Terms and techniques: New approach to hot-start polymerase chain reaction using Taq DNA polymerase antibody

Terms and Techniques: New Approach to

Hot-Start Polymerase Chain Reaction Using Taq DNA Polymerase Antibody Rajvir Dahiya, Guoren Deng, Katherine Chen, Peter C. Haughney, Gerald R. Cunha, and Perinchery Narayan

The purpose of this study was to optimize the conditions for polymerase chain reaction (PCR). The most common problem with conventional PCR is the presenceof nonspecific products and primer-dimers formation, which could be due to several factors such as annealing temperature, primer concentration, and Taq DNA polymerase activity during setup of the PCR. Recently, a neutralizing monoclonal antibody (TaqStart) that blocksTaq DNA polymerase activity has been developed. In the present study, we determined the effectsof Taq DNA polymerase monoclonal antibody (TaqStart antibody) and other parameters, suchas annealingtemperature and oligonucleotideprimer concentrations, on the specificity of PCR products. The results of these experiments suggest that TaqStart antibody inhibits nonspecificproducts and primer-dimers formation by blocking Taq DNA polymerase activity until the reaction components are heated in the thermal cycler (hot start). Other factors such as annealing temperature, oligonucleotide primer concentration, and magnesium concentrationare equally important for specificityof PCR products. (Ural Oncol i995;1:42-46)

T

he polymerase chain reaction (PCR) is a technique for the in vitro amplification of a specific DNA sequence by the simultaneous primer extension of complementary strands of DNA. The PCR method was devised and named by Mullis and Fafoona,’ although the principle and method had been described in detail by Kfeppe et al* and Panet et af3 over a decade earlier. The PCR reaction requires deoxynucleotides, Taq DNA polymerase, primer, template, and a buffer containing magnesium. The deoxynucleotides and primers are present in large excess, so the synthesis step can be repeated by heating the newly synthesized DNA to separate the strands and cooling to allow the primers to anneal to their complementary sequences. The heating and cooling cycles can be repeated and DNA will continue to accumulate exponentially until one of the reaction products is exhausted or the enzyme is unable to synthesize new DNA quickly enough. At high template and primer concentrations, the primers may

From the Department of Urology, University of California San Francisco and Veterans Affairs Medical Center, San Francisco, California. Supported by grants from the National Institutes of Health (DK47517, C&4872, DK45861, and CA59831) awarded to RD. and CC. Address correspondence to Rajvir Dahiya, PhD, Urology Research Lab (112F) VA Medical Center, 4150 Clement Street, San Francisco, CA 94121. Urol Oncol 1995;1:42-46 0 1995 Elsevier Science Inc. 655 Avenue of the Americas, New York, NY 10010

also bind to themselves or nonspecifically to DNA sequences other than the target, resulting in the synthesis of primerdimers or nonspecific products. The most common problem with conventional PCR is the presence of nonspecific products. Recently, a neutralizing monoclonal antibody (TaqStart) that blocks Taq DNA polymerase activity has been developed!* TaqStart antibody inhibits nonspecific products and primer-dimers by blocking Taq DNA polymerase activity until the reaction components are heated in the thermal cycler. This technique is called hot-start PCR. In the present study, we optimized the conditions for hot-start PCR.

