TATA box recognition†1

doi:10.1006/jmbi.2000.3797 available online at http://www.idealibrary.com on

J. Mol. Biol. (2000) 299, 965±977

Signals for TBP/TATA Box Recognition{ Avital Bareket-Samish, Ilana Cohen and Tali. E. Haran* Department of Biology Technion, Technion City Haifa 32000, Israel

The TATA box-binding protein (TBP) recognizes its target sites (TATA boxes) by indirectly reading the DNA sequence through its conformation effects (indirect readout). Here, we explore the molecular mechanisms underlying indirect readout of TATA boxes by TBP by studying the binding of TBP to adenovirus major late promoter (AdMLP) sequence variants, including alterations inside as well as in the sequences ¯anking the TATA box. We measure here the dissociation kinetics of complexes of TBP with AdMLP targets and, by phase-sensitive assay, the intrinsic bending in the TATA box sequences as well as the bending of the same sequence induced by TBP binding. In these experiments we observe a correlation of the kinetic stability to sequence changes within the TATA recognition elements. Comparison of the kinetic data with structural properties of TATA boxes in known crystalline TBP/TATA box complexes reveals several ``signals'' for TATA box recognition, which are both on the single base-pair level, as well as larger DNA tracts within the TATA recognition element. The DNA bending induced by TBP on its binding sites is not correlated to the stability of TBP/TATA box complexes. Moreover, we observe a signi®cant in¯uence on the kinetic stability of alteration in the region ¯anking the TATA box. This effect is limited however to target sites with alternating TA sequences, whereas the AdMLP target, containing an A tract, is not in¯uenced by these changes. # 2000 Academic Press

*Corresponding author

Keywords: TBP; TATA box; indirect readout; deformability; ¯anking sequences

Introduction The TATA box-binding protein (TBP) is an essential protein for transcription by all three eukaryotic RNA polymerases. TBP binds the TATA box present at many RNA polymerase II (RNA pol II) promoters, and thus initiates the assembly of the preinitiation complex (reviewed by Hernandez, 1993; Burley & Roeder, 1996). Several {This paper is dedicated to the memory of Paul B. Sigler. Present address: Avital Bareket-Samish, Department of Structural Biology, Fairchild Science Building, D-125, Stanford University School of Medicine, Stanford, CA 94305-5400 USA. Abbreviations used: TBP, TATA-binding protein; yTBPc, C-terminal domain of yeast TBP (yTBP(
1-60)); AdMLP, adenovirus major late promoter; W, adenine or thymine bases; R, adenine or guanine bases; Y, cytosine or thymine bases; A tract or A motif, a sequence of at least four A bases. E-mail address of the corresponding author: [email protected] 0022-2836/00/040965±13 $35.00/0

lines of evidence indicate that the recognition of the TATA box by TBP must mostly be by an indirect-readout mechanism, i.e. recognition of the intrinsic structure of the DNA target or its deformation upon complex formation. First, TBP contacts the TATA box exclusively through the minor groove (Lee et al., 1991; Starr & Hawley, 1991), which is not as informative as the major groove (Seeman et al., 1976). Second, the crystalline structures of TBP/TATA box complexes, which de®ne the TATA box as an eight base-pair (bp) region, show that the interaction in this system is not only exclusively through the minor groove, but is mediated by a limited number of direct hydrogen bonds from the protein to the TATA box, solely to base-pairs 4 and 5 (J.L. Kim et al., 1993; Y. Kim et al., 1993; Kim & Burley, 1994; Nikolov et al., 1996; Juo et al., 1996; Patikoglou et al., 1999, see Table 1 for the numbering scheme). Third, in all crystalline complexes, the DNA is severely distorted, unwound by 120  and bent by 80  towards the major groove, creating a very wide and shallow minor groove. Finally, TBP is known to bind a # 2000 Academic Press

966

Signals for TBP/TATA-box Recognition

large variety of DNA targets with a high level of af®nity (Hahn et al., 1989; Singer et al., 1990), some of which do not conform to the TATA box consensus sequence, TATAWAWR (Bucher, 1990; W, adenine or thymine bases; R, adenine or guanine bases). What are the structural features of TATA boxes that are recognized by TBP? Starr et al. (1995) showed, using circular-permutation analysis and phase-sensitive assay, that TBP/TATA box complexes have bend angles that are sequence dependent, with bend angles ranging from 106  to less than 34  . Furthermore, Starr et al. (1995) showed a correlation between the kinetic stability of TBP/ TATA box complexes and TBP-induced DNA bending. More severe bending by TBP correlated with more stable TBP/TATA box complexes. On the other hand, Patikoglou et al. (1999) have recently shown that the crystalline structures of the DNA targets in the ten complexes of TBP with TATA box variants are all independent of DNA sequence and are similar to the structure of the DNA in the TBP/adenovirus major late promoter (AdMLP) complex. In addition, the global mechanical ¯exibility of TATA boxes was hypothesized in many studies to be a dominant structural feature recognized by TBP. Several studies have shown that more ¯exible TATA boxes are preferred in TBP/TATA box complexes (Grove et al., 1998; Davis et al., 1999). The aim here is to further our understanding of the mechanism of indirect readout, used by TBP in its differential interaction with various TATA boxes. To this end, we studied the interaction of TBP with a set of TATA box variants, based on the AdMLP, which were all within the consensus. We measured the dissociation rate of TBP from the AdMLP variants, and determined the intrinsic bend angle of these targets, as well as the bend angles induced on the DNA double helix upon binding to TBP. We show here that sequences ¯anking the core 8 bp TATA box affect the stability of binding of TBP to its target sites, although there are no direct contacts between TBP and these

regions. However, this effect is sequence dependent. Sequences ¯anking TATA boxes, which contain the more rigid A tract, are not in¯uenced by the nature of these sequences, whereas they will perturb TATA elements containing alternating TA sequences, which are more mechanically ¯exible. Moreover, we ®nd that sequence changes within TATA boxes that lead to more ¯exible TATA boxes form less stable complexes with TBP. The mechanical ¯exibility of certain individual base-pair steps, and especially that of the entire binding site, is correlated with kinetic instability of the complexes. We ®nd that TBP-induced TATA box bending is not correlated with the measured stability of these complexes. Based on our results, we propose additional signals for TATA box recognition, which may suggest how TBP can differentially decode the information encoded in the sequence of different TATA boxes, although the TBP/TATA box interaction is exclusively through the minor groove.

