression in other neurons or glia. Some off-target expression of the exogenous gene is always present along the needle track (Berhanu and Rush, manuscript in preparation). In this current study cGFP was expressed in greater than 90% of TrkA positive forebrain neurons as shown by the co-localization of cGFP and TrkA (Fig. 1A–C and G–I) with no immunoreactivity being found in sections stained with Cy2- and Cy3-conjugated secondary antibody alone (Fig. 1D–F). TrkAi immunogene infusion results in spatial memory impairment Naive rats and rats that received either TrkAi-fkAbp75 or TrkAsc-fkAbp75 were trained in the MWMA to find a submerged platform. The time required and the distance traveled to find the submerged platform were followed using a computer-based video tracking system (Stoelting). Rats that received TrkAi-fkAbp75 took longer (Fig. 2A) and swam farther (Fig. 2B) compared with controls. Naive rats and

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

1119

Fig. 1. cGFP was transferred and expressed in TrkA positive neurons. Four different shRNAs were designed from different region of the gene encoding for TrkA. Each of the shRNA was cloned into pRNAT U6.1 vector. This vector has the gene encoding for cGFP and shRNA under the CMV and U6.1 promoters respectively. Osmotic mini-pumps were filled with TrkAi-fkAbp75. A brain infusion cannula was stereotaxically placed as described by the manufacturer for infusion from s.c. implanted minipump into the dorsal third ventricle. To examine the expression of cGFP within TrkA positive neurons, two rats were killed 7 days after infusion. These rats (n⫽2/group) were perfused, fixed, forebrains removed and sectioned. Sections were processed for cGFP (A and G) and TrkA immunofluorescence (B and H). cGFP expression was confirmed in TrkA neurons as shown in the co-localization study (C, I) with no immunoreactivity being found in sections stained with Cy2 and Cy3 conjugated secondary antibody alone (D–F). Scale bars⫽250 ␮m for A–F and 50 ␮m for G–I. The dashed rectangle in J (bregma, 0.2 mm; Paxinos et al., 1985) show the precise region of the rat brain where these images were taken.

1120

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

Impaired learning correlates with reduced TrkA protein levels, both histologically and biologically Immunofluorescence histochemistry on the fixed forebrain sections was performed to establish whether the number of TrkA immunoreactive neurons was decreased. TrkA immunoreactive neurons were reduced significantly by 55⫾6% in rats that received TrkAi-fkAbp75 as compared with controls (Fig. 3.1 and 3.2; P⬍0.05). In addition, when the protein levels of TrkA in the forebrain extracts were determined using Western blot and quantitative densitometry, TrkA protein levels were found to be reduced significantly by 60⫾5% (P⬍0.05; Fig. 4A.1, A.2 and D) in rats that received TrkAi-fkAbp75, but not in control groups including naïve animals and those that received either the scrambled or mutated sequences (Fig. 4A.1, A.2 and D). This was in contrast to the unchanged concentration of TrkB or ␤-tubulin III protein levels (Fig. 4B.1, B.2 and C respectively) between each treatment group.

DISCUSSION Fig. 2. Infusion of TrkAi-fkAbp75 (n⫽8) into the dorsal third ventricle of rats reduced their ability to perform a spatial memory task. Rats were infused via the dorsal third ventricle with either TrkAi-fkAbp75 or TrkAsc-fkAbp75 (n⫽8) using s.c. placed osmotic mini-pump. This osmotic minipump was connected to a cannula through a tube. The cannula was in turn implanted in the dorsal third ventricle. Fourteen days after infusion, training was given in the MWMA. Naive rats (n⫽8) or those that were infused with either TrkAi-fkAbp75 or TrkAsc-fkAbp75 were trained three times a day for 5 days. The time and distance required to position the platform were recorded using a video tracking system. Rats infused with TrkAi-fkAbp75 took longer time (A) and swam farther (B) compared with TrkAsc-fkAbp75 infused or naive rats. Asterisks indicate a significant difference (P⬍0.05) between rats that received TrkAi-fkAbp75 and controls.

