Targeting CHK1 inhibits cell proliferation in FLT3-ITD positive acute myeloid leukemia

Leukemia Research 38 (2014) 1342–1349

Contents lists available at ScienceDirect

Leukemia Research journal homepage: www.elsevier.com/locate/leukres

Targeting CHK1 inhibits cell proliferation in FLT3-ITD positive acute myeloid leukemia Ling Li Yuan a,d , Alexa Green b , Laure David a , Christine Dozier a , Christian Récher a,c , Christine Didier a , Jérôme Tamburini b , Stéphane Manenti a,∗ a Cancer Research Center of Toulouse, Inserm Unité Mixte de Recherche 1037, CNRS Equipe de Recherche labellisée 5294, Université de Toulouse, Centre Hospitalier Universitaire Purpan, Toulouse, France b Institut Cochin, Université Paris Descartes, CNRS UMR 8104, INSERM U 1016, Paris, France c Service d’Hématologie, Centre Hospitalier Universitaire Purpan, Toulouse, France d Department of Hematology, The Second Xiangya Hospital, Central South University, Changsha, Hunan 410011, PR China

a r t i c l e

i n f o

Article history: Received 24 February 2014 Received in revised form 4 July 2014 Accepted 30 August 2014 Available online 16 September 2014 Keywords: Acute myeloid leukemia FLT3-ITD CHK1 Cell cycle Cell signaling Proliferation

a b s t r a c t CHK1 Ser/Thr kinase, a well characterized regulator of DNA damage response, is also involved in normal cell cycle progression. In this study, we investigate how CHK1 participates to proliferation of acute myeloid leukemia cells expressing the mutated FLT3-ITD tyrosine kinase receptor. Pharmacological inhibition of CHK1 as well as its shRNA mediated down regulation reduced the proliferation rate of FLT-ITD expressing leukemic cell lines in a cytostatic manner. Flow cytometry analysis revealed no accumulation in a specific phase of the cell cycle upon CHK1 inhibition. Accordingly, lentiviral-mediated CHK1 overexpression increased the proliferation rate of FLT3-ITD expressing cells, as judged by cell viability and [3H] thymidine incorporation experiments. By contrast, expression of a ser280 mutant did not, suggesting that phosphorylation of this residue is an important determinant of CHK1 proliferative function. Clonogenic growth of primary leukemic cells from patients in semi-solid medium was reduced upon CHK1 inhibition, confirming the data obtained with leukemic established cell lines. Surprisingly, 3 out of 4 CHK1 inhibitory compounds tested in this study were also potent inhibitors of the FLT3-ITD tyrosine kinase receptor. Altogether, these data identify CHK1 as a regulator of FLT3-ITD-positive leukemic cells proliferation, and they open interesting perspectives in terms of new therapeutic strategies for these pathologies. © 2014 Elsevier Ltd. All rights reserved.

1. Introduction CHK1 Ser/Thr kinase is a key regulator of cell cycle progression, through its participation in cellular responses to DNA damage or other types of stress. P53, CDC25C, CDC25A, or Wee1 phosphorylation by CHK1 usually leads to Cyclin Dependent Kinases (CDK) inhibition and subsequent cell cycle arrest [1]. In addition to its role in response to DNA damage, CHK1 also displays important functions in unperturbed cell cycle progression, notably during DNA replication or mitosis completion [2–6]. Regarding its essential and multiple functions, CHK1 must be finely regulated to ensure its adequate activity. The major mechanism of CHK1 regulation consists in its phosphorylation by ATR

∗ Corresponding author at: INSERM U1037 CRCT, CHU Purpan, Bat B, BP3028, 31024 Toulouse Cedex 3, France. Tel.: +33 562 74 45 24. E-mail address: [email protected] (S. Manenti). http://dx.doi.org/10.1016/j.leukres.2014.08.020 0145-2126/© 2014 Elsevier Ltd. All rights reserved.

on Ser 345 and 317 residues, which leads to catalytic activation and is currently considered as a hallmark of CHK1 activity level. In addition, autophosphorylation on Serine 296 also participates to the activation process [7], and phosphorylations catalyzed by CDK1 and CDK2 on Serine 286 and Serine 301 were reported to influence CHK1 functions at the G2/M transition and in response to DNA damage [8,9]. Although its subcellular localization has not been extensively questioned, interesting studies in a PTEN −/− model pointed to the phosphorylation of CHK1 on Ser 280 by the Akt/PKB kinase [10,11], leading to retention of the protein in the cytoplasmic compartment of these cells. The occurrence of this process in other biological models has been recently questioned [12,13]. Acute myeloid leukemia (AML) is a group of myeloid malignancies characterized by a differentiation blockade occurring at different stages of the hematopoietic process, and by excessive proliferation of leukemic cells. Mutations of the FLT3 tyrosine kinase receptor are found in 25–30% of patients, the FLT3-ITD (Internal Tandem Duplication) being the most commonly detected [14].