Results We constructed a set of TATA-binding sites based on the adenovirus major late promoter. The set includes two kinds of sequences (Table 1): ®rst, variants of the AdMLP with altered bases con®ned to the 8 bp TATA box (marked by the pre®x wt) and second, binding sites in which the sequences ¯anking the TATA box have also been changed (marked by the pre®x fs). In all our TATA box variants we restricted the changes to be within the consensus sequence, TATAWAWR (Bucher, 1990). Hence, only the 30 half of the TATA box was changed. The TBP fragment used in this study is the Cterminal yeast TBP fragment in which the ®rst 60 residues from the N terminus have been deleted. We refer to this protein as yTBPc. This N-terminal deletion is known to enhance the stability of yTBP complexes during gel electrophoresis (Lieberman et al., 1991; Kuddus & Schmidt, 1993; Starr et al., 1995), and it affects neither the kinetics of complex

Table 1. Binding and bending of AdMLP-related TATA boxes

Name wtMLP fsMLP wtT7A8 wtT5 wt(TA)4 wtT5T7 fsT5T7

Sequencea 12345678 TCGGGCTATAAAAGGGGGTGG TCGGACTATAAAAGCGCGTGC TCGGGCTATAAATAGGGGTGG TCGGGCTATATAAGGGGGTGG TCGGGCTATATATAGGGGTGG TCGGGCTATATATGGGGGTGG TCGGACTATATATGCGCGTGC

Intrinsic bending (deg.)

yTBPc-induced TATA-box bendingb (deg.)

Half-life (minutes)

19(3) 9(3) 18(3) 10(4) 11(2) 11(4) 0

65(4) 67(4) 63(3) 76(4) 65(4) 43(3) 47(3)

266(16) 252(18) 203(13) 118(10) 124(5) 76(4) 118(8)

Numbers in parentheses are the standard error of the mean. It includes the experimental error between the different independent experiments and the difference between the experimental points and the curve-®tting model. a The 8 bp TATA boxes are in bold letters. Bases altered relative to wtMLP are underlined. The numbers above the bases are the numbering scheme of the TATA box. b Bend angles determined at 30  C.

967

Signals for TBP/TATA-box Recognition

dissociation, nor TBP-induced DNA bending (Starr et al., 1995). Stability of yTBPc/TATA box complexes Measuring the binding af®nity of TBP to TATA boxes by protein titration is not feasible, because the observed association rate of TBP with TATA box sequences is very slow (Hoopes et al., 1992; Parvin et al., 1995) and the complexes dissociate during native gel electrophoresis (Hoopes et al., 1992). Therefore, we determined the dissociation rate of yTBPc from the AdMLP variants (Figure 1). The added advantage of using dissociation kinetics to characterize TBP/TATA box interaction is its insensitivity to minor differences in the amount of TBP/TATA box complex formed at time zero. This is because the fraction of DNA complexed to TBP, at the different time-points, is normalized to the fraction of DNA bound at time zero. To subject the yTBPc/TATA box complexes to the shortest possible run on the gel, the samples at the different time-points were removed from the incubation mixture and immediately frozen on liquid nitrogen (Weideman et al., 1997). After the last time-point of the experiment the samples were thawed and immediately loaded onto the gel. This procedure did not affect the stability of yTBPc/TATA box complexes (data not shown). The analysis of the kinetic data showed that the reaction followed ®rst-order dissociation kinetics in the time-range used in this experiment (Figure 1), and displayed the usual log-linear behavior characteristic of sequence-speci®c DNA binding. Signi®cant sequence-dependent changes are observed between the TATA box variants (Table 1). For example, a single change from A5 to T5 (or a dinucleotide change from A4A5 to A4T5) reduced by half the stability of the complex that yTBPc forms with the wild-type AdMLP target, the most stable binding target (compare the half-life of the complexes with wtMLP and with wtT5, Table 1). A change from the A7G8 dinucleotide to T7A8 signi®cantly changed the stability of the corresponding complexes with the wtMLP versus the wtT7A8 targets (Table 1). However, a similar change in the two complexes containing the A4T5 dinucleotide at the center of their TATA box, did not affect their binding kinetics (compare the half-life of the complexes with wtT5 and with wt(TA)4; Figure 1 and Table 1). Changing the sequences that ¯ank the core TATA box, on both sides, did not change the stability of the complex that yTBPc forms with the TATAAAAG targets. However, the stability of the complex of yTBPc with the least stable sequence, wtT5T7, was increased by 64 % when the ¯anking sequences were changed from homopolymeric G tracts to alternating GC tracts (Table 1). Intrinsic bending of TATA box sequences The intrinsic curvature of the AdMLP-related TATA box sequences, shown in Table 1, was deter-

mined by phasing analysis (Zinkel & Crothers, 1987; Kerppola & Curran, 1991; Bareket-Samish et al., 1997, 1998). The results (Figure 2) show that the overall curvature of the TATA boxes has similar contributions from the A motif within the 8 bp core TATA box and from the GGGGG and GGG tracts in the sequence ¯anking it on both sides. wtMLP and wtT7A8 display a similar bend angle, having the largest magnitude in the entire set, 19(3) and 18(3) , respectively (Figure 2 and Table 1). Changing the sequences ¯anking the core TATA box of the wtMLP target reduced its intrinsic curvature by 50 % (compare the curvature of the wtMLP and fsMLP targets, Table 1). The intrinsic bending displayed by the fsMLP target is similar to values obtained in previous determinations of the extent of bending of an isolated A tract (12  , Koo & Crothers, 1988; Shatzky-Schwartz et al., 1997). Replacing the A tract within the core TATA box with alternating (AT)n tracts had a similar effect on the intrinsic curvature of the sequences, as replacing the G tracts in the ¯anking sequences by (GC)n tracts had. Only when we changed both the A tracts within the core TATA box and the G tracts outside it, did we completely abolish the intrinsic bending of the binding site (the fsT5T7 target, Figure 2 and Table 1). This is a novel observation, since large global intrinsic curvature has been previously associated mainly with A tractcontaining sequences (Haran et al., 1994). G tracts were shown signi®cantly to increase A-tract bending when placed next to it (Milton et al., 1990), but to be only slightly bent when phased to themselves (Biburger et al., 1994). However, here we observe similar bend angles of around 10  , in sequences containing only an A tract (fsMLP, Table 1), or only a G tract (wtT5, wt(TA)4, and wtT5T7, Table 1). Studies are in progress to establish the source of this phenomenon (A. Merling, I.C., A.B.-S. and T.E.H., unpublished results). The overall direction of intrinsic bending of the AdMLP variants is such that it places the minor groove of the TATA box at the concave side of the bent DNA molecules, in agreement with previous results on isolated A tracts (Zinkel & Crothers, 1987), and on the orientation of the free TATA box in solution (Davis et al., 1999). Bending in TBP/TATA box complexes We have investigated by phasing analysis the effects of base changes in the AdMLP TATA box on TBP-induced TATA box bending (Figure 3). These bend angles, which measure the capacity of the protein to bend its target sites, are derived from the ratio of the relative mobilities of the bands of the complex, to the relative mobilities of the bands of the unbound DNA. Hence, the intrinsic structure of the unbound target or that of the cloning vector does not in¯uence these bend angles. The results (Figure 3, Table 1) show that the TATA box sequences can be broadly classi®ed into two categories regarding their yTBPc-induced

