- Email: [email protected]
The complete nucleotide sequence and synthesis of infectious RNA of genomic and defective interfering RNAs of TBSV-P
Virus Research 69 (2000) 131 – 136 www.elsevier.com/locate/virusres
Short communication
The complete nucleotide sequence and synthesis of infectious RNA of genomic and defective interfering RNAs of TBSV-P Gyo¨rgy Szittya a,*, Pa´l Salamon b, Jo´zsef Burgya´n a a
Agricultural Biotechnology Center, Plant Science Institute, 2101 Go¨do¨llo3 , Hungary b Fitoteszt, 4521 Berkesz, Hungary
Received 10 April 2000; received in revised form 15 June 2000; accepted 16 June 2000
Abstract The complete nucleotide sequences of the genome of the pepper isolate of tomato bushy stunt Tombusvirus (TBSV-P), and its defective interfering (DI) RNAs were determined. The genome of TBSV-P is a linear singlestranded monopartite RNA molecule of positive polarity, 4776 nucleotides long and has an organisation identical to that reported for other tombusviruses. In vitro transcripts of the genome were highly infectious, and it could support replication of the DI RNAs associated with the wild type virus. Two DI RNAs were found in the infected leaves of Nicotiana cle6elandii, whose sequences were completely derived from the genomic RNA. The longest DI RNA (DI-5) has 550 nucleotides (nt), while the shorter DI RNA (DI-4) composed of 463 nt, both of them were formed by essentially the same genomic sequence blocks. Since host specificity of TBSV-P and other tombusviruses with available infectious cDNA clones is different, it is feasible to carry out gene exchange studies to determine viral host specificity factors for tombusviruses. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Tombusvirus; Sequencing; In vitro transcript; DI RNAs
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper have been submitted to Genbank under accession number U80935 (TBSV-P); AF038044 (DI-5) and AF241533 (DI-4). * Corresponding author. Tel.: + 36-28-430600; fax: + 3628-430482. E-mail address: [email protected] (G. Szittya).
Tomato bushy stunt virus (TBSV) is the type member of the Tombus6irus genus of plant viruses. The approx. 4.8 kilobase (kb) RNA genome of tombusviruses contains at least four non-structural proteins (33, 92, 22 and 19 kDa) and the coat protein (41 kDa) (Russo et al., 1994). A 33 kDa protein (ORF 1) and a 92 kDa protein (ORF 2) are required for viral replication (Dalmay et al., 1993; Kolla´r and Burgya´n, 1994;
0168-1702/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 0 ) 0 0 1 7 8 - 7
132
G. Szittya et al. / Virus Research 69 (2000) 131–136
Scholthof et al., 1995a; Oster et al., 1998). The 41 kDa coat protein is encoded by ORF 3 (Russo et al., 1994). The 22 kDa protein (ORF 4) is necessary for cell-to-cell movement (Rochon and Johnston, 1991; Dalmay et al., 1993; Scholthof et al., 1993) and it also has a role in symptom determination of certain hosts (Scholthof, et al., 1995b). The 19 kDa protein (ORF 5) has a role in symptom development (Rochon and Johnston, 1991; Dalmay et al., 1993; Scholthof, et al., 1995b). It also participates in virus spread in a host specific manner (Scholthof, et al., 1995c) and it can serve as a virus encoded suppresser of gene silencing (Voinnet et al., 1999). The generation of DI RNAs upon several passages of tombusviruses is a well known phenomenon (Hillman et al., 1987; Burgya´n et al., 1989; Burgya´n et al., 1991; Finnen and Rochon, 1993; Rubino et al., 1995). Tombusvirus DI RNAs have a common structural arrangement containing three conserved sequence blocks. Block A derived from the 5% proximal terminus, block B derived from an internal region of the replicase gene and block C derived from the 3% proximal terminus of the viral genome (Russo et al., 1994; White, 1997). One of the most powerful molecular biological tools for studying the symptom and host range determinants of viruses is the genome exchange between viruses having different symptoms and host specificity. However, host specificity determinants of tombusviruses are not well characterised due to the similarity of host range and symptoms elicited by the members with available infectious cDNA clones of the genus (Martelli et al., 1988). As a first step to identify these viral factors we
Fig. 1. Symptoms caused by TBSV-P on D. stramonium (A) and C. annum (B) plants 14 and 10 days after inoculation, respectively.