Methods Procedure

for Conventional

PCR

Paraffin-embedded prostate cancer specimens were used for the extraction of DNA. Genomic DNA (10-100 ng) was added to 25 ~J,Lof solution containing 10 mmok’L Tris-HCI, pH 8350 mmol/L KCl, 1.5 mmoVL MgCI,, 0.01% gelatin, 0.1-l pmof/L each of upstream and downstream primers, 02 mmol/L dNTP (deoxynucleoside triphosphates), and 1 unit Taq DNA polymerase. After heating to 94°C for 3 minutes, the mixture was subjected to 30 cycles of denaturing (94°C for 30 seconds), annealing (56-68“C for 30 seconds), and extension (72°C for 30 seconds). After the last cycle, the reaction was maintained at 72°C for 10 minutes. The selection of annealing temperature, times, primer concentrations, and number of cycles, for a PCR reaction is critical. These factors depend on the DNA being amplified and the primers used for a particular PCR reaction. To obtain the specific products, the following factors should be considered. DESIGN OF THE PRIMERS.The primers should be 15-30 nucleotides in length for each PCR reaction, with about 50% cytosine@anine (CC) content overall and a relatively high adenine/thymine (AT) content at the 3’ end, and should not contain sequences leading to the formation of dimers or hairpin structures. Most investigators use the Macintosh software program “OLICO 4.0” for designing the primers. In the present

lTaq DNA polymerase heat-stable enzyme isolated from Tfrermus aquaticus (Cetus Corp., Boehringer-Mannheim), Thermus thermophilus (United States Biochemicafs), or Bacillus sterothemophilus (Bio-Rad).

1078-1439/95/$9.50 88Dl 1078-1439(95)60901-X

Taq DNA

Ural Oncol I 995; I:4246

study, we used p53 tumor suppressor listed in Table 1.

gene primers, which are

ANNEALING TEMPERATURE. The annealing temperature should be selected carefully. Usually it is 5°C below the Tm of the primers. The higher the annealing temperature, the more specific the amplified PCR products. In the present experiments, we used three different annealing temperatures (SOOC, 64’C, SS’C) and analyzed their PCR-amplified products. CONCENTRATION OF PRIMERS.Although a higher concentration of primers could increase the yield of PCR products, a high concentration of primers can also increase the nonspecific amplification because of the increased incidence of hybridization between primers and to the nonspecific templates. Lowering the primer concentration can lead to more specific amplification. In the present study, p53 oligonucleotide primers were used at 1.0, 0.5, 0.25, and 0.125 FrnoVL concentration, and their PCR-amplified products were analyzed.

Procedure for Hot-Start

PCR

Before the reaction mixture first reaches high temperature, nonspecific hybridization and primer-dimers have already been formed because of the low level of activity of Taq DNA polymerase at room temperature. These nonspecific products can be amplified during thermal cycling, leading to lowered yield of the desired products and multiple nonspecific bands. To overcome this nonspecific amplification, the -Taq DNA polymerase should not be added to the mixture until it reaches 94°C before the thermal cycling. By doing this, one can significantly reduce nonspecific binding of the primers to DNA templates and binding between primers, leading to a higher yield of the desired products with low background. The so-called “hot-start” PCR can be accomplished by the following procedures. MANUAL. Mix all the components

polymerase

except either Taq DNA or primers, heat the solution to 94% supplement

with Taq DNA polymerase cycling?”

Polymerase Antibody for PCR

or primers, and process to thermal

ADDING WAX BARRIERS.Mix all the components

except Taq DNA polymerase and template. Dispense AmpliWax PCR Gem100 (Perkin-Elmer) into the tubes, heat the tubes to melt the wax, and cool the tube to create a solid wax layer above the reagent mixture. Add Taq DNA polymerase and template onto the wax, heat to 94°C and process to the thermal cycling.7” ADDING ANTIBODY AGAINST TAQ DNA POLYMERASE.

Mix Taq DNA polymerase and the antibody against Taq DNA polymerase (TaqStart antibody; Clontech, Palo Alto, CA), add this complex to the complete PCR reaction mixture, heat to 94°C and process to thermal cycling as described under the “Conventional PCR” section. When Taq DNA polymerase is mixed with Taq polymerase antibody, the nonspecific products and primer-dimers are eliminated because the activity of Taq DNA polymerase is blocked by the antibody during assembly of the reaction mixture at room temperature. When the PCR solution is heated to high temperature (greater than 70”(Z),the Taq DNA polymerase is released, and only specific products are produced at high temperature.