968

Signals for TBP/TATA-box Recognition

Figure 1. Dissociation kinetics of yTBPc/TATA-box complexes. (a) Gels showing the dissociation kinetics of the yTBPc/wtT5T7 complex and the yTBPc/fsT5T7 complex. Target DNA concentration was 0.4 nM. The concentration of yTBPc active for binding DNA was 27 nM. Competitor DNA concentration was 1.76 mM (65-fold excess over yTBPc). The difference in intensity is due only to a difference is the labeling level of the DNA targets. (b) Fraction of yTBPc molecules bound at time t divided by the fraction of molecules bound at time zero is plotted as a function of time (see Materials and Methods for details). The lines are from the best ®t to a single exponential curve. Filled squares, wtMLP; open squares, fsMLP; ®lled triangles, wtT7A8; open triangles, wtT5; diamonds, wt(TA)4; ®lled circles wtT5T7; open circles, fsT5T7. The shown experimental points are those from only one experiment out of three to six independent experiments conducted with each sequence DNA target. Hence, they may deviate slightly from the averaged values presented in Table 1.

bend angles. Firstly, sequences containing TG as the last dinucleotide of the TATA box have bend angles around 45  . Secondly, sequences containing AG or TA steps at this position have higher bend angles (around 67  ). Contrary to our results on the intrinsic curvature of TATA box sequences, or on the dissociation kinetics of yTBPc/TATA box complexes, the sequences ¯anking the 8 bp TATA boxes do not in¯uence the capacity of the protein to bend its target sites.

The bend angles in the yTBPc/TATA box complexes were measured at 30  C by phasing analysis, and were calibrated by the 30  C values of the standard bend angles. The measured bend angle in the yTBPc/wtMLP complex is smaller by approximately 15 % than the values observed in the crystalline complexes containing this target site (J.L. Kim et al., 1993; Y. Kim et al., 1993; Kim & Burley, 1994; Nikolov et al., 1996; Juo et al., 1996), whereas the bend angle in the yTBPc/wtT5 com-

Signals for TBP/TATA-box Recognition

969

Figure 2. Phase-sensitive assay of intrinsic bending in TATA box sequences. (a) Representative gel for each target site. The number below each gel speci®es the length of the linker between the large intrinsic ``standard bend'' and the site of the cloned test sequence. (b) Relative mobilities of TATA box targets as a function of the linker length. The experimental points are the average of two to four independent experiments. The vertical error bars represent the standard error of the mean, derived from the experimental error between different independent experiments. The line is from the best ®t to a cosine function (Kerppola & Curran, 1991). See Figure 1 for symbols.

plex is more similar to that observed in the crystalline state, within experimental errors (Patikoglou et al., 1999). It could be argued that the difference in bend angles, relative to those observed in the crystalline state, might be ascribed, at least partly,

to the writhed DNA structure observed in the crystalline state. Variations in electrophoretic mobility (through native polyacrylamide gels), between DNA fragments of the same length, are related to differences in the mean-square end-to-end distance

970

Signals for TBP/TATA-box Recognition

Figure 3. Phase-sensitive assay of yTBPc-induced TATA-box bending. (a) Representative gel for each target site. The number below each gel speci®es the length of the linker between the large intrinsic ``standard bend'' and the site of the cloned test sequence. The band above the band of the complex is the larger plasmid fragment generated by the cuts that created the test probes. The band above it is a non-speci®c complex of yTBPc with the large fragment (data not shown). The experiments were conducted at 30  C. (b) Relative mobilities of the bound DNA divided by the relative mobilities of the free DNA are plotted as a function of the linker length. The values shown are the average of four to seven independent experiments. The vertical error bars represent the standard error of the mean, derived from the experimental error between different independent experiments. The line is from the best ®t to a cosine function (Kerppola & Curran, 1991). See Figure 1 for symbols.

971

Signals for TBP/TATA-box Recognition

of the molecules (Lumpkin et al., 1985). Bend angles derived from phasing analysis are twodimensional entities, determined from the differences in mobility between the cis and trans isomers. Therefore, the difference between the crystallographic and solution results may be partly attributed to the difference in the outcome of projecting a three-dimensional curve onto a two-dimensional plane, in the two methods. Our results agree with those of Patikoglou et al. (1999), in that the bend angles in the TBP/TATA box complexes are sequence independent, except for the complexes where the DNA target contains the T7G8 step. The orientation of the yTBPc-induced bend angles (Figure 3) is opposite to that of the intrinsic bends of these sequences, positioning the major groove of the dinucleotide at position 5/6 at the concave side of the bent DNA molecule. The orientation of bending in the complexes agrees with that observed in the crystallographic analyses (J.L. Kim et al., 1993; Y. Kim et al., 1993; Kim & Burley, 1994; Juo et al., 1996; Nikolov et al., 1996; Patikoglou et al., 1999) and in solution (Starr et al., 1995; Davis et al., 1999). Kinetic stability and TBP-induced DNA bending Starr et al. (1995) reported a correlation between the kinetic stability of different TBP/TATA box complexes and TBP-induced DNA bending. We do not ®nd such a correlation with our AdMLP-like TATA boxes (Table 1). Moreover, even the data of Starr et al. (1995) do not support such a correlation, if we consider only the data derived from phasing analysis (Figure 4 of Starr et al., 1995). Correlation between protein-induced DNA bending and protein binding is expected whenever the DNA is wrapped around the protein, as in the case of CAP and the nucleosomes (reviewed by Crothers et al., 1991), because then a larger protein-induced DNA bend angle results in a larger protein-DNA interface. In the TBP/TATA box system, TBP is wrapped around the DNA. Here, larger proteininduced DNA bend angles do not correspond to a larger interaction surface, and hence no correlation should be expected here, nor is it observed. Therefore, differential DNA bending induced by the binding of TBP is probably not a structural source for differential recognition of TATA boxes.

