The Atlantic salmon prepro-gonadotropin releasing hormone gene and mRNA

Molecular and Cellular Endocrinology, 0 1992 Elsevier Scientific Publishers

MOLCEL

167

84 (lY92) 167-174 Ireland, Ltd. 0303-7207/92/$05.00

02722

The Atlantic salmon prepro-gonadotropin and mRNA Helge Klungland

releasing hormone gene

‘, James B. Lorens ‘, Oivind Andersen and Peter Alestrom a

‘, Gunn 0. Kisen a

“ Department of Dairy and Food Industries, Section for Biochemistry, Agriculturul Unit,ersity of Norway, N-1432 AOs-NLH,Norway, und ” Unil>ersityof Bergen, Center of Biotechnology, NIB-Biohlock, N-5008 Bergen, Notwuy (Received

Key words: Atlantic

salmon;

2 October

lYY1; accepted

Salmo salrrr; Gonadotropin-releasing

4 December

hormone;

1991)

Gonadotropin-releasing

hormone-associated

peptide

Summary Screening for the gene encoding salmon gonadotropin releasing hormone (sGnRH) in an Atlantic salmon (S&no s&r) genomic library resulted in isolation of a positive clone designated AsGnRH-1. An anchor polymerase chain reaction (PCR) technique was used to amplify GnRH cDNA derived from salmon hypothalamic mRNA. The cDNA sequence was aligned to the 7607 base pair genomic sequence which was shown to encode the entire prepro-GnRH gene. The cDNA proved that the cloned gene is expressed in the hypothalamus of mature salmon. The coding domain of sGnRH differs from the mammalian GnRH by six nucleotide changes which allow the two amino acid differences between the two GnRH variants. Salmon GnRH associated peptide (GAP) differs extensively in sequence and size from the mammalian counterpart. Compared to the GnRH cDNA of a cichlid species the similarity is 69.3% in the protein coding sequence.

Introduction Gonadotropin releasing hormone (GnRH) is the key molecule in the control of sexual maturation in all vertebrates. The pulsatile secretion of this decapeptide by hypothalamic neurosecretory cells stimulates the synthesis and release of the gonadotropins from the pituitary gland. Since the structural elucidation of mammalian [pGlu-His-Trp-Ser-Tyr-Gly-Leu-Arg-Pro-GIyNH,]GnRH (Matsuo et al., 1971; Burgus et al.,

Correspondence to: Helge Klungland, Department of Dairy and Food Industries, Section for Biochemistry, Agricultural University of Norway, N-1432 kNLH, Norway.

1972), the primary structure of several GnRH variants has been identified. Two forms of chicken GnRH, designated cGnRH-I and -II, have been described (King and Millar, 1982; Miyamoto et al., 1983, 1984). Multiple GnRH variants are also found in the salmon brain where salmon [Trp7,LeuS]GnRH (sGnRH) is the major form (Sherwood et al., 1983). The GnRH structure is under investigation in several other species, and new forms of GnRH are likely to be isolated in the near future. The principal structure of the prepro-GnRH follows a common scheme for neuropeptides including growth hormone releasing hormone (GHRH) and vasotocin. The peptides are generated by proteolytic processing during which both

the N-terminal signal peptide and a C-terminal peptide arc removed (Mayo et al., 1983; Heierhorst et al., 1989; Secburg et al., 1989). In prepro-GnRH this C-peptide, or GnRH associatcd peptide (GAP), has been shown to exhibit both prolactin inhibitory and gonadotropin releasing activity in rat (Nikolics et al., 1985; Yu et al., 1989). However, GAP showed no effect on the secretion of these hormones in sheep (Thomas et al., 198X). The GnRH gene has been cloned from three mammalian species: human, rat (Adelman et al., 1986) and mouse (Mason et al., 1986). These genes show a high degree of sequence and structural similarities where the mRNA is generated from the splicing of four exons. Exon 11 encodes the signal peptide, GnRH, a proteolytic cleavage site and the N-terminus of GAP. In this paper we present the first genomic sequence of prepro-GnRH and the corresponding hypothalamic mRNA from a nonmammalian species, the Atlantic salmon (S&no salur-). Materials