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349

FLT3-ITD expression participates to increased proliferation rates and cell death resistance, due to constitutive activation of the receptor and of various downstream signaling pathways, including the PI3K/Akt signaling module and the STAT5 transcription factor [15–19]. Pim1 Ser/Thr kinase is one of the important transcriptional targets of STAT5 in these leukemic cells, and the role of Pim1 and Pim2 in the oncogenic process mediated by FLT3 has been documented [20,21]. The importance and the status of CHK1 in AML have been poorly investigated up to now [22,23]. We recently described constitutive activation of this kinase in these pathologies, especially in patients with complex karyotype and poor prognosis [24,25], and we proposed that CHK1 inhibition may sensitize leukemic cells to genotoxic treatments [26]. More recently, we described that Pim1/2 phosphorylate CHK1 on Serine 280 in leukemic cells, and that this event facilitates CHK1-dependent cell cycle arrest and cell death resistance in response to genotoxic agents [13]. We show here that CHK1 also governs the normal proliferation of FLT3-ITD leukemic cells, independently of its role in checkpoint establishment, and that Serine 280 phosphorylation is important for this function. Consequences in terms of therapeutic targeting in these pathologies are discussed.

1343

2.4. Clonogenic assays Primary cells from patients were thawed and adjusted to 1 × 105 cells/ml final concentration and grown in H4230 Stem Cell Technologies methyl cellulose medium (Stem Cell Technologies, Vancouver, BC) supplemented with 10% 5637-CM as a stimulant [27], and increasing concentrations of SCH900776 (0, 250 and 500 nM). The cells were then plated in 35-mm Petri dishes in duplicate and allowed to incubate for 7 days in a humidified CO2 incubator (5% CO2 , 37 ◦ C). At day 7, the leukemic colonies (more than 20 cells) and clusters (more than 5 cells) were scored under an inverted microscope. 2.5. Proliferation assay Measurements were made according to manufacturer’s instructions (CellTiter 96® AQueous One Solution Cell Proliferation Assay, Promega). Briefly, 20 ␮l of MTS reagent was added directly to the wells with 100 ␮l cell suspension was incubated at 37 ◦ C for 3 h. Absorbance was measured at 490 nm (Mithras LB 940, Berthold technologies). Background absorbance was first subtracted using a set of wells containing medium only, then the OD value was shown.

2. Materials and methods 2.6. Lentiviral infections 2.1. Pharmacological inhibitors and antibodies The FLT-3 inhibitor III was purchased from Calbiochem (San Diego, CA, USA). CHK1 inhibitor SCH-900776 was from Active Biochem (Maplewood, NJ, USA), AZD7762 was a kind gift from AstraZeneca to CD, UCN-01 was provided by the National Cancer Institute, and CHIR-124 was purchased from Selleckbio (Selleck Chemicals, USA). The antibodies used were: monoclonal anti-CHK1 (G4), polyclonal anti-Flt3/Flt2 (C-20) (Santa Cruz, CA, USA), polyclonal anti-phospho-Ser280-CHK1 from Abgent (San Diego, CA, USA), polyclonal anti-phospho-Tyr591-Flt3 and anti-STAT5 from Cell Signaling Technology (Beverly, MA, USA), monoclonal antiphospho-STAT5 (Tyr694/699) from Millipore (Billerica, MA, USA), and monoclonal anti-tubulin from Sigma (Saint Louis, MO, USA). 2.2. Cell lines and culture conditions Human myeloid leukemia cell lines MV4-11 and K562 (DSMZ, Braunschweig, Germany) MOLM-14 (kindly provided by Martin Carroll, University of Pennsylvania, Philadelphia, PA, USA) were cultured in RPMI medium supplemented with 10% fetal bovine serum (FBS) (Invitrogen, Carlsbad, CA). Murine FLT3-ITD-expressing Ba/F3 cells were cultured in MEM␣ medium supplemented with 10% FBS and 2 mM l-glutamine. All cells were grown in the presence of 100 units/ml of penicillin and 100 ␮g/ml of streptomycin at 37 ◦ C and 5% CO2 .