Discussion The role of the flanking sequences in TATA box recognition by TBP The kinetic stability of the yTBPc/TATA box complexes containing the T5/T7 motif increased by 64 % with a change in the ¯anking sequences, whereas the complexes containing the AdMLP motif were unaffected by this change (Figure 1 and Table 1). The ability of sequences outside the core 8 bp TATA box to modulate the stability of the complex with yTBPc must be structural in nature,

because TBP does not contact these sequences. The invariance shown by the complexes with the AdMLP box may be attributed to the dominant and invariable character of A-tract structure, which is not easily perturbed by the nature of the ¯anking sequences (Haran et al., 1994), nor crystal packing environments (Dickerson et al., 1994). The two T5/T7 TATA boxes, on the other hand, contain an alternating (AT)n pattern, shown to have a variable conformation, depending on the sequence context and crystal packing environments (e.g. see Yuan et al., 1992). Thus, the G tracts on either side of the T5/T7 motif may induce a different conformation in the wtT5T7 TATA box, than the alternating GC tracts do in the fsT5T7 target. We propose that the sequence malleability of the T5/T7 motif may be the reason for the effect that the ¯anking sequences have on the dissociation of TBP from the DNA targets containing this motif. The implications of these results are that the sequences ¯anking the core TATA box may, in certain cases, be important for the binding of TBP itself, and not only for binding of the promoters by other transcription factors. These observations are supported by the following observations. Starr & Hawley (1991) observed, using footprinting techniques, that the sequences immediately ¯anking the core TATA box had a minor but signi®cant role in TBP binding. Furthermore, Wong & Bateman (1994) selected TBP-binding sequences from a pool of random oligonucleotides, and observed that the ¯anking sequences had distinct preferences, both upstream and downstream of the 8 bp core TATA box. Finally, Librizzi et al. (1998) have recently observed a 50 % decrease in binding af®nity (attributed to a decrease in the association rate) of the AdMLP TATA box to TBP as a function of the ¯anking sequences. The change was to a sequence containing an A tract (seven bases), which may account for the opposite effect on binding af®nity than that observed here. The pattern of helical twist angles and TBP/TATA box interaction A large body of evidence points to the dominance of indirect readout in the interaction of TBP with TATA boxes. What are the signals for TATA box recognition? We may not have a complete answer to this problem at present, but certain correlations do emerge when comparing the kinetic data presented here with the structural properties of the individual base-pair steps, alone and when in complex with TBP. One of the signals that emanates from such a comparison is the pattern of helical twist angles in TATA boxes, and in particular that at base-pairs 4 and 5 (step 4), the only base-pairs involved in direct hydrogen bonding to TBP. The crystal structures of TBP/TATA box complexes show that the twist angles at the center of the TATA box (step 4, Figure 4) are partitioned into two distinct groups. On the one hand, those containing the A4A5 step

972

Signals for TBP/TATA-box Recognition

Figure 4. Local twist angle versus base-pair step in the crystalline structures of TBP/DNA complexes calculated by the program CURVES (Lavery & Skelenar, 1988). Twist values for aTBP2/ AdMLP and yTBPc/CYC1 are averages of the two complexes in the asymmetric unit. CYC*, DNA sequence as positioned in the yTBPc/CYC1 complex; CYC#, DNA sequence as positioned in the yTFIIAc/yTBPc/CYC1 complex.

have twist angles (for this step) around 12  (J.L. Kim et al., 1993; Nikolov et al., 1996), whereas, those with the A4T5 step have twist angles around 2.6  (Y. Kim et al., 1993; Juo et al., 1996). This pattern persists in ternary complexes with TFIIA (Tan et al., 1996) and TFIIB (Nikolov et al., 1995; Kosa et al., 1997). Both as free DNA and when bound to proteins, TA steps usually adopt high-twist values, whereas AT steps are known to prefer lower than average twist values (analyzed by Olson et al., 1998; Dickerson, 1999). Hence, in alternating (AT)n sequences, such as the E4 target (i.e. wt(TA)4 in Table 1; Juo et al., 1996) there are usually large ¯uctuations in twist values from one base-pair to the next. This pattern of twist angles is observed in the crystalline complex of TBP with the E4 target, although all steps of the TATA box in contact with TBP are untwisted relative to the unbound target. On the other hand, the values for twist angles of AA steps are usually around the values of canonical B-DNA (Olson et al., 1998; Dickerson, 1999). Hence, even though these steps, like the rest of the TATA box, are untwisted in the crystalline complex of TBP with the wtMLP target, they are signi®cantly less unwound relative to A4T5 steps in other TATA box/TBP complexes. We suggest that higher twist angles at this step in TATA boxes, which are possible only when there are AA steps there, may enable a more favorable con®guration needed for optimal direct hydrogen bonding, and may lead to the formation of stable TBP/TATA box complexes. This demonstrates that although the information content of a single base-pair in the minor groove can be limited, the information content of a base-pair step can be suf®cient, by its structural characteristics, for sequence-dependent recognition by proteins.

The base-pair step at position 7/8 The second signal for differential recognition of different TATA boxes resulting from our analysis is the identity of base-pairs 7 and 8 (step 7). We searched the eukaryotic promoter database (EPD) (Bucher, 1996; Cavin Perier et al., 1998) for dinucleotide frequencies at position 7/8 in TATAcontaining promoters. We limited our search to sequences that were within the consensus, TATAWAWN, and hence relevant to the present study (559 sequences). We analyzed the deviation of the observed doublet frequency (in the EPD) from the expected frequency, based on the individual basepairs of that step (Berg & von Hippel, 1987). This analysis showed that the identity of the doublet at position 7/8 is signi®cantly biased in favor of either the TA or the AG step, whereas the AA and TG steps are signi®cantly selected against. All other base-pair steps (of the WN type) were neutral at this position. This pattern, of dinucleotides at position 7/8, appears also when the EPD is searched with the wider consensus (792 sequences) YWTWWAWN (Bucher, 1990). A correlation between the frequency of occurrence of particular DNA base-pairs (or base-pair steps) and their protein-binding propensities has been observed by Berg & von Hippel (1987). The preference for TA steps at position 7/8 is easy to explain. They are often used as natural hinges for DNA bending (reviewed by Olson et al., 1998; Dickerson, 1999). They are well conserved at the upstream kinked T1A2 steps. However, this cannot be the whole story, because then it is dif®cult to understand why TATA boxes with T7G8 steps, which are equally used as natural levers for DNA bending (recently analyzed by Dickerson, 1999), form the least stable complex (Figure 1, Table 1), as well as being under-represented in