rats that received TrkAsc-fkAbp75 learned to locate the hidden platform more rapidly with training. No difference was found between these two control groups. Although rats that received TrkAi-fkAbp75 learned to some limited extent at the beginning of training, they showed learning deficits at all time points examined when compared with controls (Fig. 2A). In this group the latency to locate the platform was 53.6⫾3 s on the first day to 48.3⫾4 s on the fifth day. Rats that were treated with TrkAsc-fkAbp75 took 41⫾3.8 s and 9.6⫾2.5 s on the first and fifth days of training respectively. Naive rats scored 42.6⫾3 s on the first day and 8.6⫾3 s on the fifth day. The time required to find the platform was longer in rats that received TrkAi-fkAbp75 compared with controls and was significantly different (P⬍0.05). A similar pattern was observed when analyzing the distance swum. TrkAi-fkAbp75 treated rats swam farther and this differed significantly (P⬍0.05) from controls. These rats swam 8.1⫾0.9 m (m) on the first day. This distance was reduced to only 5⫾0.5 m on the fifth day. TrkAsc-fkAbp75 infused rats swam 5.9⫾0.7 m on the first day and 1.0⫾0.25 m on the fifth day. Naive rats took only 5.3⫾0.3 (first day) m and 0.9⫾0.2 (fifth day) m to find the platform. No significant differences were found between these two control groups.

RNAi is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by the generation of dsRNA molecules homologous in sequence to the silenced gene (Fire et al., 1998). Several studies have shown the use of RNAi to silence endogenous genes within the brain (Thakker et al., 2004). In this current study, an initial, pilot experiment was performed to determine whether a behavioral deficit could be achieved with the use of a single shRNA species delivered using the p75 targeting immunogene. As spatial memory impairment failed to reach significance despite a significant reduction (35%) in TrkA protein level, additional shRNA-generating plasmids were included in the infusion of rats in the full experiment. Combining several shRNA sequences has been used to achieve sufficient silencing of the tumor suppressor, Trp53 mRNA (Hemann et al., 2003). In this study, we have shown down-regulation of TrkA using pshRNA-mediated RNAi. The plasmids containing shRNA were transferred to TrkA immunoreactive neurons through the p75NTR using the fkAbp75 immunoporter. This was confirmed by the expression of cGFP in most TrkA positive neurons. Rats infused with TrkAi-fkAbp75 immunogene took longer and swam further to find the hidden platform compared with those that received the control, TrkAsc-fkAbp75 immunogene or naive rats. The latency to find the platform reduced from 41 to 9.6 and 42.6 – 8.6 s for TrkAsc-fkAbp75 infused and naïve rats, respectively showing a normal learning response curve. These groups of rats learned faster to find the position of the platform as training continued. In contrast, the time taken to locate the platform for rats that received TrkAi-fkAbp75 reduced only from 53.6 – 48.3 s. Thus these rats showed significant memory impairment which was confirmed by the longer distance swum to locate the platform. The distance swum reduced from 5.9 –1.0 and from 5.3– 0.9 m for the control TrkAscfkAbp75 infused and naive rats, respectively and there was no significant difference between these two control groups.

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

1121

G

Fig. 3. Effect of immunogene infusion on TrkA expressing neurons. (3.1) Fluorescent immunostaining for TrkA shows loss of TrkA immunoreactive neurons in rats that received TrkAi-fkAbp75. Rats were infused into the third ventricle for 3 weeks with either TrkAi-fkAbp75 (C, F) or TrkAsc-fkAbp75 (B, E). Control, naive rats were also included for the same time points (A, D). These rats were perfused, fixed, and forebrains removed and sectioned. Sections were stained with anti-TrkA antibody. The number of TrkA immunoreactive neurons in rats that received TrkAi-fkAbp75 (C, F) reduced substantially as compared with those that received TrkAsc-fkAbp75 (B, E) or naive rats (A, D). (D–F) Higher magnifications of A, B and C respectively. Scale bars⫽250 ␮m (A–C) and 50 ␮m (D–F). (3.2) TrkAi-fkAbp75 infusion into the dorsal third ventricle reduced the number of TrkA positive neurons. Rats were infused into the dorsal third ventricle for 3 weeks with either TrkAi-fkAbp75 or TrkAsc-fkAbp75 or kept untreated. These rats were perfused, fixed, and forebrains removed and sectioned. Sections were incubated with anti-TrkA antibody and stained with Cy3-cojugated secondary antibody. The numbers of TrkA neurons left were counted in one of every three sections. TrkA positive neurons were reduced by 55⫾6% (P⬍0.05; n⫽4) in rats that received TrkAi-fkAbp75 compared with controls. Asterisks indicate a significant difference.