We generated Chk1 Ser 280 mutated to Ala by using site directed mutagenesis with forward primer 5 CCCCGAGTCACTGCAGGTGGTGTGTC 3 and reverse primer 5 GACACACCACCTGCAGTGACTCGGGG 3 . To generate lentiviral vectors expressing CHK1 proteins, WT or mutated S280A HA-CHK1 sequences were cloned into the pTrip-TAL-Ires-GFP lentiviral vector. We used 293T packaging cells, co-transfected with lentiviral protein (GAG, POL, and ENV) encoding plasmids, and plasmids containing GFP (as a control), CHK1 or CHK1 S280A genes, separately. Supernatants containing lentivirus were collected 48 h after transfection, then during 3 consecutive days, and stored at −80 ◦ C. Same approach was used for shRNA particules production (TRCN0000039855NM 001274.21378s1c1TRC1, Sigma). Murine FLT3-ITD-expressing BA/F3 cells were plated at 5 × 105 cells in 200 ␮l in serum-free medium and 5 ␮l of lentiviral supernatant was added during 3 h. Cells were then grown in 10% FBS medium. The percentage of infected cells was then determined by flow cytometry GFP detection, allowing subsequent GFP-positive cell sorting. 2.7. [3H]Thymidine proliferation assay 5 × 104 FLT3-ITD-expressing BA/F3 cells were incubated 48 h in 100 ␮l of 5% FCS supplemented MEM, and then pulsed for 6 h with [3H]thymidine (1 ␮Ci, [37 kBq]). The amount of radioactivity incorporated to neo-synthetized DNA was then determined after trichloracetic acid precipitation.

2.3. Patient samples

2.8. Cell viability assay

Leukemic blasts from patients with diagnosed AML have been obtained after informed consent and stored at the HIMIP collection. According to the French law, HIMIP collection has been declared to the Ministry of Higher Education and Research (DC 2008-307 collection 1) and obtained a transfer agreement (AC 2008-129) after approbation by the “Comité de Protection des Personnes Sud-Ouest et Outremer II” (ethical committee). Clinical and biological annotations of the samples have been declared to the CNIL (Comité National Informatique et Libertés i.e., Data processing and Liberties National Committee). Frozen cells were thawed in IMDM medium with 20% FBS and immediately processed for clonogenic assays (see “Section 2.4”).

2.5 × 104 FLT3-ITD-expressing BA/F3 cells were plated in 100 ␮l of 5% FCS supplemented MEM during 48 h. The UptiBlueTM viable cell counting reagent (Interchim, Montlucon, France) was then added during 3 h according to manufacturer’s instructions, and the fluorescence was measured using a typhoon 8600 scanner. 2.9. Western blot analysis Cells (2 × 106 ) were usually in 100 ␮l of Laemmli sample buffer, sonicated for 7 s, and boiled for 3 min. Proteins were then resolved on 4–12% gradient SDS-PAGE and transferred to nitrocellulose membrane. Saturation of the membrane was done for

1344

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349

1 h in TBS with Tween 0.1% (TBS-T) containing 5% nonfat milk or 5% bovine serum albumin (BSA). Membranes were blotted with proper antibodies overnight at 4 ◦ C or for 1 h at room temperature, washed thrice with TBS-T, and incubated for 30 min with HRP-conjugated secondary antibody (Promega). After three additional washes, detection was achieved with Supersignal Westpico chemiluminescent substrate (Perkin Elmer, Shelton, CT). 2.10. Apoptosis and cell cycle analysis Cells were harvested and fixed in ice-cold 70% ethanol, permeabilized with PBS-0.25% Triton X-100, and stained with propidium iodide. Data were collected on a BD FACSCalibur cytometer and analyzed using the Cell Quest (Becton Dickinson, Franklin Lakes, NJ, USA) and FlowJo software (Treestar, Ashland, USA). Apoptotic cells were detected with Annexin V-FITC detection kit from BD PharMingen (San Diego, CA, USA) according to the manufacturer instructions. 3. Results 3.1. CHK1 inhibition reduces proliferation of FLT3-ITD cells We used MV4-11 as a model of human AML cell line expressing the FLT3-ITD receptor. When exponentially growing MV4-11 cells were treated with either of the 4 different CHK1 inhibitors, we observed a dose- and time-dependent inhibition of cell proliferation (Fig. 1). As a comparison, the effect of FLT3 inhibition on MV4-11 cells proliferation is shown in Fig. 1A. By contrast, the FLT3-ITD negative and BCR-ABL positive leukemic cell line K562 was insensitive to the CHK1 inhibitors SCH900776 and AZD7762,