and methods

Synthetic oligonucleotide probes and sequencing primers Two probes were synthesized (Applied Biosysterns 381A DNA synthesizer) based on the sGnRH amino acid sequence (see Introduction). A 32-mix 29-mer probe was synthesized, 5’ CCIGG“/,AICCA“/,CCITAC‘/,“/~;ICCAITG“ /,.TG 3’, covering all 460X possible coding sequences of sGnRH, where A, T, and G were replaced with inosine (I) in degenerated positions. In addition, a 2%mer unique sequence probe was synthesized based on the DNA sequence encoding rat GnRH (Adelman et al., 1986). By introducing a minimum of changes in the rat sequence in order to obtain the amino acid shifts at position 7 and 8 of sGnRH, the following probe was generated: 5’ CCAGGGAGCCACCCATAGGACCAGTGCTG 3’. The DNA sequencing primers for primer walking were all 17-mers. Screening of an Atlantic salmon genomic library A genomic EMBL 3 Atlantic salmon library (Johansen and Valla, 1987) was screened. Hy-

bond-N (Amersham) filters were used for the screening of 500,000 plaques (Maniatis et al., 1982). Hybridization with the probe was carried out in plaque screen buffer (10 x Denhardt, 0.05 M Tris-HCl (pH 7.5), 1 M NaCl, 7 mM Na,HPO,, 1% sodium dodecyl sulfate (SDS)) at 42°C or 50°C. Washing conditions were 1 or 3 x standard saline citrate (SSC), 1% SDS at 42°C or 50°C. Positive clones were isolated, designated AsGnRH-1 to -4, and plaque purified. Southern analyses of the clones were carried out at the same conditions as described above. Construction of u deletion lihrury, DNA sequencing and computing A 10 kb Sal I-SulI fragment and a 5.3 kb Sal I-&n1 fragment of the salmon DNA insert from AsGnRH-1 were subcloned in a pGEM3zf( + 1 vector (Promega) giving the subclones psGnRH(S-S) and psGnRH(S-K). An ‘Erase-aBase’ deletion library (Promega) was constructed based on psGnRH(S-K). DNA sequence analysis was carried out using a multiwell microtiter plate DNA sequencing system with T7 DNA polymerase (Amersham). The sequence data were computed by the University of Wisconsin Gene Computer Group (UWGCG) programs (Devereux et al., 1984) operated on a VAX computer and the DNA Strider 1,l program (Marck, 1987) run on an Apple computer. The Transcription Factor Database (TFD) at the EMBNet-node. University of Oslo, Norway, was also used. Positions in the DNA or cDNA sequence are always calculated from the first base of any described sequence. Kel’erse transcription Total RNA was prepared from hypothalamic tissue from sexually mature Atlantic salmon by a single-step acid guanidinium-phenol extraction (Chomcynski and Sacchi, 1987) using RNAzol B (Cinna/Bioteck, Friendswood, TX, USA). 10 pg total hypothalamic RNA was reverse transcribed in a 50 ~1 reaction containing 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 10 mM dithiothreitol (DTT), 3 mM MgCl,, 500 PM of each dNTP, 20 U RNasin (Promega), 500 pug/ml oligo dT-adaptor primer (Frohman et al., 1988) and 800 U M-MLV reverse transcriptase (BRL) at 37°C for

169

60 min. The cDNA reaction was diluted to 0.1 ml in TE (10 mM Tris-Cl (pH 7.4) and 1 mM EDTA (pH 8.0)) and stored at -20°C.

cherichia co/i. Plasmid sequenced.

cDNA amplification sGnRH cDNA (5 ~1 from the total of 100 ~1) was amplified in a 100 ~1 reaction containing 10 mM Tris-HCI (pH 8.3), 50 mM KCI, 1.5 mM MgCl,, 0.001% gelatin, 50 PM of each dNTP, 0.5 FM signal peptide primer (5’ CG GAATTC ATG GAT CTT AGC AAC AGA ACG GT 3’1, 0.5 PM adaptor primer (Frohman et al., 1988) and 2.5 U Taq polymerase (Cetus). Polymerase chain reaction (PCR) was run for 50 cycles at 94°C for 1 min (denaturation), at 60°C for 1 min (annealing) and at 72°C for 2 min (elongation). PCR products (l/10 of the reaction mixture) were analyzed by agarose gel electrophoresis.