Single-Stranded Conformation Polymorphism

4 Sense 4 Antisense 5 Sense 5 Antisense 6 Sense 6 Antisense 7 Sense 7 Antisense 8 Sense 8 Antisense 9 Sense 9 Antisense

5’-3’ Sequence

PCR Product

TGC ACC AGC AGC TCC TAC AC CAT GGA AGC CAG CCC CTC AG GTG CCC TGA CTT TCA ACT CTG GGG CAA CCA CCC CTG TCG CGTCTAGAAITCCTCACTGATTGCTC CGG TCG ACA G’lT GCA AAC CAG A CGTCTAGAGGCCTGTGTTGTCTCC CGG TCG ACG GTG GCA AGT GGC TCC ATTTCTTACTGCCTCTI’GCTTC CTT GGT CTC CTC CAC CGC GCC TCA GAT TCA CTT ‘ITA TCA CC GAC TGG AAA CTT TCC ACT TGA TAA G

181 bp

PCR= polymerase chain reactions.

(SSCP)

Hot-start PCR has a significant impact on the specificity of PCR products. To determine the difference in quality of SSCP analysis with and without hot-start PCR, genomic DNA was isolated from five consecutive 5-pm paraffin-embedded prostate cancer specimens and amplified by hot-start PCR (using TaqStart antibody). The reaction mixture containing template, 1 @_i 32P-dCTP, and primers was amplified by PCR, and the amplified fragment was denatured by heating and analyzed by 6% polyacrylamide gel electrophoresis at room temperature. The separated DNA strands were visualized by autoradiography.g*10

TABLE I. SEQUENCES OF p53 PRIMERS USED FOR POLYMERASE CHAIN REACTION

Exon

43

266 bp 166 bp 165 bp 218 bp 161 bp

44

Ural Oncol I995; /:42-#6

Dahiya et a/

Results and Discussion Figure 1 shows the results of conventional PCR using p53 oligonucleotide primer (exon 7). One hundred nanograms of genomic DNA was amplified by conventional PCR using p53 exon-7 primers, and the products were separated on a 2% agarose gel. Figure 1 shows several nonspecific PCR products along with the specific product (see arrow). Lanes l-5 are prostate cancer specimens and lane S is the standard molecular marker. Figure 2 shows hot-start PCR (Taq DNA polymerase antibody) using p53 exon4 and exon-7 primers. One hundred nanograms of genomic DNA was amplified by hot-start PCR using TaqStart antibody and exon-4 primers (lanes l-4) or exon-7 primers (lanes 5-S), and the products were separated on a 2% agarose gel. There was a specific product for p53 exon4 primer (lanes l-4) with a size of 181 base pairs (bp), whereas exon-7 primer (lanes 5-8) produced a 165-bp product. These results demonstrate a significant improvement in the specificity and quality of PCR products. Figure 3 shows the effects of annealing temperature on PCR products. The annealing temperature should be selected carefully. Genomic DNA (100 ng) was amplified using 1 pmol/L of p53 exon-7 primer with an annealing temperature of 60°C (lane l), 64°C (lane 2), and 68°C (lane 3). Amplified products were separated electrophoretically on a 2% agarose gel. The arrow (Figure 3) denotes specific product. This figure shows that products from the PCR reaction at 64°C were more specific than those at 6o”C, whereas no specific amplification was obtained at 68°C.

s

1

FIGURE I. Conventional PCR using p53 exon-7 primers. One hundred nanograms of genomic DNA was amplified by conventional PCR using p53 exon-7 primers, and the products were separated on a 2% agarose gel. Several nonspecific PCR products are evident along with the specific product (arrow). Lanes I-S are prostate cancer specimens; lane S is a standard molecular marker (I 00-bp DNA ladder).