characterised a new isolate of TBSV, a tombusvirus with different host specificity compared with the previously characterised viruses of this genus. A pepper plant (Capsicum annuum) showing unusual yellow spots, rings and line pattern symptoms was found in a polyethylene tunnel at Farkasmajor in Hungary and transplanted for etiological studies. Several test plants inoculated by the leaf extract reacted either with local or with local and systemic symptoms characteristic to tombusviruses. On Datura stramonium (Fig. 1A) local necrotic spots followed by systemic isolated necrotic spots and twisting of the top leaves have appeared. Most of the pepper test plants (e.g. cvs. Fehe´ro¨zo¨n, HRF1, Javı´tott Cecei, Yolo Wonder) reacted with chlorotic local lesions followed by the slow appearance of systemic symptoms consisted of isolated yellow, sometimes circular spots on the top leaves (Fig. 1B). Etiological studies indicated that we have found a TBSV isolate (named TBSV-P) which has a significantly different host range than the other well characterised tombusvirus, cymbidium ringspot virus (CymRSV) (Russo et al., 1988), which fails to infect pepper and D. stramonium. This host range difference makes TBSV-P an interesting and useful candidate to carry out gene exchange studies to determine viral gene(s) responsible for host specificity. Therefore, TBSV-P was further characterised, the complete nucleotide sequence was determined and full-length infectious clone was prepared. Virions were visualised in crude and partially purified extracts of pepper leaves and of the leaves of N. benthamiana test plants. Electron microscopy revealed spherical particles, ca 30 nm in diameters typical for tombusvirus (not shown). Total RNA was extracted from virus infected N. cle6elandii plants and the accumulation of virus RNAs was analysed by Northern hybridisation (Sambrook et al., 1989). TBSV-P infected plants showed the presence of three major viral RNA species whose pattern was identical to other tombusvirus (Fig. 2). After few passages, other small RNA species with approximately the size of 500 nt were also found in total RNA extracts (Fig. 2).
G. Szittya et al. / Virus Research 69 (2000) 131–136
Fig. 2. Northern blot analysis of nucleic acids extracted from CymRSV (lane 1), TBSV-P (lane 2) particles and TBSV-P infected N. cle6elandii plants (lane 3). Hybridisation was with a mixture of random probed cDNA clone representing the 3%-terminal 800 nt of TBSV-P and CymRSV RNAs. The positions of genomic (G), subgenomic (sg1 and sg2) and defective interfering (DI) RNAs are marked.
To determine the primary sequence of TBSV-P, the RNA was extracted from virus particles purified from systemically infected leaves of N. cle6elandii (Gallitelli et al., 1985; Dalmay et al., 1993). The virus RNA was polyadenilated at the 3% end with poly(A) polymerase (Bethesda Research Laboratories, BRL) and used as template for oligo(dT) primed cDNA synthesis (cDNA System Plus, Amersham). Double-stranded DNA was cloned into pUC18 and recombinant clones were sequenced (Sanger et al., 1977). The sequence of the 5% region of TBSV-P RNA was determined by
133
dideoxynucleotide terminated reverse transcription (Zimmern and Kaesberg, 1978) using the oligonucleotide 5%-GGTAGACCCAACCTTCAAACCCC-3’ complementary to nucleotides 102–125 in the final sequence of genomic RNA. The first nucleotide of TBSV-P genome was determined by the same method as described by Rubino et al. (1995). The first nucleotide of TBSV-P is A, which seems to exclude the presence of a cap at the 5% end. This is in accordance with an earlier report by Rubino et al. (1995) in a study of carnation Italian ringspot virus (CIRV), which is the other specie in the genus. We were unable to determine whether the 3% terminal nucleotide of TBSV-P ends with an A at position 4777 or a C at position 4776, since the viral RNA had been in vitro polyadenilated. So, the A nucleotide may be derived from in vitro polyadenilation of the genomic RNA. However, C as the terminal nucleotide is a common feature to tombus- and carmoviruses, as well as the related genera Necro6irus, Machlomo6irus, Diantho6irus and Luteo6irus (Russo et al., 1994), it can be assumed that the terminal nucleotide of TBSV-P may also be a C. The genome of TBSV-P is 4776 nt long and consists of five ORF (Fig. 3.). The first ORF starts
Fig. 3. Schematic representation of the genomic organisation of TBSV-P and its naturally occurring DI RNAs. The locations of open reading frames (ORF) and the approximate Mrs of encoded proteins are indicated in the shaded boxes. Genomic RNA sequences conserved in DI RNAs are shown below as shaded blocks. Thick lines indicate non-coding region and deleted regions are depicted as dotted lines. The numbers of deleted bases are shown below the lines. Dashed lines show the origin of sequences conserved in DI RNAs. The numbers above the shaded areas are the sizes of the genomic RNA blocks (in nucleotides).