When the forebrains of the treated rats were examined by immunofluorescence, the number of TrkA positive neu-

rons was reduced significantly in rats that received TrkAifkAbp75 when compared with controls. The TrkA protein

1122

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

Fig. 4. TrkA protein level is quantitatively reduced in forebrain extract of rats that received TrkAi-fkAbp75. Representative immunoblots (A, B) of samples taken from forebrain extracts of rats that received either TrkAi-fkAbp75 or controls. Samples were resolved by SDS-PAGE and immunoblotted for TrkA (A), ␤-tubulin III (B) and TrkB (C). ␤-Tubulin III was used as a controls for protein loading. Quantitative densitometry of TrkA⫾S.E.M. (D) from forebrain extracts of rats that received either TrAin-fkAbp75 or control rats (n⫽4/group). Western blot analysis revealed that protein level of TrkA was reduced by 60⫾5% (P⬍0.05) in rats that received TrkAi-fkAbp75 (A.1, A.2, D) but not in any of the control groups of naïve animals, rats infused with either TrkAsc-fkAbp75, or TrkAm-fkAbp75 (A.1, A.2, D) when compared with total extracted protein. The protein level of ␤-tubulin III did not show reduction (B) in any of the groups. No reduction was seen in TrkB protein level indicating that there were no off-target effects (C).

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

level in these treated rats also showed a significant reduction compared with control groups, suggesting that the reduction in TrkA protein was responsible for the memory impairment. A correlation between the reduction in the number of forebrain TrkA positive neurons and TrkA protein level, and memory impairment also has been shown in aged rats (Saragovi, 2005). The TrkA protein level and the number of TrkA positive neurons showed no reduction in rats that received TrkAsc-fkAbp75, shRNAs to TrkA mutated at the silencing site (mTrkAi) –fkAbp75 or in naive animals. The protein level of ␤-tubulin III was similar in all groups confirming that the immunogene has no effect on the majority of neurons within the basal forebrain. It is possible that the use of RNAi for one mRNA species can lead to the unwanted inhibition of other species. Such off-target effects can occur particularly if the shRNA sequence used has homology to mRNA sequences of other transcripts. Because the mRNA sequence for rat TrkA and TrkB has approximately 67% identity in mammals (Lamballe et al., 1991), we examined the same rat brain tissues by Western blot for the concentration of TrkB protein which is known to be present within the basal forebrain. TrkB protein level was not affected by the immunogene treatment confirming the absence of off-target effects. This is in line with our observation that the MC192 targeting vehicle ensures uptake of the gene is limited to only those cells expressing the p75 receptor. This is not surprising given a large amount of published work that has shown the specificity of the targeting immunotoxin MC192-saporin to these neurons (Lappi and Wiley, 2004). Thus, it is likely that the learning deficits seen in this study are due to the generation of the siRNA specific to TrkA within the basal forebrain cholinergic neurons. There is also a possibility of downregulation of unrelated genes as a result of targeted shRNA infusion. Non-specific, dose dependent repression of gene expression by siRNA has been reported (Jackson et al., 2003; Persengiev et al., 2004). However, no downregulation of TrkA protein was found following infusion of animals with the control immunogene containing mutated shRNA generating plasmids at the silencing sites, supporting the conclusion that the immunogene specifically targets TrkA. Acetylcholine levels are known to be a critical component of spatial learning (Auld et al., 2001). It is therefore reasonable to speculate that the mechanism by which the immunogene leads to an impaired learning ability is likely to involve a reduced level of this neurotransmitter. A reduction in the level of TrkA protein within the cholinergic neurons would in turn reduce the amount of NGF transported within these neurons. NGF is known to regulate acetylcholine production through the control of choline acetyltransferase synthesis (Pongrac and Rylett, 1996; Auld et al., 2001). This mechanism is in line with many others studies that have identified the role of NGF, TrkA and choline acetyltransferase in learning and memory (Li et al., 1995; Wortwein et al., 1998; Mufson et al., 2003). Recently, other researchers using plasmid based shRNA coupled to an antibody against the transferrin receptor and encapsulated within pegylated immunolipo-