Results

Cloning of PCR products PCR products (12.5 ~1) of 400-900 bp in length were size fractionated and purified from an agarose gel (Heery et al., 1990). The eluate was ethanol precipitated and dissolved in 100 /*I TE of which 1 ~1 were amplified as above for 25 cycles. The PCR products were cloned into the pGEM7 vector (Promega) as described (Lorens, in press). Briefly, half of the PCR reaction was concatemerized by treatment with Klenow, T4 polynucleotide kinase and T4 DNA ligase. The concatemeric DNA was digested with ClaI, Iigated to the vector and transformed into EsBbv II

Bgl II

HinD III

stu

I

DNA

was

purified

and

Four positive clones were isolated from the genomic library after plaque hybridization at high (.WC> stringency, using the mix probe. Further characterization of the four clones with Southern blot analyses using either the mix or the unique probe at high stringency revealed two distinct classes of clones, based on hybridization and restriction fragment patterns. The only clone which hybridized to the unique probe was designated AsGnRH-1 and selected for subcloning and DNA sequence analysis. The restriction map (Fig. 1) is in agreement with data empirically obtained from Southern blot analyses (results not shown). The psGnRH subclones were shown to contain a signal peptide coding sequence coupled to the GnRH coding domain using the oligonucleotide mix probe as the sequencing primer. The psGnRHtS-K) clone was chosen to construct a deletion library for rational sequencing of the complete GnRH gene. Sequence information downstream from the KpnI site was carried out by primer walking on the psGnRH(S-S) subclone. Using this strategy a sequence of 7607 bp was analyzed. The general structure of the gene is given in Fig. 1, and Fig. 2 shows 4500 bp of this sequence. All sequence information has been

Bbv II

Kpnt

HinD III Kpn II Bbv II

Salmon

Human

Rat

m

signal peptide

OGllRH m

processing site

0

GnRH associated peptide

-

200bpexon

sequence

5‘ and 3‘ nontranslated regions

-

loo0bp intron sequence

Fig. 1. Structure and restriction map of the Atlantic salmon prepro-GnRH gene. Site positions are: Bh1,11: 765, 3647, 6149; BglII: 1540; HindIII: 2400, 5629; SluI: 3082; f@nI: 4434, 5402 (see Fig. 2). A comparison with the exon/intron structure of the human and rat GnRH genes (Adelmen et al., 1986) is shown below.

The cloned cDNA contains an open reading frame of 246 nucleotides encoding 82 amino acids. Salmon prepro-GnRH is composed of a 23 amino acid signal peptide, the GnRH decapeptide, a three residue proteolytic processing site and the C-peptide GAP of 46 amino acids. For exact positions in the genomic sequence, the coordinates are given in Fig. 2. The 3’-nontranslated sequence contains a consensus poly(A) signal sequence (AATAAAI 15 nucleotides upstream of the poly(A) tail (Fig. 3). In addition to TATA, CAT and GC boxes, several consensus pituitary

Fig. 7. The complete sequence of the GnRH gene in Atlantic salmon with exon I, II. III and IV. Promoter CAAT. TATA and GC hoxea, enhancer elements. putative exon 1. GnRH coding sequence and poly-A signal sequences are underlined. Exon II. 111 and IV arc in capital letters. P,: TATA (1281), CAT (1233 and 1249). GC box (1205), cap site (1306). PL: TATA (2722), cap site (2550). Putative exon I: 1306-1329 or 2550-2589. Exon II: 2775-2917, with GnRH at position 2849-2878. Exon III: 3195-3275. Exon IV: 3583S3804. with poly(A) signal at position 3790.

171

ATG Met

GAT asp

CTT XC lf?" ser

AAC asn

AGA arq

ACG GTT ttlr "al

GTG val

CAG qm

GTG va1

GTG val

GTG TTG v.31 leu

GCG ala

TTG 1eu

GTA val

GCT ala

CAG gin

GTC va1

ACT thr

CTC leu

TCT ser

CAG qln

CAC his

TGG trp

TCG ser

TAT tyr

GGC qly

TGG trp

CTA leu

CCT pro

GG gly

GGF gly

AAG lys

AGA arq

AGT ser

GTA val

GGG gly

GAG qlu

CTG Leu

GAL qlu

KC ala

ACC thr

AK ile

AAG lys

ATG met

ATG met

GAC asp

ACA thr

GGA qly

GGT gly

GTA val

GTG "al

GCT ala

CTT leu

CCT pro

GAG qlu

GAG qlu

ACA thr

AGG arq

CTG leu

AGA arq

CCA pro

TAT tyr

GAT asp

GTA ATA val,ile

TTG leu

RAG lys

AAA lys

TGG trp

ATG met

CCC pro

t

AGT ser

GCC ala

CAT his

GTC val

TCA ser

GAG qlu

i41/81 CAT AAA t.is iys

TAA OCH

AGAACTGTGAGACCATTATTCACAAAAGAAGCAAGRAGACAACATCAAGCAGACATTCAGCATCACT

ATCAACATCAATGATGGAGCRACTACAGTTCTACATTTATGTTATTTACTTGA 396 AG~ATAACACTTTAACCTTCTGTAAAATTGTAATRAAGAG

Fig. 3. Atlantic

salmon prepro-GnRH

amino acids. Salmon prepro-GnRH residues long proteolytic

cDNA

and amino acid sequence.