134
G. Szittya et al. / Virus Research 69 (2000) 131–136
from an AUG at nts 165 – 167 and terminates with an amber stop codon UAG at nts 1055 – 1057. Readtrough of the leaky amber termination codon would extend the frame up to a stop codon at nt 2621–2623 (ORF 2). ORF 3 is from nt 2653 and terminates with a UAG at nts 3817 – 3819. ORF 4 starts at nt 3857 and terminates with a UGA at 4424–4426. ORF 5 is nested in ORF 4 in a different frame beginning with an AUG at nt 3887 –3889 and terminating with UAA at nt 4405 –4407. The predicted Mrs of the polypeptides encoded by the five ORFs are, respectively, 33 390 (33K); 92 591 (92K); 41 188 (41K); 21 566 (22K); 19 365 (19K). The 5% untranslated region is 164 nt long and the 3% untranslated region is 350 nt long. The genome of TBSV-P has an organisation similar to that reported for the other tombusviruses (Russo et al., 1994). Comparative sequence analysis revealed that, TBSV-P has the closest relationship (934 nt sequence similarity) to the sequenced cherry strain of TBSV (Hearne et al., 1990). However, there are significant biological differences between the two viruses (e.g. the in vitro transcript of TBSV-Ch strain is not infectious on pepper (Scholthof et al., 1995c), while TBSV-P in vitro transcript readily infects pepper). In addition, the amino acid identity are significantly lower (93.6%) in ORF4 than in the other ORFs of the two viruses and it is known that the protein product (p19) of this ORF is an important pathogenecity determinant (Russo et al., 1994; Scholthof et al., 1995b,c; Voinnet et al., 1999). Three passages of TBSV-P on N. cle6elandii resulted in symptom attenuation and accumulation of small virus associated RNAs (Fig. 2.) characteristic for DI RNAs of tombusviruses (Russo et al., 1994). Several cDNA clones were prepared from these putative DI RNAs with RTPCR and the size of inserts was analysed. Two different insert categories were identified and one clone for each category was sequenced. Both RNA completely derived from TBSV-P genome and consisted of three sequence blocks (A, B and C) (Fig. 3.). These results confirmed that the small RNAs are DI RNAs. The longer DI RNA (DI-5) was 550 and the shorter DI RNA (DI-4) was 463 nt long. Sequence similarities between DI-5 and
DI-4 RNAs strongly suggests that the smaller DI RNA originates from the larger precursor. This finding is in line with the hypothesis that small DI RNAs evolve from large precursors upon repeated passages (Burgya´n et al., 1991; Havelda et al., 1997). Full-length in vitro transcripts of TBSV-P and DI RNAs were prepared and tested for biological activity. Full-length clone of TBSV-P was constructed using newly prepared cDNA clones of the 5% 1075 nt of the TBSV-P RNA and a clone (Gy 20) approximately containing the last 4300 nt and the added poly(A) tail. The 5% containing 1075 nt, was cloned by priming the first strand synthesis with the oligonucleotide 5‘ ACACCAGGTAGACGTACTAGGCC 3‘ complementary to nt 1052–1075 of the genomic RNA sequence. The cDNA was amplified by PCR using the above oligonucleotide and oligo 5%-T7 (5%ATCGATAATACGACTCACTATAGGAAATTCCCCAGGATT 3%), which contained the first 17 nt of TBSV-P genomic RNA (bold) fused to a 17 nt bacteriophage T7 RNA polymerase promoter consensus sequence (underline) and five bases contributing to the formation of a ClaI restriction site (italic). The major PCR product of approximately 1100 bp was cloned as described above. The resulting clones TBSV 5% and Gy 20 contained the 5% and 3% part of the viral genome, and were fused using the StuI site at position 1060. A unique SmaI restriction site was placed at the 3% terminus of TBSV-P to permit linearisation of the full-length clone. Biologically active cDNA clones of DI RNAs were prepared by RT-PCR using oligonucleotide 5%GGGCTGCATTGCTGCAA 3%, which is complementary to the last 17 nt of TBSV-P genomic RNA and T7-5% primer and it was cloned as described above. The first nucleotide of the TBSV-P genome sequence (A) was substituted by G to allow efficient transcription by T7 RNA polymerase (Dunn and Studier, 1983). In vitro transcripts of TBSV-P RNA were infectious. All the plants inoculated either with the wild-type viral RNA or in vitro synthesised TBSV-P RNA showed similar symptoms developed with the same intensity and rapidity. Northern blot analysis confirmed that the pattern of viral specific genomic and subgenomic RNA species were equivalent to the wild-type
G. Szittya et al. / Virus Research 69 (2000) 131–136
135
References
Fig. 4. Northern blot analysis of nucleic acids extracted from N. cle6elandii plants inoculated with TBSV-P viral RNA (lanes 1), in vitro transcript of TBSV-P (lane 2) and in vitro transcripts of genomic RNA mixed with in vitro synthesised DI-4 RNAs (lanes 3 and 4) or with in vitro transcripts of DI-5 RNAs (lanes 5 and 6). The samples in 3, 4, 5 and 6 were taken from different plants of the same infection. G, sg1, sg2, DI-4 and DI-5 show the position of genomic, subgenomic and defective interfering RNAs, respectively. Hybridisation was with a random probed cDNA clone representing the 3%-terminal 800 nt of TBSV-P RNA.