1123

somes, have shown down-regulation of the corresponding mRNA in the brain after i.v. injection (Zhang et al., 2003). However, given the high susceptibility of neurons to liposomal toxicity (Ohki et al., 2001; Krichevsky and Kosik, 2002; Lingor et al., 2004), we have constructed the p75 receptor–targeted immunogene without the use of a cationic lipid-based transfection reagent. Delivery of shRNA expressing vectors have been shown to silence the transgene in GFP transgenic mice (Xia et al., 2002). Tyrosine hydroxylase has been down-regulated by 30% using pshRNA resulting in a deficit in motor performance and reduced response to a psychostimulant (Hommel et al., 2003). In addition, shRNA-mediated silencing of the ␣-estrogen receptor in the ventromedial nucleus of hypothalamus has been shown to abolish female sexual behaviors (Musatov et al., 2006). The potential use of RNAi for the treatment of various neurodegenerative diseases has been highlighted by reports showing that administration of shRNA expressing vectors prevents the onset of clinical and the cytological characteristics in a mouse model of spinocerebellar ataxia type 1, Huntington disease and amyotrophic lateral sclerosis (Xia et al., 2004; Harper and Davidson, 2005; Ralph et al., 2005; Raoul et al., 2005). However, all these studies used viral vectors to deliver and express the shRNA which do not target or express genes within specific cell groups. Makimura et al. (2002) used local injection of siRNA against the gene expressing agouti-related protein, into the hypothalamic arcuate nucleus of adult mice, which resulted in down-regulation of the protein by as much as 50% within 24 h of injection, leading to a marked increase in the overall metabolic rate. However, this siRNA-mediated elevation of the metabolic rate was transient, lasting for not more than 3 days. Another attempt to use siRNA in the brain achieved a 30% reduction both in the mRNA and protein levels of the ␣2A adrenoreceptor, following local siRNA injections into the brainstem of neonatal rats (Shishkina et al., 2004). However, this knockdown was also transient and required repeated injections of siRNA for up to 3 days. These studies clearly demonstrated the need for alternative means of siRNA administration in order to prolong the knockdown effect for the targeted gene. Moreover, local injections of siRNA restrict its entry to just a small number of cells that are in close proximity to the injection site. To overcome this problem, several researchers have resorted to the use of electroporation to deliver genes non-specifically into several cell types including neurons, which results in relatively better transfection than local injection (Weaver, 1995; Mizutani and Saito, 2005). In a recent study, electroporation was used to downregulate TrkB in the brain which resulted in a reduction of pain sensation noted after hind paw inflammation (Guo et al., 2006). Cellular introduction of siRNA encoding for AMPA glutamate receptor 2 or cyclo-oxygenase 1 into the hippocampal CA1 region and visual cortex of neonatal rats using electroporation has also been shown to down-regulate the target mRNA, but again was only local and transient (Akaneya et al., 2005). As most proteins are not localized in a single region of the brain and they commonly

1124

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125

have long half-lives, repeated administration of siRNA aided with electroporation would be needed for this purpose which is expensive, time consuming and traumatic (Bonnafous et al., 1999; Gehl et al., 2002). Attempts to resolve this problem have been made by infusing the siRNA into the brain using osmotic mini-pumps (Thakker et al., 2004). Infusion of siRNA into the dorsal third ventricle using an osmotic mini-pump also has been shown to down-regulate endogenous genes such as the dopamine and 5-HT transporters in the rodent brains (Thakker et al., 2004, 2005). However, the dose of siRNA used (400 ␮g/ day, for 2 weeks) in these studies was high. Additionally, during infusion, the siRNA spreads widely throughout the brain which increases the probability of off-target effects.

CONCLUSION In this study, we have constructed a novel non-viral targeting vector, the fkAbp75 immunoporter to transfer the pDNA generating shRNA to TrkA immunoreactive neurons through the p75 receptor. We have successfully shown the expression of cGFP and down-regulation of TrkA protein that resulted in a significant learning deficit. Thus, this finding demonstrates significant progress toward an efficient targeted delivery of functionally important genes to specific neuronal population within the brain using a novel non-viral vector strategy. The use of immunogenes constructed from antibodies targeting other receptors would allow this novel technology to be extended to a wide range of additional neuronal populations. Acknowledgments—This work was supported by an International Postgraduate Research Scholarship from Flinders University of South Australia to Degu A. Berhanu and an NHMRC grant to Robert A. Rush. The authors would like to thank Dr. Tim Chataway for Western blots and Dusan Matusica for assistance with fluorescence microscopy.