as well as to the FLT3 inhibitor (Supplementary Fig. 1). These data suggest that CHK1 participates to normal proliferation of leukemic cells expressing FLT3-ITD. Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres.2014.08.020. To control the efficacy of CHK1 inhibitors, we followed phosphorylation of Ser 345, a hallmark of CHK1 inhibition. Indeed, phosphorylation of this residue is currently used as a marker of ATR-dependent activation, but it was also reported that pharmacological inhibition of CHK1 leads to Ser345 phosphorylation, due to regulatory loop involving PP2A phosphatase inhibition or DNA damage induction [28]. As observed in Supplementary Fig. 2, SCH900776, and to a lesser extent UCN-01, CHIR-124, and AZD7762 induced CHK1 Ser 345 phosphorylation at concentrations inhibiting cell proliferation, confirming their efficacy in this model. Supplementary Fig. S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres.2014.08.020. In order to confirm these data, we performed shRNA-mediated down-regulation of CHK1 in MV4-11 and MOLM-14 cells. As shown in Fig. 2, this significantly reduced cell proliferation in both cell lines, confirming the data obtained with pharmacological inhibitors. Altogether these data demonstrate that CHK1 is an important actor of cell proliferation in FLT3-ITD leukemic cells. We then questioned the specificity of these inhibitors by determining their impact on FLT3-ITD-dependent signaling pathways. Surprisingly, we observed that AZD7762, UCN-01 and CHIR-124 triggered FLT3-ITD tyr 591 dephosphorylation, as well as a drop in STAT5 activation levels (Fig. 3B–D). These data suggest either direct inhibition of FLT3-ITD by these drugs, or the existence of a signaling feedback loop between CHK1 and FLT3. However, the fact that SCH900776 efficiently inhibited CHK1 without any impact on

Fig. 1. Proliferation rates of FLT3-ITD MV4-11 cells upon treatment with CHK1 inhibitors. Exponentially growing MV4-11 cells seeded at 1 × 105 cells/well in 96-well plates were treated with different inhibitors. Cell viability was assessed daily by using the MTS assay. (A) Cells were treated with Flt3 inhibitor III (50 nM) or Chk1 inhibitor AZD7762 (0.5 nM); (B) cells were treated with Chk1 inhibitor SCH900776 (250 nM and 500 nM); (C) cells were treated with Chk1 inhibitor UCN01 (50 nM, 100 nM and 300 nM); (D) cells were treated with Chk1 inhibitor CHIR124 (50 nM, 100 nM and 300 nM). The results are means ± SEM of three independent experiments, each run performed in triplicate.

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349

1345

Fig. 2. CHK1 knock-down impairs leukemic cell proliferation. MTS proliferation assay of MV4-11 (A) and Molm14 (B) leukemic cells transduced with shRNA control or against CHK1. CHK1 protein levels were determined by Western blot (lower panels). Briefly, 48 h after CHK1 knock-down with shRNA, leukemic cells were incubated for additional 24 h on growing conditions. Data shown are representative of 2 independent experiments.

FLT3-ITD or STAT5 activity (Fig. 3A) strongly argues for the first hypothesis. Altogether these data indicate that AZD7762, UCN-01 and CHIR-124 are also potent inhibitors of the FLT3-ITD tyrosine kinase receptor. In the next experiments, in order to specifically question CHK1 functions, we essentially used SCH900776 at a

concentration of 500 nM, which does not affect FLT3 activity but completely blocks MV4-11 cells proliferation (Fig. 3). As a control, similar experiments were performed in a murine Ba/F3 cell line expressing human FLT3-ITD. SCH900776 reduced proliferation of these cells (Supplementary Fig. 3) at concentrations

Fig. 3. Specificity of Chk1 inhibitors in MV4-11 leukemic cells. Exponentially growing MV4-11 cells were treated for 2 h with Chk1 inhibitors at different dose as described in Fig. 1, then p-Flt3 and Flt3, p-Stat5 and Stat5, were detected by western blot. Tubulin was used as loading control. (A) Cells were treated with SCH900776 (250 nM and 500 nM); (B) cells were treated with Flt3 inhibitor III (50 nM) or AZD7765 (0.5 nM); (C) cells were treated with UCN01 (50 nM, 100 nM and 300 nM); (D) cells were treated with CHIR124 (50 nM, 100 nM and 300 nM). Data are representative of three independent experiments.