S12345678S

FIGURE 2. Hot-start PCR using P53 exon-4 and exon-7 primers. One hundred nanograms of genomic DNA was amplified by hot-start PCR using TaqStart antibody and exon-4 primers (lanes 1-4) or exond primers (lanes S-S), and the products were separated on a 2% agarose gel. Only a specific band was formed by hot-start PCR p53 exon-4 primer (/anes 1-4) showed a product size of I81 bp. whereas exon-7 primer (lanes I-g) produced a l65-bp product. Lane S is a standard molecular marker. Figure 4 shows the effects of primer concentration on PCR products. Cenomic DNA (100 ng) was amplified by PCR at 68°C annealing temperature using 1 p,mol/L (lane l), 0.5 I*rnol/L (lane 2) 0.25 pmol/L (lane 3) 0.125 kmol/L (lane 4) 0.0625 pmol/L (lane 5) and 0 p,mol/L (lane 6) of p53 exon-7 primer. The product was separated electrophoretically on a 2% agarose gel. Figure 4, lane 3, shows that 0.25 p,mol/L primer concentration resulted in a more specific PCR product. Figure 5 shows SSCP analysis of prostate cancer specimens for exon-7 of the p53 gene. One hundred nanograms of DNA from different prostate cancer specimens was amplified by hot-start PCR using p53 exon-7 primers denatured by heating, and separated on a 6% polyacrylamide gel. Denatured products from six different prostate cancer specimens are seen in lanes l-6. Lane 7 is undenatured product. The shifted bands in lanes 5 and 6, indicated by an arrow, show the mutation of the p53 gene at exon 7. (SS is single-stranded DNA, M is mutation; DS is double-stranded DNA.) There are several other parameters that should be optimized to increase the specificity of PCR products.“*” 1) Magnesium concentration: Specificity can be achieved by lowering the magnesium concentration below 1.5 mmol/L. 2) Oligonucleotide primer concentration: Decreasing primer concentration may increase specificity. 3) DNA concentration: Tenfold dilution of the genomic DNA concentration (1 @FL) can increase specificity and still provide adequate amplification. 4) Specificity of primer sequence: Occasionally a given pair of primers may not be specific. Therefore, replacement of the nonspecific primer with another oligonucleotide primer may provide specific products. 5) Primer design: Primers must be incapable of forming dimers or hairpin struc-

Taq DNA

U-o/ Oncol I 995; I:4246

FIGURE 3. Effects of annealing temperature on PCR products. Genomic DNA (I 00 ng) was amplified using I pmol/L of p53 exon-7 primer with annealing temperatures of 60°C (lane I), 64°C (lane 2). and 68°C (lane 3’) and separated electrophoretically on a 2% agarose gel. Specific product is shown (arrow). Products from the PCR reaction at 64°C were more specific than those at 60°C whereas no specific amplification was obtained at 68°C. lane S is a standard molecular marker (I 00-bp DNA ladder).

lures. The primers should contain 15-30 nucleotides for each PCR reaction, with high C + G content and a relatively high AT content at the 3’ end. 6) Deoxynucleotide concentration: Decreasing the concentration of dNTPs to 25-50 pmof/‘L can P’f event spurious amplification. 7) Formamide: Inclusion of

1234

56

FIGURE 4. Effects of primer concentration on PCR products. Genomic DNA (I 00 ng) was amplified by PCR at 68°C annealing temperature using I pmol/L (lane I). 0.5 pmol/L (lane 2). 0.25 p,mol/L (lane 3), 0.125 pmol/L (lane 4), 0.0625 pmol/L (lane 5). and 0 pmol/L (lane 6) of p53 exon-7 primer. The product was separated electrophoretically on a 2% agarose gel. The 0.25+mol/L primer concentration resulted in a more specific PCR product.

folymeme

Antibody for PCR

FIGURE 5. SSCP analysis of prostate cancer specimens for exon-7 of the p53 gene. One hundred nanograms of DNA from different prostate cancer specimens was amplified by hot-start PCR using p53 exon-7 primers, denatured by heating, and separated on a 6% polyacrylamide gel. Lanes l-6, denatured products from six different prostate cancer specimens; lane 7, undenatured product. The shifted bands in lanes 5 and 6 (arrow) show the mutation of the p53 gene at exon-7. SS = single-stranded DNA; M = mutation; DS = double-stranded DNA.