REFERENCES Akaneya Y, Jiang B, Tsumoto T (2005) RNAi-induced gene silencing by local electroporation in targeting brain region. J Neurophysiol 93:594 – 602. Auld DS, Mennicken F, Day JC, Quirion R (2001) Neurotrophins differentially enhance acetylcholine release, acetylcholine content and choline acetyltransferase activity in basal forebrain neurons. J Neurochem 77:253–262. Barati S, Hurtado PR, Zhang SH, Tinsley R, Ferguson IA, Rush RA (2006) GDNF gene delivery via the p75(NTR) receptor rescues injured motor neurons. Exp Neurol 202:179 –188. Bonnafous P, Vernhes M, Teissie J, Gabriel B (1999) The generation of reactive-oxygen species associated with long-lasting pulse-induced electropermeabilisation of mammalian cells is based on a non-destructive alteration of the plasma membrane. Biochim Biophys Acta 1461:123–134. Chandler CE, Parsons LM, Hosang M, Shooter EM (1984) A monoclonal antibody modulates the interaction of nerve growth factor with PC12 cells. J Biol Chem 259:6882– 6889. Crowley C, Spencer SD, Nishimura MC, Chen KS, Pitts-Meek S, Armanini MP, Ling LH, McMahon SB, Shelton DL, Levinson AD (1994) Mice lacking nerve growth factor display perinatal loss of sensory and sympathetic neurons yet develop basal forebrain cholinergic neurons. Cell 76:1001–1011.

Davidson TJ, Harel S, Arboleda VA, Prunell GF, Shelanski ML, Greene LA, Troy CM (2004) Highly efficient small interfering RNA delivery to primary mammalian neurons induces microRNA-like effects before mRNA degradation [erratum appears in J Neurosci 2005 25(5):1311]. J Neurosci 24:10040 –10046. Fagan AM, Garber M, Barbacid M, Silos-Santiago I, Holtzman DM (1997) A role for TrkA during maturation of striatal and basal forebrain cholinergic neurons in vivo. J Neurosci 17:7644 –7654. Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 391:806 – 811. Gehl J, Skovsgaard T, Mir LM (2002) Vascular reactions to in vivo electroporation: characterization and consequences for drug and gene delivery. Biochim Biophys Acta 1569:51–58. Ghosh SS, Kao PM, McCue AW, Chappelle HL (1990) Use of maleimide-thiol coupling chemistry for efficient syntheses of oligonucleotide-enzyme conjugate hybridization probes. Bioconjug Chem 1:71–76. Gibbs RB, Pfaff DW (1994) In situ hybridization detection of trkA mRNA in brain: distribution, colocalization with p75NGFR and up-regulation by nerve growth factor. J Comp Neurol 341:324 – 339. Guo W, Robbins MT, Wei F, Zou S, Dubner R, Ren K (2006) Supraspinal brain-derived neurotrophic factor signaling: a novel mechanism for descending pain facilitation. J Neurosci 26:126 –137. Hannon GJ (2002) RNA interference. Nature 418:244 –251. Harper SQ, Davidson BL (2005) Plasmid-based RNA interference: construction of small-hairpin RNA expression vectors. Methods Mol Biol 309:219 –235. Hemann MT, Fridman JS, Zilfou JT, Hernando E, Paddison PJ, Cordon-Cardo C, Hannon GJ, Lowe SW (2003) An epi-allelic series of p53 hypomorphs created by stable RNAi produces distinct tumor phenotypes in vivo. Nat Genet 33:396 – 400. Hommel JD, Sears RM, Georgescu D, Simmons DL, DiLeone RJ (2003) Local gene knockdown in the brain using viral-mediated RNA interference. Nat Med 9:1539 –1544. Isacson R, Kull B, Salmi P, Wahlestedt C (2003) Lack of efficacy of ‘naked’ small interfering RNA applied directly to rat brain. Acta Physiol Scand 179:173–177. Ishii N, Minami N, Chen EY, Medina AL, Chico MM, Kasamatsu H (1996) Analysis of a nuclear localization signal of simian virus 40 major capsid protein Vp1. J Virol 70:1317–1322. Jackson AL, Bartz SR, Schelter J, Kobayashi SV, Burchard J, Mao M, Li B, Cavet G, Linsley PS (2003) Expression profiling reveals off-target gene regulation by RNAi. Nat Biotechnol 21:635– 637. Krichevsky AM, Kosik KS (2002) RNAi functions in cultured mammalian neurons. Proc Natl Acad Sci U S A 99:11926 –11929. Laakso A, Mohn AR, Gainetdinov RR, Caron MG (2002) Experimental genetic approaches to addiction. Neuron 36:213–228. Lamballe F, Klein R, Barbacid M (1991) trkC, A new member of the trk family of tyrosine protein kinases, is a receptor for neurotrophin-3. Cell 66:967–979. Lappi DA, Wiley RG (2004) Immunotoxins and neuropeptide-toxin conjugates experimental applications. Mini Rev Med Chem 4:585– 595. Li Y, Holtzman DM, Kromer LF, Kaplan DR, Chua-Couzens J, Clary DO, Knusel B, Mobley WC (1995) Regulation of TrkA and ChAT expression in developing rat basal forebrain: evidence that both exogenous and endogenous NGF regulate differentiation of cholinergic neurons. J Neurosci 15:2888 –2905. Lingor P, Michel U, Scholl U, Bahr M, Kugler S (2004) Transfection of ‘naked’ siRNA results in endosomal uptake and metabolic impairment in cultured neurons. Biochem Biophys Res Commun 315: 1126 –1133. Makimura H, Mizuno TM, Mastaitis JW, Agami R, Mobbs CV (2002) Reducing hypothalamic AGRP by RNA interference increases metabolic rate and decreases body weight without influencing food intake. BMC Neurosci 3:3–9.