The open reading

is composed of a 23 amino acids long signal peptide,

processing site and the C-peptide

GAP

elements (Fig. 2).

were identified

by

Discussion In this study we describe the detailed structure of the Atlantic salmon GnRH gene and the corresponding mRNA. The cloning of the cDNA demonstrates that the isolated gene is expressed in the brain of sexually mature Atlantic salmon. Salmon has previously been shown to express two forms of GnRH in the brain: the sGnRH and the equivalent to the chicken GnRH-II variant (Sherwood, 1986). The described DNA sequence encodes the sGnRH which is the major species found in salmon brain. A second class of genomic clones obtained during our screening procedure represents a putative candidate of a GnRH-like peptide encoding gene (data not shown). The distribution of exons and introns was unambiguously determined for all sequences downstream of the prepro-GnRH ATG translational start signal by direct alignment of the cDNA to the genomic sequence (Fig. 2). This comparison verified all splice sites except a putative exon I donor site which was not covered by the cDNA. A computer search for conserved promoter sequence elements revealed various possible TATA and CAT boxes. The best conserved pro-

of 246 nucleotides decapeptide

of 46 residues. The arrows show the localization

bp) and intron 3 (307 bp). Positions are given for nucleotides/amino

specific transcription the computer search

frame

the GnRH

encodes 82

(in box), a three of intron 2 (277

acids. The poly(A) site signal is underlined.

moter context is found 1494 bp upstream of exon II with a TATAATT sequence at position 1281 and CCAAT at position 1249, alternatively CCAT at position 1233 (Fig. 2). These boxes are located at - 25, - 57 and - 73, respectively, relative to a putative cap site and thus resembles a consensus for a RNA polymerase II promoter. Two GC boxes, the binding sequence for transcription factor SPl (Gidoni et al., 1984; Briggs et al., 1986), were found. One lies within the promoter GnRH(P,) (TAGGCGTAA at position 12051, the other further downstream (TAGGCGGAGT at position 1757). The position of P, 1494 kb upstream from exon II is in good agreement with the situation for the mammalian genes (Adelman et al., 1986; Mason et al., 1986). The high degree of consensus sequences together with the analogous relative position as compared to the mammalian genes suggest that P, is the candidate for the sGnRH major promoter. An alternative promoter GnRH(P,) is found 251 bp upstream of exon II (Fig. 21, with a TATAAAA at position 2524 and an alternative transcriptional start site at position 2550. The activity of the two promoter regions P, and P, will be tested using 5’ end PCR amplification and fusion gene expression experiments. A pituitary specific transcription factor element, A*/,“/,TATNCAT, which is found up-

172

malian GnRH by six nucleotide changes which allow the two amino acid differences between the two GnRH variants. The signal peptide is 23 amino acids and has the typical content of hydrophobic or nonpolar amino acids, but shows no sequence identity to the compared mammalian signal peptides. The differences in this region are also considerable within mammalian or fish. Furthermore, no similarity is found when comparing the GAP sequences where the salmon GAP is 10 amino acids shorter than the mammalian counterparts. The recent characterization of a cichlid GnRH cDNA shows a similar pattern of conserved domains apart from the finding of partial conserved signal peptide as well (Bond et al., 1991). When comparing the cichlid GAP with the salmon GAP 30 out of 46 residues are identical. However, the cichlid GAP is eight amino acids longer than salmon GAP, probably due to a deletion/insertion in exon IV. The similarity between salmon and the cichlid GnRH is 69.3% when comparing the protein coding sequence. Specifically, the similarity is 71.0%, 86.7% and 64.2% in the coding regions of the signal peptide, GnRH and GAP, respectively. The rules for RNA splicing seem to be highly conserved among vertebrates, following the GT (donor) and AG (acceptor) sequence rule. Within the sGnRH gene there is, however, one of the exceptions where the consensus GT is changed to GC in the exon II splice donor site at position 2918. Apart from this nucleotide substitution, the splice site (5’ AGGCAAGT 3’) is in agreement with the extended consensus 5’ A(,,,G(,,,G(,,,,,,TAAGT 1987). An (100) (h2) (69) (X4) (h3) 3’ (Lewin, identical GC donor site is also found in the