viral RNA (Fig. 4). TBSV-P DI RNA caused symptom attenuation on N. cle6elandii plants. To test the biological activity of the cloned TBSV-P DI RNAs, N. cle6elandii plants were inoculated with in vitro synthesised DI RNAs in the presence of helper genome. The DI RNAs replicated well and accumulated at high levels in the inoculated plants (Fig. 4). In addition, there was no difference in symptom attenuation if the wild type or in vitro synthesised DI RNA was present in the inoculated plants, indicating that the cloned DI RNAs were biologically active. In conclusions, biological features as host range and symptoms on test plants, electron microscopy studies, sequence similarities and genome organisation all indicated that TBSV-P is a member of the Tombus6irus genus showing close relationship to the sequenced cherry strain of TBSV. However, the biological properties of TBSV-P make it possible to characterise it and the infectious cDNA clone can be useful for further studies to identify host specificity factors for tombusviruses.
Acknowledgements We thank Da´niel Silhavy (ABC, Go¨do¨llo3 , Hungary) for useful comments on the manuscript.
Burgya´n, J., Grieco, F., Russo, M., 1989. A defective interfering RNA in cymbidium ringspot virus infections. J. Gen. Virol. 70, 235 – 239. Burgya´n, J., Rubino, L., Russo, M., 1991. De novo generation of cymbidium ringspot virus defective interfering RNA. J. Gen. Virol. 72, 505 – 509. ´ ., Russo, M., Dalmay, T., Rubino, L., Burgya´n, J., Kolla´r, A 1993. Functional analysis of cymbidium ringspot virus genome. Virology 194, 697 – 704. Dunn, J.J., Studier, F.W., 1983. Complete nucleotide sequence of bacteriophage T7 DNA and the location of T7 genetics elements. J. Mol. Biol. 166, 477 – 535. Finnen, R.L., Rochon, D.M., 1993. Sequence and structure of defective interfering RNAs associated with cucumber necrosis virus infections. J. Gen. Virol. 74, 1715 – 1720. Gallitelli, D., Hull, R., Koenig, R., 1985. Relationship among viruses in the tombusvirus group: nucleic acid hybridization studies. J. Gen. Virol. 66, 1523 – 1531. Havelda, Z., Dalmay, T., Burgya´n, J., 1997. Secondary structure-dependent evolution of Cymbidium ringspot virus defective interfering RNA. J. Gen. Virol. 78, 1227 – 1234. Hearne, P.Q., Knorr, D.A., Hillman, B.I., Morris, T.J., 1990. The complete genome structure and synthesis of infectious RNA from clones of tomato bushy stunt virus. Virology 177, 141 – 151. Hillman, B.I., Carrington, J.C., Morris, T.J., 1987. A defective interfering RNA that contains a mosaic of plant virus genome. Cell 51, 427 – 433. Kolla´r, A., Burgya´n, J., 1994. Evidence that ORF 1 and 2 are the only virus encoded replicase gene of cymbidium ringspot tombusvirus. Virology 201, 169 – 172. Martelli, G.P., Gallitelli, D., Russo, M., 1988. Tombusviruses. In: Koenig, R. (Ed.), The Plant Viruses, vol. 3. Plenum Publishing, New York, pp. 13 – 72. Oster, S.K., Wu, B., White, A., 1998. Uncoupled expression of p33 and p92 permits amplification of tomato bushy stunt virus RNAs. J. Virol. 72, 5845 – 5851. Rochon, D.M., Johnston, J.C., 1991. Infectious transcripts from cloned cucumber necrosis virus cDNA. Evidence for a bifunctional subgenomic mRNA. Virology 181, 656 – 665. Rubino, L., Burgya´n, J., Russo, M., 1995. Molecular cloning and complete nucleotide sequence of carnation Italian ringspot tombusvirus genomic and defective interfering RNAs. Arch. Virol. 140, 2027 – 2039. Russo, M., Burgya´n, J., Carrington, J.C., Hillman, B.I., Morris, T.J., 1988. Complementary DNA cloning and characterization of cymbidium ringspot virus genome. J. Gen. Virol. 69, 401 – 406. Russo, M., Burgya´n, J., Martelli, P.G., 1994. The molecular biology of Tombusviridae. Adv. Virus Res. 44, 382 – 424. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA seqencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463 – 5467.