D. A. Berhanu and R. A. Rush / Neuroscience 153 (2008) 1115–1125 Mizutani K, Saito T (2005) Progenitors resume generating neurons after temporary inhibition of neurogenesis by Notch activation in the mammalian cerebral cortex. Development 132:1295–1304. Morris RG, Garrud P, Rawlins JN, O’Keefe J (1982) Place navigation impaired in rats with hippocampal lesions. Nature 297:681– 683. Mufson EJ, Ginsberg SD, Ikonomovic MD, DeKosky ST (2003) Human cholinergic basal forebrain: chemoanatomy and neurologic dysfunction. J Chem Neuroanat 26:233–242. Musatov S, Chen W, Pfaff DW, Kaplitt MG, Ogawa S (2006) RNAimediated silencing of estrogen receptor {alpha} in the ventromedial nucleus of hypothalamus abolishes female sexual behaviors. Proc Natl Acad Sci U S A 103:10456 –10460. Navarro-Quiroga I, Antonio Gonzalez-Barrios J, Barron-Moreno F, Gonzalez-Bernal V, Martinez-Arguelles DB, Martinez-Fong D (2002) Improved neurotensin-vector-mediated gene transfer by the coupling of hemagglutinin HA2 fusogenic peptide and Vp1 SV40 nuclear localization signal. Brain Res Mol Brain Res 105:86 –97. Ohki EC, Tilkins ML, Ciccarone VC, Price PJ (2001) Improving the transfection efficiency of post-mitotic neurons. J Neurosci Methods 112:95–99. Paxinos G, Watson C, Pennisi M, Topple A (1985) Bregma, lambda and the interaural midpoint in stereotaxic surgery with rats of different sex, strain and weight. J Neurosci Methods 13:139 –143. Persengiev SP, Zhu X, Green MR (2004) Nonspecific, concentrationdependent stimulation and repression of mammalian gene expression by small interfering RNAs (siRNAs). RNA 10:12–18. Pongrac JL, Rylett RJ (1996) Differential effects of nerve growth factor on expression of choline acetyltransferase and sodium-coupled choline transport in basal forebrain cholinergic neurons in culture. J Neurochem 66:804 – 810. Ralph GS, Radcliffe PA, Day DM, Carthy JM, Leroux MA, Lee DC, Wong LF, Bilsland LG, Greensmith L, Kingsman SM, Mitrophanous KA, Mazarakis ND, Azzouz M (2005) Silencing mutant SOD1 using RNAi protects against neurodegeneration and extends survival in an ALS model. Nat Med 11:429 – 433. Raoul C, Abbas-Terki T, Bensadoun JC, Guillot S, Haase G, Szulc J, Henderson CE, Aebischer P (2005) Lentiviral-mediated silencing of SOD1 through RNA interference retards disease onset and progression in a mouse model of ALS. Nat Med 11:423– 428. Salahpour A, Medvedev IO, Beaulieu JM, Gainetdinov RR, Caron MG (2007) Local knockdown of genes in the brain using small interfering RNA: a phenotypic comparison with knockout animals. Biol Psychiatry 61:65– 69. Saragovi HU (2005) Progression of age-associated cognitive impairment correlates with quantitative and qualitative loss of TrkA receptor protein in nucleus basalis and cortex. J Neurochem 95: 1472–1480. Schober A, Minichiello L, Keller M, Huber K, Layer PG, Roig-Lopez JL, Garcia-Arraras JE, Klein R, Unsicker K (1997) Reduced acetylcholinesterase (AChE) activity in adrenal medulla and loss of sympa-