stream in the two pituitary genes encoding prolactin and growth hormone (Rosenfeld et al., 1988) is also found in multiple copies in the GnRH gene. By allowing one mismatch from the conserved sequence, or the complementary scquence, as many as nine sequences were found within 1 kb upstream of P, (position 228, 371, 510, 523, 588, 608, 702, 947 and 1196). From the above discussion it seems correct to suggest the existence of an exon 1 and thus, the overall structure of the sGnRH gene consists of four exons and is similar to the three known mammalian homologues (Adelman et al., 1986; Mason et al., 1986). One minor difference is the size of intron 2 and 3 which is only 277 and 307 bp, respectively, in salmon, but varies from 1321 to 2120 bp in the mammalian GnRH genes (Fig. 1). Hence, the sGnRH gene spans 2484 bp from the putative cap site at position 1306 to the poly(A) signal at position 3790. The determination of the polyadenylation site to 1.5 bp downstream from the poly(A) signal is somewhat uncertain due to the high content of adenosine residues in this region (see Figs. 2 and 3). In such a sequence, the thymidine-rich primer used for the cDNA synthesis might initiate reverse transcription at an internal oligo-A sequence. The prepro-GnRH coding domain spans exons II-IV (Figs. 1 and 3). A comparison of preproGnRH from salmon with the mammalian counterpart molecules reveals a high degree of sequence homology within the GnRH domain and the following proteolytic cleavage site both at the nucleic acid and the amino acid sequence level (Fig. 4). The coding domain of GnRH in both Atlantic salmon and the cichlid Haplochromis burtoni (Bond et al., 1991) differs from the mam-

sGnRH

ylr-

ills

Tri‘

.sixr

7-j”

;

mGnR”

~~~

~~_

__~

~~_

___

___

y

?rg> Le.1

_,rl

Arg

PT2

Gly

Gly

:.yr

Arq

___

_~~

___