136
G. Szittya et al. / Virus Research 69 (2000) 131–136
Scholthof, H.B., Morris, T.J., Jackson, A.O., 1993. The capsid protein gene of tomato bushy stunt virus is dispensable for systemic movement and can be replaced for localized expression of foreign genes. Mol. Plant-Microbe Ineract. 6, 309 – 322. Scholthof, K.-B.G., Scholthof, H.B., Jackson, A.O., 1995a. The tomato bushy stunt virus replicase proteins are coordinately expressed and membrane associated. Virology 208, 365 – 369. Scholthof, H.B., Scholthof, K.-B.G., Jackson, A.O., 1995b. Identification of tomato bushy stunt virus host-specific symptom determinants by expression of individual genes from a potato virus X vector. Plant Cell 7, 1157–1172. Scholthof, H.B., Scholthof, K.-B.G., Kikkert, M., Jackson, A.O., 1995c. Tomato bushy stunt virus spread is regu-
.
lated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion. Virology 213, 425 – 438. Voinnet, O., Pinto, Y.M., Baulcobe, D.C., 1999. Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl. Acad. Sci. USA 96, 14147 – 14152. White, K.A., 1997. Formation and evolution of Tombusvirus defective interfering RNAs. Semin. Virol. 7, 409 – 416. Zimmern, D., Kaesberg, P., 1978. 3’-Terminal nucleotide sequence of encephalomyocarditis virus RNA determined by reverse transcription and chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 75, 4257 – 4261.
Short communication
The complete nucleotide sequence and synthesis of infectious RNA of genomic and defective interfering RNAs of TBSV-P Gyo¨rgy Szittya a,*, Pa´l Salamon b, Jo´zsef Burgya´n a a
Agricultural Biotechnology Center, Plant Science Institute, 2101 Go¨do¨llo3 , Hungary b Fitoteszt, 4521 Berkesz, Hungary
Received 10 April 2000; received in revised form 15 June 2000; accepted 16 June 2000
Abstract The complete nucleotide sequences of the genome of the pepper isolate of tomato bushy stunt Tombusvirus (TBSV-P), and its defective interfering (DI) RNAs were determined. The genome of TBSV-P is a linear singlestranded monopartite RNA molecule of positive polarity, 4776 nucleotides long and has an organisation identical to that reported for other tombusviruses. In vitro transcripts of the genome were highly infectious, and it could support replication of the DI RNAs associated with the wild type virus. Two DI RNAs were found in the infected leaves of Nicotiana cle6elandii, whose sequences were completely derived from the genomic RNA. The longest DI RNA (DI-5) has 550 nucleotides (nt), while the shorter DI RNA (DI-4) composed of 463 nt, both of them were formed by essentially the same genomic sequence blocks. Since host specificity of TBSV-P and other tombusviruses with available infectious cDNA clones is different, it is feasible to carry out gene exchange studies to determine viral host specificity factors for tombusviruses. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Tombusvirus; Sequencing; In vitro transcript; DI RNAs
Nucleotide sequence accession number. The nucleotide sequence data reported in this paper have been submitted to Genbank under accession number U80935 (TBSV-P); AF038044 (DI-5) and AF241533 (DI-4). * Corresponding author. Tel.: + 36-28-430600; fax: + 3628-430482. E-mail address: [email protected] (G. Szittya).
Tomato bushy stunt virus (TBSV) is the type member of the Tombus6irus genus of plant viruses. The approx. 4.8 kilobase (kb) RNA genome of tombusviruses contains at least four non-structural proteins (33, 92, 22 and 19 kDa) and the coat protein (41 kDa) (Russo et al., 1994). A 33 kDa protein (ORF 1) and a 92 kDa protein (ORF 2) are required for viral replication (Dalmay et al., 1993; Kolla´r and Burgya´n, 1994;
0168-1702/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 0 ) 0 0 1 7 8 - 7
132
G. Szittya et al. / Virus Research 69 (2000) 131–136
Scholthof et al., 1995a; Oster et al., 1998). The 41 kDa coat protein is encoded by ORF 3 (Russo et al., 1994). The 22 kDa protein (ORF 4) is necessary for cell-to-cell movement (Rochon and Johnston, 1991; Dalmay et al., 1993; Scholthof et al., 1993) and it also has a role in symptom determination of certain hosts (Scholthof, et al., 1995b). The 19 kDa protein (ORF 5) has a role in symptom development (Rochon and Johnston, 1991; Dalmay et al., 1993; Scholthof, et al., 1995b). It also participates in virus spread in a host specific manner (Scholthof, et al., 1995c) and it can serve as a virus encoded suppresser of gene silencing (Voinnet et al., 1999). The generation of DI RNAs upon several passages of tombusviruses is a well known phenomenon (Hillman et al., 1987; Burgya´n et al., 1989; Burgya´n et al., 1991; Finnen and Rochon, 1993; Rubino et al., 1995). Tombusvirus DI RNAs have a common structural arrangement containing three conserved sequence blocks. Block A derived from the 5% proximal terminus, block B derived from an internal region of the replicase gene and block C derived from the 3% proximal terminus of the viral genome (Russo et al., 1994; White, 1997). One of the most powerful molecular biological tools for studying the symptom and host range determinants of viruses is the genome exchange between viruses having different symptoms and host specificity. However, host specificity determinants of tombusviruses are not well characterised due to the similarity of host range and symptoms elicited by the members with available infectious cDNA clones of the genus (Martelli et al., 1988). As a first step to identify these viral factors we
Fig. 1. Symptoms caused by TBSV-P on D. stramonium (A) and C. annum (B) plants 14 and 10 days after inoculation, respectively.