Signals for TBP/TATA-box Recognition

natural promoters. Moreover, the equal stability of the wtT5 and the wt(TA)4 complexes (Figure 1, Table 1), containing targets with the A7G8 or the T7A8 step, respectively, is surprising, considering the large deformation induced on this base-pair step by the binding of TBP and the nature of AG steps, which are one of the least deformable steps (Olson et al., 1998). Intuitively, one would have expected a more ``kinky'' step at this position, like TA or TG. It could be that the more rigid AG step is harder to pry open, but once it is opened it more readily accommodates the intercalating phenylalanine residue, forming a more stable complex. Indeed, hompolymeric steps are observed in several other protein-DNA complexes involving DNA kinking by intercalation of hydrophobic residues (Werner et al., 1996). On the other hand, this apparent contradiction could come from focusing on the structural properties of dinucleotides. It could be that we should focus instead on larger DNA regions. For example, Cao et al. (1998) have shown that the tetranucleotide TGGA, especially when it appears multiple times, impairs nucleosome formation. This point is further discussed below. Recognition of global DNA flexibility Global differential ¯exibility was hypothesized in many studies to be a dominant structural feature of TATA boxes. Several studies have indeed shown that more ¯exible TATA boxes are being preferred in TBP/TATA box complexes (Grove et al., 1998; Davis et al., 1999). In our experiments, the most stable complex is formed with the wtMLP target, containing the A motif. When we substitute adenine bases with thymine bases, thus creating larger alternating (AT)n tracts, we reduce the stability of TBP/TATA box complexes (Table 1). The A tract motif (de®ned as four or more adjacent adenine bases) has been proposed to be a ``rigid'' structural motif (Nelson et al., 1987; Yoon et al., 1988; Sarai et al., 1989; Zhurkin et al., 1991; Goodsell & Dickerson, 1994; Dickerson et al., 1996; El Hassan & Calladine, 1996). Recent studies have shown that A tracts are more ¯exible than previously envisioned (Olson et al., 1998), and they may be as ¯exible as B-DNA, at room temperature (A. Sitlani & D. M. Crothers, personal communication). However, the ¯exibility of (AT)n tracts is probably still higher (A. Sitlani & D.M. Crothers, personal communication). Alternating (AT)n tracts are known to be macroscopically more ¯exible than random B-DNA molecules, as measured in a decrease in the persistence length relative to random B-DNA molecules (Chen et al., 1985). Thus it seems that yTBPc prefers to bind to more mechanically rigid targets, in contradiction to previous studies. However, the above discussion may not be relevant to TATA boxes because it could be that TATA box sequences have ¯exibility properties which are different from those of ``simple'' A tracts and ``simple'' alternating (AT) sequences alone. This conjecture is supported by the recent obser-

973 vation by Davis et al. (1999) that the wtMLP sequence is either anisotropically ¯exible or bent (but notice that the DNA target sequence as used by Davis et al. (1999) does not contain as extensive G tracts ¯anking it, as in our constructs and in the naturally occurring promoter). Moreover, Widlund et al. (1999) have recently shown that the TATAAA motif (again, not in a context of ¯anking G tracts) is more ¯exible than random B-DNA sequences. Hence, the ¯exibility properties of these motifs may be similar, and consequently, ¯exibility may not be a useful parameter for explaining the differential stability of the complexes of yTBPc with the wtMLP and the wtT7A8 targets (20 % difference, Table 1). Both sequences wtMLP and wtT7A8 have the preferred A4A5 base-pair step, and the change from A7G8 to the T7A8 step did not change the stability of the complexes to yTBPc in other complexes (wtT5 versus wt(TA)4), Table 1). However, this change (A7G8 to T7A8) has abolished the A-tract structure in wtT7A8. Thus, we conclude that the complex of yTBPc with wtMLP may owe at least part of its stability to the existence of an A tract in wtMLP, and its absence in the wtT7A8 target. If it is not an issue of ¯exibility, then it must be some other property unique to A tracts. Furthermore, we observed that changing the sequences ¯anking the core TATA box on either side affected the kinetics of yTBPc dissociation from the target with alternating (TA)n tracts, but not from the target containing homopolymeric A tracts. This effect must be structural in nature, as discussed above. This observation supports the idea that A tracts, even with a 50 TAT tract, adopt a dominant structure which is not perturbed by its nearest neighbors, whereas alternating (TA)n tracts are ¯exible, in the sense that the structure that they adopt depends, to a large extent, on their sequence context. Davis et al. (1999) have suggested that TATA boxes, in general, are bistable and may exist in two conformational states separated by an energy barrier. We propose that this applies only to TATA boxes containing short A tracts. We suggest that TATA boxes containing A tracts, such as the AdMLP target, can adopt two, or a small number of, conformational states, whereas those containing alternating TA tracts, such as wt(T-A)4 (the E4 promoter) can adopt multiple conformations, which are also dependent on sequence context. Therefore, on binding to yTBPc, there will be considerably greater loss in entropy for the E4 target, than for the wtMLP target. The results reported by Petri et al. (1998) support this hypothesis. They have found that at 30  C, and higher temperatures, the binding of TBP to the E4 target is enthalpy driven, whereas that of the AdMLP is entropy driven at all the studied temperatures. At other TATA boxes, not containing canonical A tracts, these suggestions may not apply. For example, Grove et al. (1998) compared the binding of variants (containing nonWatson-Crick analogs) of the TATAAA motif to TBP, and showed that more ¯exible binding sites

974 form more stable complexes to TBP. The TATAAA motif is more ¯exible than B-DNA (Widlund et al., 1999), and thus may have access, however with reduced energy, to all the conformational states of the other, more ¯exible variants. Hence, these sequences may not follow the mechanism proposed here for A tract-containing TATA boxes. Thus, we may call the mechanism of action of TBP, on A tract-containing promoters, the ``induced ¯ip'' mode of operation. The ¯ip of A tracts from their preferred unbound conformation may be a slow step, but once carried out they may constitute a more stable interface for TBP binding. Studies are in progress to establish this hypothesis. Relation to transcription It has been shown that TBP remains stably bound on the TATA box when RNA Pol II and the associated factors clear the promoter, thus facilitating the assembly of a new preinitiation complex (Roberts et al., 1995; Zawel et al., 1995). Moreover, the in vitro studies by Yean & Geralla (1997) show that mutating the consensus TATA box decreases transcription reinitiation rates. Therefore, it could be that a high degree of kinetic stability of the TBP/TATA box complex on the promoter may increase the transcriptional activity of that promoter by increasing the number of transcription reinitiation events. Indeed, the study by Starr et al. (1995) shows that basal transcription from a wtT5containing promoter is approximately 70 % of that from a wtMLP-containing promoter, in agreement with the reduced stability of the complex formed between yTBPc and wtT5, relative to the corresponding complex with wtMLP, observed here (Table 1).

Materials and Methods DNA and protein TATA box variants were chemically synthesized both as linear duplexes, 21 bp long, as shown in Table 1, and as hairpin constructs with 19 bp double-stranded stems (same as in Table 1 minus the two outer-most bases at the 50 side) and ®ve cytosine residues in the loop. For kinetic analysis of the interaction with yTBPc, the hairpin constructs were 32P-end-labeled using standard techniques. For phase-sensitive analysis of intrinsic and protein-induced DNA bending, the 21 bp linear duplexes were cloned into the p4AT/n (n ˆ 10 to 20) plasmid set, as described (Bareket-Samish et al., 1997). The 569-579 bp DNA probes were generated from this set as described (Bareket-Samish et al., 1997) and were 32P-labeled using [a32P]dCTP and the Klenow enzyme according to standard protocols. The C-terminal domain of yeast TBP (yTBP(D1-60), here referred to as yTBPc) was a kind gift from P.B. Sigler (Yale University). The overexpression and puri®cation of the protein were as described (Y. Kim et al., 1993). We have determined the fraction of yTBPc molecules that are active for TATA box binding as described (Coleman & Pugh, 1995). Samples of the wtMLP target (57 nM), contained within the 32P-labeled hairpin duplex,

Signals for TBP/TATA-box Recognition were incubated with increasing amounts of yTBPc (total protein concentration 0 to 400 nM). After 60 minutes incubation at 30  C, in the binding conditions described below, the free wtMLP target was separated from the yTBPc/wtMLP complex by native gel electrophoresis, as described below. The fraction of the wtMLP target bound by yTBPc was determined as described (Coleman & Pugh, 1995), and found to be 69 % (data not shown).