1346

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349

Fig. 4. Impact of CHK1 inhibitors on cell cycle progression. Exponentially growing MV4-11 leukemic cells were treated for 24 h with DMSO (1/1000e ) (A) or SCH900776 at 500 nM (B) or Flt3 inhibitor III at 50 nM (C) or AZD7762 at 0.5 nM (D). Cell cycle analysis was performed. Quantification of the sub-population fractions of the histograms was performed by software FlowJo.

inhibiting CHK1 activity (Supplementary Fig. 4) without modifying FLT3-ITD/STAT5 signaling pathway (Supplementary Fig. 5). Supplementary Figs. S3–S5 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres. 2014.08.020. 3.2. Impact of CHK1 inhibitors on cell cycle progression and cell death in leukemic cell lines We then investigated how CHK1 inhibition may affect FLT3ITD-positive cells proliferation. First, Annexin V labeling analysis indicated that SCH900776 did not significantly trigger apoptotic cell death in FLT3-ITD positive cells (data not shown) at a concentration inhibiting cell proliferation. To further precise the mechanisms of this inhibition, we then investigated the impact of CHK1 inhibition on cell cycle progression. As shown in Fig. 4, treatment with SCH900776 did not dramatically modify the cell cycle profile of MV4-11 cells, with a moderate accumulation in G1 and a corresponding decrease of the G2/M phase. Since proliferation was completely blocked at this concentration (see Fig. 1), this suggests that cell proliferation arrest occurred at different phases. As a control, the FLT3 inhibitor induced a clear G1 accumulation and an S phase depletion of MV4-11 cells (Fig. 4C), as did AZD7762 (Fig. 4D), in good accordance with its effect on FLT3-ITD activity. Altogether, these data argue for the occurrence of a cytostatic effect of CHK1 inhibition in FLT3-ITD AML cells.

3.3. Impact of CHK1 inhibitors on clonogenicity of primary leukemic cells from patients We then investigated the impact of CHK1 inhibition on the clonogenic potential of 3 samples from FLT3-ITD positive AML patients. Treatment with SCH900776 dramatically decreased the clonogenic growth of leukemic progenitor cells (Fig. 5), at the same concentrations found to inhibit cell lines proliferation, further underlying CHK1 as a key regulator of FLT3-ITD-dependent proliferation. We did not detect significant cell death in the bulk of cells treated with this inhibitor (data not shown), suggesting that clonogenicity reduction occurs through proliferation inhibition, as observed for the MV4-11 cell line (Fig. 4). 3.4. CHK1 overexpression increases proliferation of FLT3-ITD cells Since CHK1 inhibition induced leukemic cells proliferation arrest, we reasoned that overexpressing CHK1 may have an opposite positive effect on proliferation of FLT3-ITD expressing cells. To test this hypothesis, we thus expressed CHK1 through lentiviral infection in FLT3-ITD-positive Ba/F3 cells. Exogenous CHK1 was expressed at moderate level, equivalent to the endogenous protein (Supplementary Fig. 6). As shown in Fig. 6, exogenous CHK1 expression significantly improved the viability of these cells as compared to control (Fig. 6A), without modifying their basal apoptotic level (not shown). [3H]Thymidine incorporation experiments indicate

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349

1347

Fig. 5. Impact of CHK1 inhibition on the clonogenic capacities of primary cells from FLT3/ITD-positive patients. Primary cells from patients were thawed as described in Section 2, and plated at a concentration of 1 × 105 cells/ml in duplicate, in the presence (250 nM and 500 nM) or absence of SCH900776. The number of colonies was scored at day 7. Results are expressed as percentage of control (untreated). The characteristics of these primary samples are as follows: Patient 1: FAB4, bone marrow, intermediate risk, 92% blasts. Patient 2: FAB4, blood, intermediate risk, 80% blasts. Patient 3: FAB2, bone marrow, high risk, 61% blasts.

that DNA replication rate was significantly augmented (Fig. 6B) by CHK1 overexpression, suggesting that moderate increase in CHK1 protein level accelerates cell proliferation. These data appear in good agreement with the pharmacological inhibition experiments shown in Fig. 1. Supplementary Fig. S6 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.leukres. 2014.08.020.

3.5. Ser280 phosphorylation of CHK1 is important for its implication in leukemic cells proliferation In a recent work, we described phosphorylation of CHK1 at S280 by the Ser/Thr kinase Pim downstream of FLT3-ITD, and the impact of this phosphorylation on the DNA damage response elicited by CHK1 [13]. In consequence, we tested if Serine 280 phosphorylation is also necessary for the CHK1 proliferative

Fig. 6. Ser 280 phosphorylation is important for CHK1-dependent proliferation of FLT3-ITD positive cells. Ba/F3 FLT3-ITD cells expressing either GFP as a control, wild type CHK1, or CHK1 S280A, were generated by lentiviral infection as described in the “Section 2”. Control, CHK1-WT and CHK1 S280A cells were plated in triplicate at 105 (proliferation) or 2.5 × 103 (viability) in 100 ␮l of 10% FCS supplemented medium during 48 h. Cell viability was measured by UptiBlueTM viable cell counting (A) and proliferation was determined by [3H]Thymidine incorporation (1 ␮Ci, [37 kBq]) (B) and results are expressed in beats per minute (bpm). Vertical bars indicate standard deviations. Comparisons were operated by Student t-test (ns = not significant and *p < 0.05; **p < 0.01).