formamide (2-5%) can increase the signal strength and efiminate undesired bands, especially at high G + C content.s*11*12 8) Additional pair of primers: A second pair of compatible nonspecific primers can be added to generate a constant band. This serves both as an internal control for the technical success of the PCR and also increases specificity by providing another substrate for Taq pofymerase. 9) Taq pofyrnerase: Decreasing the amount of enzyme in each reaction (0.2-0.3 U/25 FL) can increase specificity and reduce reagent costs. 10) Number of amplification cycles: Decreasing the number of PCR cycles may reduce nonspecific products but also decreases the amount of PCR products. The appropriate number of cycles may be between 20 and 40. However, the number of cycles usually makes little difference in specificity. 11) Annealing temperature: Increasing the PCR annealing temperature may increase specificity and decrease nonspecific bands. All of the above parameters should be optimized to increase highly specific PCR products. In summary, the results of the present study demonstrate that the use of Taq DNA polymerase monocfonaf antibody in hot-start PCR clearly increases specificity and decreases nonspecific PCR products, in addition to optimizing other PCR conditions as mentioned above. The significance of PCR for urologic oncology is great. PCR is a simple, rapid, and inexpensive technique for producing

46

Dahiya et al

microgram quantities of DNA from a very small amount of sample (picogram DNA). Other applications of PCR include gene analysis, gene mapping, genetic mutation, gene cloning, and manipulation. We would like to thank Mr. David Hang, Richard Chui, and Ms. Rachael Ho for their technical help.

References Mullins KB, Faloona F. Specific synthesis of DNA in vitro via a polyrnerase-catalyzed chain reaction. Methods Enzymol 1987;155: 335-50. Kfeppe K, Ohstuka E, Kleppe R, Molineux L, Khorana HG. Studies on polynucleotides: Repair replication of short synthetic DNA’s as catalyzed by DNA polymerase. J Mol Biol 1971;56:341-9. Panet A, Khorana HG. Studies on polynucleotides: The linkage of deoxyribopolynucleotide templates to cellulose, and its use in their replication. J Biol Chem 1971;249:5213-21. Sharkey D, Scalice E, Christry K, Atwood SM, Daiss JL. Antibodies as thermolabile switches: High temperature triggering for the polymerase chain reaction. Bio Technol 1994;12:506-9.

Ural Oncol /995;1:42-46

5. D’Aquila RT, Bechtel LJ, Videler JA, Eron JJ, Gorczyca P, Kaplan JC. Maximizing sensitivity and specificity of PCR by preamplification heating. Nucleic Acids Res 1991;193749. 6. Chou Q. Minimizing deletion mutagenesis artifact during Taq DNA polymerase PCR by E. Coli SSB. Nucleic Acids Res 1992;20: 4371. 7. Bassam JC. Automated hot start PCR using mineral oil and paraffin wax. BioTechniques 1993;1430-4. 8. Kaijalainen S, Karhunen PJ, Lalu K, Lindstrom K. An alternative hot start technique for polymerase chain reaction using beads of wax-embedded reaction components dried in trehalose. Nucleic Acids Res 1993;21:2959-60. 9. Effert PJ, Newbauer A, Walther PJ. Liver alterations of p53 gene are associated with progression of human prostate carcinoma. J Urol 1992;147:789-93. 10. Hollstein M, Sidransky D, Vogelstein B, Harris CC. P53 mutation in human cancers. Science 1991253:492-5. 11. Bottema CDK, Sarkar G, Cassady JD, II S, Dutton CM, Sommer SS. Polymerase chain reaction amplification of specific alleles: A general method of detection of mutations, polymorphisms, and haplotypes. Methods Enzymol 1993;218:388-402. 12. Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA. The amplification refractory mutation system (ARMS). Nucleic Acids Res 1989;17:2503-16.