characterised a new isolate of TBSV, a tombusvirus with different host specificity compared with the previously characterised viruses of this genus. A pepper plant (Capsicum annuum) showing unusual yellow spots, rings and line pattern symptoms was found in a polyethylene tunnel at Farkasmajor in Hungary and transplanted for etiological studies. Several test plants inoculated by the leaf extract reacted either with local or with local and systemic symptoms characteristic to tombusviruses. On Datura stramonium (Fig. 1A) local necrotic spots followed by systemic isolated necrotic spots and twisting of the top leaves have appeared. Most of the pepper test plants (e.g. cvs. Fehe´ro¨zo¨n, HRF1, Javı´tott Cecei, Yolo Wonder) reacted with chlorotic local lesions followed by the slow appearance of systemic symptoms consisted of isolated yellow, sometimes circular spots on the top leaves (Fig. 1B). Etiological studies indicated that we have found a TBSV isolate (named TBSV-P) which has a significantly different host range than the other well characterised tombusvirus, cymbidium ringspot virus (CymRSV) (Russo et al., 1988), which fails to infect pepper and D. stramonium. This host range difference makes TBSV-P an interesting and useful candidate to carry out gene exchange studies to determine viral gene(s) responsible for host specificity. Therefore, TBSV-P was further characterised, the complete nucleotide sequence was determined and full-length infectious clone was prepared. Virions were visualised in crude and partially purified extracts of pepper leaves and of the leaves of N. benthamiana test plants. Electron microscopy revealed spherical particles, ca 30 nm in diameters typical for tombusvirus (not shown). Total RNA was extracted from virus infected N. cle6elandii plants and the accumulation of virus RNAs was analysed by Northern hybridisation (Sambrook et al., 1989). TBSV-P infected plants showed the presence of three major viral RNA species whose pattern was identical to other tombusvirus (Fig. 2). After few passages, other small RNA species with approximately the size of 500 nt were also found in total RNA extracts (Fig. 2).
G. Szittya et al. / Virus Research 69 (2000) 131–136
Fig. 2. Northern blot analysis of nucleic acids extracted from CymRSV (lane 1), TBSV-P (lane 2) particles and TBSV-P infected N. cle6elandii plants (lane 3). Hybridisation was with a mixture of random probed cDNA clone representing the 3%-terminal 800 nt of TBSV-P and CymRSV RNAs. The positions of genomic (G), subgenomic (sg1 and sg2) and defective interfering (DI) RNAs are marked.
To determine the primary sequence of TBSV-P, the RNA was extracted from virus particles purified from systemically infected leaves of N. cle6elandii (Gallitelli et al., 1985; Dalmay et al., 1993). The virus RNA was polyadenilated at the 3% end with poly(A) polymerase (Bethesda Research Laboratories, BRL) and used as template for oligo(dT) primed cDNA synthesis (cDNA System Plus, Amersham). Double-stranded DNA was cloned into pUC18 and recombinant clones were sequenced (Sanger et al., 1977). The sequence of the 5% region of TBSV-P RNA was determined by
133
dideoxynucleotide terminated reverse transcription (Zimmern and Kaesberg, 1978) using the oligonucleotide 5%-GGTAGACCCAACCTTCAAACCCC-3’ complementary to nucleotides 102–125 in the final sequence of genomic RNA. The first nucleotide of TBSV-P genome was determined by the same method as described by Rubino et al. (1995). The first nucleotide of TBSV-P is A, which seems to exclude the presence of a cap at the 5% end. This is in accordance with an earlier report by Rubino et al. (1995) in a study of carnation Italian ringspot virus (CIRV), which is the other specie in the genus. We were unable to determine whether the 3% terminal nucleotide of TBSV-P ends with an A at position 4777 or a C at position 4776, since the viral RNA had been in vitro polyadenilated. So, the A nucleotide may be derived from in vitro polyadenilation of the genomic RNA. However, C as the terminal nucleotide is a common feature to tombus- and carmoviruses, as well as the related genera Necro6irus, Machlomo6irus, Diantho6irus and Luteo6irus (Russo et al., 1994), it can be assumed that the terminal nucleotide of TBSV-P may also be a C. The genome of TBSV-P is 4776 nt long and consists of five ORF (Fig. 3.). The first ORF starts
Fig. 3. Schematic representation of the genomic organisation of TBSV-P and its naturally occurring DI RNAs. The locations of open reading frames (ORF) and the approximate Mrs of encoded proteins are indicated in the shaded boxes. Genomic RNA sequences conserved in DI RNAs are shown below as shaded blocks. Thick lines indicate non-coding region and deleted regions are depicted as dotted lines. The numbers of deleted bases are shown below the lines. Dashed lines show the origin of sequences conserved in DI RNAs. The numbers above the shaded areas are the sizes of the genomic RNA blocks (in nucleotides).