1348

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349

function described here. First, exogenously expressed wild type CHK1was phosphorylated on Ser 280, and pharmacological inhibition of FLT3 suppressed this phosphorylation (not shown). In these experiments performed in Ba/F3 FLT3-ITD expressing cells, both wild type and Serine 280 mutated CHK1 (S280A, unphosphorylated mutant) were expressed at similar levels (Supplementary Fig. 5). By contrast with wild type CHK1, expression of this mutant did not increase the proliferation rate of these cells (Fig. 6B), demonstrating that Ser 280 phosphorylation is a key determinant of CHK1-dependent proliferation downstream of FLT3-ITD.

4. Discussion In this work, we demonstrate that Chk1 is an important mediator of leukemic cells proliferation down-stream of the oncogenic tyrosine kinase receptor FLT3-ITD, independently of its DNA damage response function. The involvement of Chk1 in normal proliferation of different cell types has been described, and various mechanisms occurring at different phases of the cell cycle and supporting this function have been proposed [2–6]. Our cell cycle analysis in response to pharmacological inhibition of CHK1 in MV411 cells appears in good agreement with these data, since we did not observe massive accumulation in any specific phase of the cell cycle. Intriguingly, according to these results, cell proliferation arrest also occurred in G1, suggesting the existence of CHK1 functions in this phase. Further studies are needed to establish which substrates of CHK1 regulate cell proliferation of leukemic cells. The status of CHK1 expression and activation was poorly investigated in AML. In a previous work, we described constitutive phosphorylation of Ser 345 and Ser 317 activating residues in AML with complex karyotype, and we linked this phosphorylation state with higher sensitivity to CHK1 inhibition [25,26]. The origin of this phosphorylation remains unclear and did not correlate with constitutive DNA damage in these cells. Our present results suggest that Ser 345 and Ser 317 phosphorylation levels are not sufficient markers to estimate the activation state of CHK1 in cancer cells. Taking into account other modifications of the protein, like Ser 296 autophosphorylation or Ser 280 regulatory phosphorylation would be more relevant and probably facilitate its identification as a therapeutic target in AML and in other cancers. We recently described Ser 280 phosphorylation of CHK1 by Pim1/2 in FLT3-ITD positive AML cells, and the importance of this event for resistance to DNA damaging agents [13]. Our present results indicate that this regulation of CHK1 by Pim is also important for its proliferative function. Pim kinases are frequently over-expressed in AML [29], independently of FLT3 mutational status, and recent studies point to the importance of Pim2 in the regulation of the mTOR pathway in these pathologies [30,31]. Pim1/2 are constitutively active kinases and their activity supports in vitro and in vivo tumor cell growth and survival through multiple substrates, including cell cycle and apoptosis regulators [32]. In light of this, many reports provide new insights into their oncogenic action, and support the development of Pim specific inhibitors as anti-cancer agents to increase the efficacy of conventional therapies. Interestingly, a recently described pharmacological Pim inhibitor was also characterized as a potent Flt3-ITD inhibitor, with a potential clinical interest linked to this double specificity characteristic [31]. This is reminiscent of our present observation that three independent CHK1 inhibitors also efficiently inhibit FLT3 receptor activity in leukemic cells. In fact, although these results sound surprising, IC50s for FLT3 inhibition compatible with these data had been measured in previous studies describing these compounds (for a review on CHK1 inhibitors see [32]). A consequence of these observations is that such molecules could be considered as