Binding conditions All assays were conducted using the same binding conditions. The reaction mixture contained (in addition to DNA and protein) 4 mM DTT, 10 mM Tris.HCl (pH 7), 30 mM KCl, 0.4 % (v/v) Brij58, 5 mM MgCl2, and 10 % (v/v) glycerol.

Dissociation kinetics Radiolabeled hairpin duplexes (0.4 nM) and yTBPc (27 nM active protein) were incubated for 60 minutes at 30  C in the binding buffer before adding unlabeled 21 bp linear duplex competitor of the same DNA sequence (1.76 mM, 65-fold excess of the cold competitor over active protein, and 4400-fold over labeled DNA targets). We used DNA targets embedded in short DNA fragments in these experiments in order to observe the net dissociation of yTBPc from the TATA box targets, and in order to afford yTBPc minimal opportunities for non-sequence-speci®c binding (Coleman & Pugh, 1995). We used short hairpin constructs as DNA targets to avoid disproportionation of short double-stranded, partly self-complementary, oligonucleotides into internal hairpins at the low concentration used in this experiment (Haran et al., 1992). This also accounts for using short linear duplexes as the cold competitor, because at the large molar excess of competitor DNA, over that of the radiolabeled target, the intramolecular hairpin constructs can convert into longer linear duplexes containing two TATA boxes separated by an internal bulge. At the timepoints indicated in Figure 1 samples were removed and immediately frozen in liquid nitrogen (Weideman et al., 1997). After the ®nal time-point, the samples were thawed and immediately loaded onto native gels (10 %, acrylamide/bisacrylamide ratio 75:1, 10 % glycerol) while the gels were running. The gels were run at 450 V and 30  C, in a running buffer containing 0.5  TG (25 mM Tris
HCl (pH 8.3), 190 mM glycine) and 5 mM magnesium acetate, until the bromophenol blue dye migrated 5.5 cm.

Phasing analysis For measuring the intrinsic bending of TATA box targets, the radiolabeled DNA probes, 569 to 579 bp long, were analyzed on native gels in a 89 mM Tris-borate, 2 mM EDTA buffer, as described (Bareket-Samish et al., 1997). For measuring yTBPc-induced DNA bending the same radiolabeled DNA probes (0.4 nM) were incubated with 25 to 200 nM yTBPc for 60 minutes at 30  C. The relative mobilities of the complexes were analyzed on native gels (6 %, acrylamide/bisacrylamide 75:1, 10 % glycerol). Gels were run at 450 V and 30  C, as described above, until the xylene cyanol dye migrated 12 cm.

975

Signals for TBP/TATA-box Recognition Data analysis All gels were dried and quanti®ed using a Fujii Bas1000 phosphorimager. For the analysis of the kinetic experiments, boxes were de®ned surrounding each band on the gel. To account for dissociation of the complex during electrophoresis the band corresponding to the protein-DNA complex was de®ned as extending from its main band to the free DNA band (Bareket-Samish et al., 1997). The background was de®ned from a similar box in a lane containing the unbound target only. The fractions of bound DNA at the different time-points, F(t), were calculated from the equation: F…t† ˆ…PSL ÿ bg†complex…t† =‰…PSL ÿ bg†complex…t† ‡ …PSL ÿ bg†free…t† Š where PSL is the photostimulated luminescence and bg is the background. ln[F(t)/F(0)] was plotted as a function of time (t) after the addition of the unlabeled competitor. The dissociation rate constant (koff) was calculated from the best ®t of the linear range of the graph using the ®rst-order kinetics equation: ln [F(t)/F(0)] ˆ ÿ koff  t. The initial conditions were chosen such that F(0) ˆ 1. Values of t1/2 were calculated from t1/2 ˆ ln 2/koff. The data in Table 1 are an average of three to six independent experiments for each DNA target. Intrinsic and yTBPc-induced bending of TATA box targets was determined as described (Bareket-Samish et al., 1997, 1998) with few modi®cations. A best ®t to a cosine function (Kerppola & Curran, 1991) was calculated for the set of six relative band mobilities. For yTBPc-induced DNA bending this was ®rst divided by the relative mobilities of the free DNA bands (Zinkel & Crothers, 1987), and a helical periodicity of 10.9 was used, since this periodicity gave the best ®t to the cosine function. This periodicity is in agreement with the crystallographic results on the unwinding of the DNA target in the complex (J.L. Kim et al., 1993; Kim & Burley, 1994; Nikolov et al., 1996). Absolute values for bend magnitudes were derived from the equation tg(kaB/2) ˆ Aph/[2tg(kaC/2)] (Kerppola & Curran, 1991), where aC is the intrinsic bend associated with the standard bend (four A tracts corresponding to 72  at 20  C; Koo et al., 1990), aB is the unknown test bend, Aph is the amplitude of the composite bend, and k is a calibration constant unique for each experimental setup. Our cloning vector itself displays residual bending (Bareket-Samish et al., 1997, 1998), which affected our calibration process. Therefore, k was determined here using two plasmid sets. In the ®rst set, two phased A tracts, called A61/1 (Koo & Crothers, 1988), possessing a bend angle of 36  at 20  C (Koo et al., 1990) replaced the unknown test bend. The second set contained only one A tract (called A61/2; Koo & Crothers, 1988) instead of the test sequence, which was out of phase relative to the two A tracts of the A61/1 sequence. The contribution of the DNA sequence of the cloning vector in the A61/1 construct is therefore opposite to its effect on the A61/2 construct, and we can use the sum of these two bends, which is not dependent on the residual bending of the vector, to determine a vectorindependent k-factor. Protein-induced bend angles, which measure the capacity of the protein to bend its target sites, are not in¯uenced by the intrinsic structure of the unbound target or those of the cloning vector itself. To factor out the contribution of the residual bend of the cloning vector on the intrinsic bending of the

studied sequences, we used the following equation: aF ˆ aB ÿ 11   cos[(minB ÿ minv)  360/10.6], where aF is the net bend angle of the test sequence, and aB is the bend angle determined from the previous equation. minB and minv are the minimum points derived from the cosine function of the test sequence and the cloning vector, respectively. The magnitude of the residual bend of the vector was found to be 11  . Bend center and orientation were calculated as described (Bareket-Samish et al., 1997, 1998).