134
G. Szittya et al. / Virus Research 69 (2000) 131–136
from an AUG at nts 165 – 167 and terminates with an amber stop codon UAG at nts 1055 – 1057. Readtrough of the leaky amber termination codon would extend the frame up to a stop codon at nt 2621–2623 (ORF 2). ORF 3 is from nt 2653 and terminates with a UAG at nts 3817 – 3819. ORF 4 starts at nt 3857 and terminates with a UGA at 4424–4426. ORF 5 is nested in ORF 4 in a different frame beginning with an AUG at nt 3887 –3889 and terminating with UAA at nt 4405 –4407. The predicted Mrs of the polypeptides encoded by the five ORFs are, respectively, 33 390 (33K); 92 591 (92K); 41 188 (41K); 21 566 (22K); 19 365 (19K). The 5% untranslated region is 164 nt long and the 3% untranslated region is 350 nt long. The genome of TBSV-P has an organisation similar to that reported for the other tombusviruses (Russo et al., 1994). Comparative sequence analysis revealed that, TBSV-P has the closest relationship (934 nt sequence similarity) to the sequenced cherry strain of TBSV (Hearne et al., 1990). However, there are significant biological differences between the two viruses (e.g. the in vitro transcript of TBSV-Ch strain is not infectious on pepper (Scholthof et al., 1995c), while TBSV-P in vitro transcript readily infects pepper). In addition, the amino acid identity are significantly lower (93.6%) in ORF4 than in the other ORFs of the two viruses and it is known that the protein product (p19) of this ORF is an important pathogenecity determinant (Russo et al., 1994; Scholthof et al., 1995b,c; Voinnet et al., 1999). Three passages of TBSV-P on N. cle6elandii resulted in symptom attenuation and accumulation of small virus associated RNAs (Fig. 2.) characteristic for DI RNAs of tombusviruses (Russo et al., 1994). Several cDNA clones were prepared from these putative DI RNAs with RTPCR and the size of inserts was analysed. Two different insert categories were identified and one clone for each category was sequenced. Both RNA completely derived from TBSV-P genome and consisted of three sequence blocks (A, B and C) (Fig. 3.). These results confirmed that the small RNAs are DI RNAs. The longer DI RNA (DI-5) was 550 and the shorter DI RNA (DI-4) was 463 nt long. Sequence similarities between DI-5 and
DI-4 RNAs strongly suggests that the smaller DI RNA originates from the larger precursor. This finding is in line with the hypothesis that small DI RNAs evolve from large precursors upon repeated passages (Burgya´n et al., 1991; Havelda et al., 1997). Full-length in vitro transcripts of TBSV-P and DI RNAs were prepared and tested for biological activity. Full-length clone of TBSV-P was constructed using newly prepared cDNA clones of the 5% 1075 nt of the TBSV-P RNA and a clone (Gy 20) approximately containing the last 4300 nt and the added poly(A) tail. The 5% containing 1075 nt, was cloned by priming the first strand synthesis with the oligonucleotide 5‘ ACACCAGGTAGACGTACTAGGCC 3‘ complementary to nt 1052–1075 of the genomic RNA sequence. The cDNA was amplified by PCR using the above oligonucleotide and oligo 5%-T7 (5%ATCGATAATACGACTCACTATAGGAAATTCCCCAGGATT 3%), which contained the first 17 nt of TBSV-P genomic RNA (bold) fused to a 17 nt bacteriophage T7 RNA polymerase promoter consensus sequence (underline) and five bases contributing to the formation of a ClaI restriction site (italic). The major PCR product of approximately 1100 bp was cloned as described above. The resulting clones TBSV 5% and Gy 20 contained the 5% and 3% part of the viral genome, and were fused using the StuI site at position 1060. A unique SmaI restriction site was placed at the 3% terminus of TBSV-P to permit linearisation of the full-length clone. Biologically active cDNA clones of DI RNAs were prepared by RT-PCR using oligonucleotide 5%GGGCTGCATTGCTGCAA 3%, which is complementary to the last 17 nt of TBSV-P genomic RNA and T7-5% primer and it was cloned as described above. The first nucleotide of the TBSV-P genome sequence (A) was substituted by G to allow efficient transcription by T7 RNA polymerase (Dunn and Studier, 1983). In vitro transcripts of TBSV-P RNA were infectious. All the plants inoculated either with the wild-type viral RNA or in vitro synthesised TBSV-P RNA showed similar symptoms developed with the same intensity and rapidity. Northern blot analysis confirmed that the pattern of viral specific genomic and subgenomic RNA species were equivalent to the wild-type