possible double specificity inhibitors aimed at targeting both the FLT3 receptor activity and the Ser/Thr kinase CHK1. CHK1 is an essential regulator of DNA damage checkpoint and of resistance to genotoxic agents, and is considered to this respect as an interesting target in many cancers in association with DNA damaging drugs. Several pharmacological inhibitors against this kinase have been developed and tested in clinical trials, including SCH 900776 in AML. Here we also identify CHK1 as an important player of the FLT3-ITD- and Pim-dependent proliferation of leukemic cells, suggesting that its inhibition or that of upstream regulators could be considered for more personalized treatment of these pathologies independently of the association with DNA damaging agents. Considering together our different studies, we propose to consider CHK1 inhibition in association with conventional chemotherapy (daunorubicin/aracytin) as a preferential protocol in complex karyotype and FLT3-ITD AML subgroups, and single CHK1 inhibition as an interesting alternative in this latter category. This opens the interesting question of how the cellular signaling landscape may influence the functionality of this kinase, and specially its relative importance for unperturbed cell cycle progression. To this respect, our data obtained with the BCR-ABL positive leukemic cell line K562 are interesting, since they suggest that CHK1 function in cell proliferation may differ depending on the cell environment. Indeed, CHK1 inhibition did not significantly affect the proliferation process in this model, although the two models (MV4-11 and K562) are characterized by the expression of an oncogenic tyrosine kinase leading to the activation of similar signaling networks. This further reinforces the idea that careful and multiparameter characterization of CHK1 will be necessary to establish its potential therapeutic target status in different oncogenic contexts. Conflict of interest statement No potential conflicts of interest were disclosed. Acknowledgements We are very grateful to Dr. Cécile Demur and Prof. Eric Delabesse for managing and characterization of primary samples. We also thank Dr. Ramon Parsons (Columbia University), for kindly providing us with the CHK1 expression plasmids. We thank Fatima L’Faqihi for technical assistance at the cytometry and cell sorting facility of INSERM 1043, Toulouse. This work was supported by the Association GAEL (Gael Adolescent Espoir Leucémie), by the Institut National de la Santé et de la Recherche Médicale (INSERM), by the Centrr National de la Recherche Scientifique (CNRS), by the Association pour la Recherche contre le Cancer (ARC, grant SFI20101201865), by the Ligue Nationale Contre le Cancer 31, and by the Laboratoire d’Excellence Toulouse Cancer LABEX TOUCAN (Integrative analysis of resistance in hematological cancers). Lingli Yuan is a recipient of the China Scholarship Council and of the Société Franc¸aise d’Hématologie (SFH). References [1] Dai Y, Grant S. New insights into checkpoint kinase 1 in the DNA damage response signaling network. Clin Cancer Res 2010;16:376–83. [2] Petermann E, Maya-Mendoza A, Zachos G, Gillespie DA, Jackson DA, Caldecott KW. Chk1 requirement for high global rates of replication fork progression during normal vertebrate S phase. Mol Cell Biol 2006;26:3319–26. [3] Petermann E, Woodcock M, Helleday T. Chk1 promotes replication fork progression by controlling replication initiation. Proc Natl Acad Sci U S A 2010;107:16090–5. [4] Syljuasen RG, Sørensen CS, Hansen LT, Fugger K, Lundin C, Johansson F, et al. Inhibition of human Chk1 causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage. Mol Cell Biol 2005;25:3553–62.

L.L. Yuan et al. / Leukemia Research 38 (2014) 1342–1349 [5] Krämer A, Mailand N, Lukas C, Syljuåsen RG, Wilkinson CJ, Nigg EA, et al. Centrosome-associated Chk1 prevents premature activation of cyclin-B-Cdk1 kinase. Nat Cell Biol 2004;6:884–91. [6] Zachos G, Black EJ, Walker M, Scott MT, Vagnarelli P, Earnshaw WC, et al. Chk1 is required for spindle checkpoint function. Dev Cell 2007;12:247–60. [7] Kasahara K, Goto H, Enomoto M, Tomono Y, Kiyono T, Inagaki M. 14-3-3gamma mediates Cdc25A proteolysis to block premature mitotic entry after DNA damage. EMBO J 2010;29:2802–12. [8] Xu N, Libertini S, Black EJ, Lao Y, Hegarat N, Walker M, et al. Cdk-mediated phosphorylation of Chk1 is required for efficient activation and full checkpoint proficiency in response to DNA damage. Oncogene 2012;31:1086–94. [9] Enomoto M, Goto H, Tomono Y, Kasahara K, Tsujimura K, Kiyono T, et al. Novel positive feedback loop between Cdk1 and Chk1 in the nucleus during G2/M transition. J Biol Chem 2009;284:34223–30. [10] King FW, Skeen J, Hay N, Shtivelman E. Inhibition of Chk1 by activated PKB/Akt. Cell Cycle 2004;3:634–7. [11] Puc J, Keniry M, Li HS, Pandita TK, Choudhury AD, Memeo L, et al. Lack of PTEN sequesters CHK1 and initiates genetic instability. Cancer Cell 2005;7:193–204. [12] Li P, Goto H, Kasahara K, Matsuyama M, Wang Z, Yatabe Y, et al. P90 RSK arranges Chk1 in the nucleus for monitoring of genomic integrity during cell proliferation. Mol Biol Cell 2012;23:1582–92. [13] Yuan LL, Green AS, Bertoli S, Grimal F, Mansat-De Mas V, Dozier C, et al. Pim kinases phosphorylate Chk1 and regulate its functions in acute myeloid leukemia. Leukemia 2013, http://dx.doi.org/10.1038/leu.2013.168 (Advance online publication). [14] Swords R, Freeman C, Giles F. Targeting the FMS-like tyrosine kinase 3 in acute myeloid leukemia. Leukemia 2012;26:2176–85. [15] Chung KY, Morrone G, Schuringa JJ, Wong B, Dorn DC, Moore MA. Enforced expression of an Flt3 internal tandem duplication in human CD34+ cells confers properties of self-renewal and enhanced erythropoiesis. Blood 2005;105:77–84. [16] Hayakawa F, Towatari M, Kiyoi H, Tanimoto M, Kitamura T, Saito H, et al. Tandem-duplicated Flt3 constitutively activates STAT5 and MAP kinase and introduces autonomous cell growth in IL-3-dependent cell lines. Oncogene 2000;19:624–31. [17] Kiyoi H, Naoe T. FLT3 in human hematologic malignancies. Leuk Lymphoma 2002;43:1541–7. [18] Mizuki M, Schwable J, Steur C, Choudhary C, Agrawal S, Sargin B, et al. Suppression of myeloid transcription factors and induction of STAT response genes by AML-specific Flt3 mutations. Blood 2003;101:3164–73. [19] Stirewalt DL, Radich JP. The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer 2003;3:650–65.