~~~

~~~

Fig. 4. Comparison of the highly conserved region of the prepro-GnRH gene encoding the GnRH decapeptide and the following proteolytic processing site in salmon. cichlid (Bond et al., 1991) and three mammalian species (Sherwood et al.. 1983; Adelman et al., 1986: Mason et al., 1986).

173

rainbow trout GnRH gene (Klungland, unpublished results). The translational start signal for initiation of the prepro-GnRH biosynthesis reads CCCATGG at position 2777. This context is very uncommon since the consensus for an active start site is A case has been reported where a two bp deletion in the cu-globin gene creates a CCCATGG start signal instead of the usual ACCATGG and thereby leads to gene inactivation and a-thalassemia (Merle et al., 1985). On the other hand, four out of 211 examined mRNAs had a C in -3 (Kozak, 1984). Fusion gene expresposition sion experiments are in progress to test this start codon by expressing firefly luciferase (deWet et al.. 1987) as a reporter protein. In the rat, Adelman et al. (1987) showed that the GnRH locus is transcribed from both complementary DNA strands, which is uncommon in eukaryotic genomes but has an economical rationale in compact virus genomes (Roberts et al., 1986). Preliminary data suggest expression of the GnRH genomic region in salmon heart tissue also (data not shown). The complementary strand of the prepro-GnRH gene contains sequences which might represent a salmon homologue to the rat SH gene.

Acknowledgements The authors are grateful to Dr. Berit Johansen for providing the Atlantic salmon genomic library. Financial support has been received from the Agricultural Research Council of Norway and the Norwegian Fisheries Research Council.

References Adelman, J.P., Mason, J., Hayflick, J.S. and Seeburg, P.H. (1986) Proc. Nat]. Acad. Sci. USA X3, 179-183. Adelman, J.P., Bond, C.T., Douglass, J. and Herbert, E. (19871 Science 235, 1514-1526. Bond, CT., Francis, R.C., Fernald, R.D. and Adelman, J.P. (1991) Mol. Endocrinol. 5, 931-937. Briggs, M.R., Kadonaga, J.T., Bell, S.P. and Tjian, R. (1986) Science 234, 47-52. Burgus, R., Butcher, M., Amoss, M., Ling, N., Monahan, M.,

Rivier, J., Fellows, R., Blackwell, R., Vale. W. and Guillemin, R. (1972) Proc. Natl. Acad. Sci. USA 69, 27X2X2. Chomcynski. P. and Sacchi, N. (19871 Anal. Biochem. 162, 156-159. Devereux, J., Haeberli, P. and Smithies, 0. (19841 Nucleic Acids Res. 12, 3X7-395. deWet, J.R.. Wood, K.V., deluca. M., Helinski, D.R. and Subramani, S. (lYX71 Mol. Cell. Biol. 7, 725-737. Frohman. M.A., Dush, M.K. and Martin, G.R. (19881 Proc. Nat]. Acad. Sci. USA X5, 899X-YO02. Gidoni, D.. Dynan, W.S. and Tjian. R. (19841 Nature 312. 409-413. Heery, D.M., Cannon, F., Powell, R. (19901 Trends Genet. 6, 173. Heierhorst, J., Morley, SD.. Figueroa, J.. Krentler, C., Lederis. K. and Richter, D. (1989) Proc. Nat]. Acad. Sci. USA X6, 524225246. Johansen, B. and Valla, S. (lY871 in Proceedings World Symposium on Selection, Hybridization, and Genetic Engineering in Aquaculture, Bordeaux (Tiews, K.. ed.1, Vol. 2, pp. 372-375, Berlin. King, J.A. and Millar, R.P. (19821 J. Biol. Chem. 257, 1072910732. Kozak, M. (1984) Nucleic Acids Res. 12, X57-872. Kozak, M. (1986) Cell 44, 2X3-292. Lewin, B. (lYX7) in Genes III, p. 388, John Wiley. New York. Lorens, J.B. (1991) PCR Methods Applications 1. 140-141. Maniatis, T.. Fritsch, E.F. and Sambrook, J. (19821 in Molecular Cloning - A Laboratory Manual, p. 320, Cold Spring Harbor Laboratory Press. Cold Spring Harbor, NY. Marck, C. (19871 Nucleic Acid Res. 16, 182Y-1836. Mason, A.J., Hayflick. J.S., Zoeller, R.T.. Young, III, W.S., Phillips, H.S.. Nikolics, K. and Seeburg, P.H. (19861 Science 234, 1366-1371. Matsuo, H., Baba, Y., Nair, R.M.G., Arimura, A. and Schally, A.V. (19711 Biochem. Biophys. Res. Commun. 43, 1334133’). Mayo, K.E., Vale, W., Rivier, J., Rosenfeld, M.G. and Evans, R.M. (19831 Nature 306, X6-8X. Miyamoto, K., Hasegawa. Y., Igarashi, M., Chino, N., Sakakibara, S., Kangawa, K. and Matsuo, H. (19831 Life Sci. 32, 1341-1347. Miyamoto, K., Hasegawa, Y.. Nomura, M., Igarashi, M., Kangawa, K. and Matsuo, H. (1984) Proc. Natl. Acad. Sci. USA Xl, 387443878. Mode, F., Lopez, B., Henni, T. and Godet, J. (19851 EMBO J. 4, 1245-1250. Nikolics, K., Mason, A.J., Szonyi, E., Ramachandran, J. and Seeburg. P.H. (19851 Nature 316, 511-517. Roberts, R.J., Akusjarvi. Cl., Alestrom, P., Gelinas, R.E.. Gingeras, T.R., Sciaky, D. and Pettersson, U. (19861 in Adenovirus DNA (Doerfler, W., ed.1, pp. I-51, Martinus Nijhoff, Boston, MA. Rosenfeld, M.G., Glass, C.K., Adler, S., Crenshaw, III, E.B., He, X., Lira, S.A., Elsholtz, H.P., Mangalam, H.J., Holloway, J.M., Nelson, C., Albert, V.R. and Ingraham, H.A. (19881 Cold Spring Harbor Symp. Quant. Biol. 53,545-556.

174 Seeburg. P.H., Mason, A.J., Young, III, W.S., Stewart, T.A. and Nikolics, K. (1YXY) J. Steroid Biochem. 33, h87-691. Sherwood. N. (19%) Am. Zool. 26, 1041-1054. Sherwood, N., Eiden, L.. Brownstein, M., Spiess, J., Rivier, J. and Vale. W. (1983) Proc. Natl. Acad. Sci. USA 80. 2794-2198.

Thomas, G.B.. Cummins, J.T.. Doughton, B.W., Griffin, N., Millar, R.P., Milton, R.C.L. and Clarke, 1.J. (1988) Neuroendocrinology 48, 342-350. Yu, W.H., Arisawa, M.. Millar, R.P. and McCann, SM. (1989) Peptides 10, 1133% 1138.