Acknowledgments We thank J. Geiger and P. B. Sigler for their generous gift of puri®ed yTBPc. We thank S. K. Burley, B. F. Luisi, and Z. Shakked for critical reading of various versions of this manuscript. This work was supported by the Basic Research Foundation administered by the Israel Academy of Sciences and Humanities (T.E.H).

References Bareket-Samish, A., Cohen, I. & Haran, T. E. (1997). Repressor assembly at trp binding sites is dependent on the identity of the intervening dinucleotide between the binding half sites. J. Mol. Biol. 267, 103117. Bareket-Samish, A., Cohen, I. & Haran, T. E. (1998). Direct versus indirect readout in the interaction of the trp repressor with non-canonical binding sites. J. Mol. Biol. 277, 1071-1080. Berg, O. G. & von Hippel, P. H. (1987). Selection of DNA binding sites by regulatory proteins. Statistical- mechanical theory and application to operators and promoters. J. Mol. Biol. 193, 723-750. Biburger, M., Niederweis, M. & Hillen, W. (1994). Oligo[d(C).(G)] runs exhibit a helical repeat of 11.1 bp in solution and cause slight DNA curvature when properly phased. Nucl. Acids Res. 22, 15621566. Bucher, P. (1990). Weight matrix descriptions of four eukaryotic RNA polymerase II promoter elements derived from 502 unrelated promoter sequences. J. Mol. Biol. 212, 563-578. Bucher, P. (1996). The eukaryotic promoter database EPD, EMBL, nucleotide sequence data library, release 48, European Bioinformatics Institute, Cambridge, UK. Burley, S. K. & Roeder, R. G. (1996). Biochemistry and structural biology of transcription factor IID (TFIID). Annu. Rev. Biochem. 65, 769-799. Cao, H., Widlund, H. R., Simonsson, T. & Kubista, M. (1998). TGGA repeats impair nucleosome formation. J. Mol. Biol. 281, 253-260. Cavin, Perier R., Junier, T. & Bucher, P. (1998). The eukaryotic promoter database EPD. Nucl. Acids Res. 26, 353-357. Chen, H. H., Rau, D. C. & Charney, E. (1985). The ¯exibility of alternating dA-dT sequences. J. Biomol. Struct. Dynam. 2, 709-719. Coleman, R. A. & Pugh, B. F. (1995). Evidence for functional binding and stable sliding of the TATA binding protein on non-speci®c DNA. J. Biol. Chem. 270, 13850-13859.

976 Crothers, D. M., Gartenberg, M. R. & Shrader, T. E. (1991). DNA bending in protein-DNA complexes. Methods Enzymol. 208, 118-146. Davis, N. A., Majee, S. S. & Kahn, J. D. (1999). TATA box DNA deformation with and without the TATA box-binding protein. J. Mol. Biol. 291, 249-265. Dickerson, R. E. (1999). Helix structure and molecular recognition by B-DNA. In Oxford Handbook of Nucleic Acid Structure (Neidle, S., ed.), vol. 145-191, Oxford University Press, Oxford. Dickerson, R. E., Goodsell, D. & Kopka, M. L. (1996). MPD and DNA bending in crystals and in solution. J. Mol. Biol. 256, 108-125. Dickerson, R. E., Goodsell, D. S. & Neidle, S. (1994). ``. . . the tyranny of the lattice. . . ''. Proc. Natl Acad. Sci. USA, 91, 3579-3583. El Hassan, M. A. & Calladine, C. R. (1996). Propellertwisting of base-pairs and the conformational mobility of dinucleotide steps in DNA. J. Mol. Biol. 259, 95-103. Goodsell, D. S. & Dickerson, R. E. (1994). Bending and curvature calculations in B-DNA. Nucl. Acids Res. 22, 5497-5503. Grove, A., Galeone, A., Yu, E., Mayol, L. & Geiduschek, E. P. (1998). Af®nity, stability and polarity of binding of the TATA binding protein governed by ¯exure at the TATA box. J. Mol. Biol. 282, 731-739. Hahn, S., Buratowski, S., Sharp, P. A. & Guarente, L. (1989). Yeast TATA-binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc. Natl Acad. Sci. USA, 86, 5718-5722. Haran, T. E., Joachimiak, A. & Sigler, P. B. (1992). The DNA target of the trp repressor. EMBO J. 11, 30213030. Haran, T. E., Kahn, J. D. & Crothers, D. M. (1994). Sequence elements responsible for DNA curvature. J. Mol. Biol. 244, 135-143. Hernandez, N. (1993). TBP, a universal eukaryotic transcription factor? Genes Dev. 7, 1291-1308. Hoopes, B. C., LeBlanc, J. F. & Hawley, D. K. (1992). Kinetic analysis of yeast TFIID-TATA box complex formation suggests a multi-step pathway. J. Biol. Chem. 267, 11539-11547. Juo, Z. S., Chiu, T. K., Leiberman, P. M., Baikalov, I., Berk, A. J. & Dickerson, R. E. (1996). How proteins recognize the TATA box. J. Mol. Biol. 261, 239-254. Kerppola, T. K. & Curran, T. (1991). DNA bending by Fos and Jun: the ¯exible hinge model. Science, 254, 1210-1214. Ê resolution re®ned Kim, J. L. & Burley, S. K. (1994). 1.9 A structure of TBP recognizing the minor groove of TATAAAAG. Nature Struct. Biol. 1, 638-653. Kim, J. L., Nikolov, D. B. & Burley, S. K. (1993). Co-crystal structure of TBP recognizing the minor groove of a TATA element. Nature, 365, 520-527. Kim, Y., Geiger, J. H., Hahn, S. & Sigler, P. B. (1993). Crystal structure of a yeast TBP/TATA box complex. Nature, 365, 512-520. Koo, H. S. & Crothers, D. M. (1988). Calibration of DNA curvature and a uni®ed description of sequencedirected bending. Proc. Natl Acad. Sci. USA, 85, 1763-1767. Koo, H. S., Drak, J., Rice, J. A. & Crothers, D. M. (1990). Determination of the extent of DNA bending by an adenine-thymine tract. Biochemistry, 29, 4227-4234. Kosa, P. F., Ghosh, G., DeDecker, B. S. & Sigler, P. B. Ê crystal structure of an archaeal (1997). The 2.1-A preinitiation complex: TATA box-binding protein/