1349

[20] Kim KT, Baird K, Ahn JY, Meltzer P, Lilly M, Levis M, et al. Pim-1 is up-regulated by constitutively activated FLT3 and plays a role in FLT3-mediated cell survival. Blood 2005;105:1759–67. [21] Grundler R, Brault L, Gasser C, Bullock AN, Dechow T, Woetzel S, et al. Dissection of PIM serine/threonine kinases in FLT3-ITD-induced leukemogenesis reveals PIM1 as regulator of CXCL12-CXCR4-mediated homing and migration. J Exp Med 2009;206:1957–70. [22] Amico D, Barbui AM, Erba E, Rambaldi A, Introna M, Golay J. Differential response of human acute myeloid leukemia cells to gemtuzumab ozogamicin in vitro: role of Chk1 and Chk2 phosphorylation and caspase 3. Blood 2003;101:4589–97. [23] Sampath D, Cortes J, Estrov Z, Du M, Shi Z, Andreeff M, et al. Pharmacodynamics of cytarabine alone and in combination with 7-hydroxystaurosporine (UCN-01) in AML blasts in vitro and during a clinical trial. Blood 2006;107: 2517–24. [24] Didier C, Cavelier C, Quaranta M, Galcera MO, Demur C, Laurent G, et al. G2/M checkpoint stringency is a key parameter in the sensitivity of AML cells to genotoxic stress. Oncogene 2008;27:3811–20. [25] Cavelier C, Didier C, Prade N, Mansat-De Mas V, Manenti S, Recher C, et al. Constitutive activation of the DNA damage signaling pathway in acute myeloid leukemia with complex karyotype: potential importance for checkpoint targeting therapy. Cancer Res 2009;69:8652–61. [26] Didier C, Demur C, Grimal F, Jullien D, Manenti S, Ducommun B. Evaluation of checkpoint kinase targeting therapy in acute myeloid leukemia with complex karyotype. Cancer Biol Ther 2012;13:307–13. [27] Quentmeier H, Zaborski M, Drexler HG. The human bladder carcinoma cell line 5637 constitutively secretes functional cytokines. Leuk Res 1997;21: 343–50. [28] Parsels LA, Qian Y, Tanska DM, Gross M, Zhao L, Hassan MC, et al. Assessment of chk1 phosphorylation as a pharmacodynamic biomarker of chk1 inhibition. Clin Cancer Res 2011;17:3706–15. [29] Nawijn MC, Alendar A, Berns A. For better or for worse: the role of Pim oncogenes in tumorigenesis. Nat Rev Cancer 2011;11:23–34. [30] Tamburini J, Green AS, Bardet V, Chapuis N, Park S, Willems L, et al. Protein synthesis is resistant to rapamycin and constitutes a promising therapeutic target in acute myeloid leukemia. Blood 2009;114:1618–27. [31] Hospital MA, Green AS, Lacombe C, Mayeux P, Bouscary D, Tamburini J. The FLT3 and Pim kinases inhibitor SGI-1776 preferentially target FLT3-ITD AML cells. Blood 2012;119:1791–2. [32] Maugeri-Saccà M, Bartucci M, De Maria R. Checkpoint kinase 1 inhibitors for potentiating systemic anticancer therapy. Cancer Treat Rev 2013;39:525– 33.