1125

thetic preganglionic neurons in TrkA-deficient, but not TrkB-deficient, mice. J Neurosci 17:891–903. Shishkina GT, Kalinina TS, Dygalo NN (2004) Attenuation of alpha2Aadrenergic receptor expression in neonatal rat brain by RNA interference or antisense oligonucleotide reduced anxiety in adulthood. Neuroscience 129:521–528. Sobreviela T, Clary DO, Reichardt LF, Brandabur MM, Kordower JH, Mufson EJ (1994) TrkA-immunoreactive profiles in the central nervous system: colocalization with neurons containing p75 nerve growth factor receptor, choline acetyltransferase, and serotonin. J Comp Neurol 350:587– 611. Thakker DR, Natt F, Husken D, Maier R, Muller M, van der Putten H, Hoyer D, Cryan JF (2004) Neurochemical and behavioral consequences of widespread gene knockdown in the adult mouse brain by using nonviral RNA interference. Proc Natl Acad Sci U S A 101:17270 –17275. Thakker DR, Natt F, Husken D, van der Putten H, Maier R, Hoyer D, Cryan JF (2005) siRNA-mediated knockdown of the serotonin transporter in the adult mouse brain. Mol Psychiatry 10:782–789. Thorpe PE, Wallace PM, Knowles PP, Relf MG, Brown AN, Watson GJ, Knyba RE, Wawrzynczak EJ, Blakey DC (1987) New coupling agents for the synthesis of immunotoxins containing a hindered disulfide bond with improved stability in vivo. Cancer Res 47: 5924 –5931. Valdez G, Akmentin W, Philippidou P, Kuruvilla R, Ginty DD, Halegoua S (2005) Pincher-mediated macroendocytosis underlies retrograde signaling by neurotrophin receptors. J Neurosci 25:5236 – 5247. Wagner E, Plank C, Zatloukal K, Cotten M, Birnstiel ML (1992) Influenza virus hemagglutinin HA-2 N-terminal fusogenic peptides augment gene transfer by transferrin-polylysine-DNA complexes: toward a synthetic virus-like gene-transfer vehicle. Proc Natl Acad Sci U S A 89:7934 –7938. Weaver JC (1995) Electroporation theory. Concepts and mechanisms. Methods Mol Biol 55:3–28. Wortwein G, Yu J, Toliver-Kinsky T, Perez-Polo JR (1998) Responses of young and aged rat CNS to partial cholinergic immunolesions and NGF treatment. J Neurosci Res 52:322–333. Xia H, Mao Q, Eliason SL, Harper SQ, Martins IH, Orr HT, Paulson HL, Yang L, Kotin RM, Davidson BL (2004) RNAi suppresses polyglutamine-induced neurodegeneration in a model of spinocerebellar ataxia. Nat Med 10:816 – 820. Xia H, Mao Q, Paulson HL, Davidson BL (2002) siRNA-mediated gene silencing in vitro and in vivo. Nat Biotechnol 20:1006 –1010. Zhang Y, Boado RJ, Pardridge WM (2003) In vivo knockdown of gene expression in brain cancer with intravenous RNAi in adult rats. J Gene Med 5:1039 –1045. Zhang Y, Jeong Lee H, Boado RJ, Pardridge WM (2002) Receptormediated delivery of an antisense gene to human brain cancer cells. J Gene Med 4:183–194.

(Accepted 2 March 2008) (Available online 22 March 2008)