Signals for TBP/TATA-box Recognition transcription factor (II)B core/TATA box. Proc. Natl Acad. Sci. USA, 94, 6042-6047. Kuddus, R. & Schmidt, M. C. (1993). Effect of the nonconserved N-terminus on the DNA binding activity of the yeast TATA binding protein. Nucl. Acids Res. 21, 1789-1796. Lavery, R. & Skelenar, H. (1988). The de®nition of generalized helicoidal parameters and of axis curvature for irregular nucleic acids. J. Biomol. Struct. Dynam. 6, 63-91. Lee, D. K., Horikoshi, M. & Roeder, R. G. (1991). Interaction of TFIID in the minor groove of the TATA element. Cell, 67, 1241-1250. Librizzi, M. D., Brenowitz, M. & Willis, I. M. (1998). The TATA element and its context affect the cooperative interaction of TATA-binding protein with the TFIIBrelated factor, TFIIIB70. J. Biol. Chem. 273, 45634568. Lieberman, P. M., Schmidt, M. C., Kao, C. C. & Berk, A. J. (1991). Two distinct domains in the yeast transcription factor IID and evidence for a TATA box-induced conformational change. Mol. Cell. Biol. 11, 63-74. Lumpkin, O. J., Dejardin, P. & Zimm, B. (1985). Theory of gel electrophoresis of DNA. Biopolymers, 24, 15731593. Milton, D. L., Casper, M. L., Wills, N. M. & Gesteland, R. F. (1990). Guanine tracts enhance sequence directed DNA bends. Nucl. Acids Res. 18, 817-820. Nelson, H. C., Finch, J. T., Luisi, B. F. & Klug, A. (1987). The structure of an oligo(dA).oligo(dT) tract and its biological implications. Nature, 330, 221-226. Nikolov, D. B., Chen, H., Halay, E. D., Usheva, A. A., Hisatake, K., Lee, D. K., Roeder, R. G. & Burley, S. K. (1995). Crystal structure of a TFIIB-TBPTATA-element ternary complex. Nature, 377, 119128. Nikolov, D. B., Chen, H., Halay, E. D., Hoffman, A., Roeder, R. G. & Burley, S. K. (1996). Crystal structure of a human TATA box-binding protein/TATA element complex. Proc. Natl Acad. Sci. USA, 93, 4862-4867. Olson, W. K., Gorin, A. A., Lu, X. J., Hock, L. M. & Zhurkin, V. B. (1998). DNA sequence-dependent deformability deduced from protein-DNA crystal complexes. Proc. Natl Acad. Sci. USA, 95, 1116311168. Parvin, J. D., McCormick, R. J., Sharp, P. A. & Fisher, D. E. (1995). Pre-bending of a promoter sequence enhances af®nity for the TATA-binding factor. Nature, 373, 724-727. Patikoglou, G. A., Kim, J. L., Sun, L., Yang, S. H., Kodadek, T. & Burley, S. K. (1999). TATA element recognition by the TATA box-binding protein has been conserved throughout evolution. Genes Dev. 13, 3217-3230. Petri, V., Hsieh, M., Jamison, E. & Brenowitz, M. (1998). DNA sequence-speci®c recognition by the saccharomyces cerevisiae ``TATA'' binding protein: promoter-dependent differences in the thermodynamics and kinetics of binding. Biochemistry, 37, 1584215849. Roberts, S. G., Choy, B., Walker, S. S., Lin, Y. S. & Green, M. R. (1995). A role for activator-mediated TFIIB recruitment in diverse aspects of transcriptional regulation. Curr. Biol. 5, 508-516. Sarai, A., Mazur, J., Nussinov, R. & Jernigan, R. L. (1989). Sequence dependence of DNA conformational ¯exibility. Biochemistry, 28, 7842-7849.

Signals for TBP/TATA-box Recognition Seeman, N. C., Rosenberg, J. M. & Rich, A. (1976). Sequence-speci®c recognition of double helical nucleic acids by proteins. Proc. Natl Acad. Sci. USA, 73, 804-808. Shatzky-Schwartz, M., Arbuckle, N. D., Eisenstein, M., Rabinovich, D., Bareket-Samish, A., Haran, T. E., Luisi, B. F. & Shakked, Z. (1997). X-ray and solution studies of DNA oligomers and implications for the structural basis of A-tract-dependent curvature. J. Mol. Biol. 267, 595-623. Singer, V. L., Wobbe, C. R. & Struhl, K. (1990). A wide variety of DNA sequences can functionally replace a yeast TATA element for transcriptional activation. Genes Dev. 4, 636-645. Starr, D. B. & Hawley, D. K. (1991). TFIID binds in the minor groove of the TATA box. Cell, 67, 1231-1240. Starr, D. B., Hoopes, B. C. & Hawley, D. K. (1995). DNA bending is an important component of site-speci®c recognition by the TATA binding protein. J. Mol. Biol. 250, 434-446. Tan, S., Hunziker, Y., Sargent, D. F. & Richmond, T. J. (1996). Crystal structure of a yeast TFIIA/TBP/ DNA complex. Nature, 381, 127-151. Weideman, C. A., Netter, R. C., Benjamin, L. R., McAllister, J. J., Schmiedekamp, L. A., Coleman, R. A. & Pugh, B. F. (1997). Dynamic interplay of TFIIA, TBP and TATA DNA. J. Mol. Biol. 271, 61-75. Werner, M. H., Gronenborn, A. M. & Clore, G. M. (1996). Intercalation, DNA kinking, and the control of transcription. Science, 271, 778-784.

977 Widlund, H. R., Kuduvali, P. N., Bengtsson, M., Cao, H., Tullius, T. D. & Kubista, M. (1999). Nucleosome structural features and intrinsic properties of the TATAAACGCC repeat sequence. J. Biol. Chem. 274, 31847-31852. Wong, J. M. & Bateman, E. (1994). TBP-DNA interactions in the minor groove discriminate between A:T and T:A base-pairs. Nucl. Acids Res. 22, 18901896. Yean, D. & Gralla, J. (1997). Transcription reinitiation rate: a special role for the TATA box. Mol. Cell. Biol. 17, 3809-3816. Yoon, C., Prive, G. G., Goodsell, D. S. & Dickerson, R. E. (1988). Structure of an alternating-B DNA helix and its relationship to A-tract DNA. Proc. Natl Acad. Sci. USA, 85, 6332-6336. Yuan, H., Quintana, J. & Dickerson, R. E. (1992). Alternative structures for alternating poly(dA-dT) tracts: the structure of the B-DNA decamer C-G-AT-A-T-A-T-C-G. Biochemistry, 31, 8009-8021. Zawel, L., Kumar, K. P. & Reinberg, D. (1995). Recycling of the general transcription factors during RNA polymerase II transcription. Genes Dev. 9, 1479-1490. Zhurkin, V. B., Ulyanov, N. B., Gorin, A. A. & Jernigan, R. L. (1991). Static and statistical bending of DNA evaluated by Monte Carlo simulations. Proc. Natl Acad. Sci. USA, 88, 7046-7050. Zinkel, S. S. & Crothers, D. M. (1987). DNA bend direction by phase sensitive detection. Nature, 328, 178181.

Edited by T. Richmond (Received 21 December 1999; received in revised form 14 April 2000; accepted 17 April 2000)