G. Szittya et al. / Virus Research 69 (2000) 131–136
135
References
Fig. 4. Northern blot analysis of nucleic acids extracted from N. cle6elandii plants inoculated with TBSV-P viral RNA (lanes 1), in vitro transcript of TBSV-P (lane 2) and in vitro transcripts of genomic RNA mixed with in vitro synthesised DI-4 RNAs (lanes 3 and 4) or with in vitro transcripts of DI-5 RNAs (lanes 5 and 6). The samples in 3, 4, 5 and 6 were taken from different plants of the same infection. G, sg1, sg2, DI-4 and DI-5 show the position of genomic, subgenomic and defective interfering RNAs, respectively. Hybridisation was with a random probed cDNA clone representing the 3%-terminal 800 nt of TBSV-P RNA.
viral RNA (Fig. 4). TBSV-P DI RNA caused symptom attenuation on N. cle6elandii plants. To test the biological activity of the cloned TBSV-P DI RNAs, N. cle6elandii plants were inoculated with in vitro synthesised DI RNAs in the presence of helper genome. The DI RNAs replicated well and accumulated at high levels in the inoculated plants (Fig. 4). In addition, there was no difference in symptom attenuation if the wild type or in vitro synthesised DI RNA was present in the inoculated plants, indicating that the cloned DI RNAs were biologically active. In conclusions, biological features as host range and symptoms on test plants, electron microscopy studies, sequence similarities and genome organisation all indicated that TBSV-P is a member of the Tombus6irus genus showing close relationship to the sequenced cherry strain of TBSV. However, the biological properties of TBSV-P make it possible to characterise it and the infectious cDNA clone can be useful for further studies to identify host specificity factors for tombusviruses.
Acknowledgements We thank Da´niel Silhavy (ABC, Go¨do¨llo3 , Hungary) for useful comments on the manuscript.
Burgya´n, J., Grieco, F., Russo, M., 1989. A defective interfering RNA in cymbidium ringspot virus infections. J. Gen. Virol. 70, 235 – 239. Burgya´n, J., Rubino, L., Russo, M., 1991. De novo generation of cymbidium ringspot virus defective interfering RNA. J. Gen. Virol. 72, 505 – 509. ´ ., Russo, M., Dalmay, T., Rubino, L., Burgya´n, J., Kolla´r, A 1993. Functional analysis of cymbidium ringspot virus genome. Virology 194, 697 – 704. Dunn, J.J., Studier, F.W., 1983. Complete nucleotide sequence of bacteriophage T7 DNA and the location of T7 genetics elements. J. Mol. Biol. 166, 477 – 535. Finnen, R.L., Rochon, D.M., 1993. Sequence and structure of defective interfering RNAs associated with cucumber necrosis virus infections. J. Gen. Virol. 74, 1715 – 1720. Gallitelli, D., Hull, R., Koenig, R., 1985. Relationship among viruses in the tombusvirus group: nucleic acid hybridization studies. J. Gen. Virol. 66, 1523 – 1531. Havelda, Z., Dalmay, T., Burgya´n, J., 1997. Secondary structure-dependent evolution of Cymbidium ringspot virus defective interfering RNA. J. Gen. Virol. 78, 1227 – 1234. Hearne, P.Q., Knorr, D.A., Hillman, B.I., Morris, T.J., 1990. The complete genome structure and synthesis of infectious RNA from clones of tomato bushy stunt virus. Virology 177, 141 – 151. Hillman, B.I., Carrington, J.C., Morris, T.J., 1987. A defective interfering RNA that contains a mosaic of plant virus genome. Cell 51, 427 – 433. Kolla´r, A., Burgya´n, J., 1994. Evidence that ORF 1 and 2 are the only virus encoded replicase gene of cymbidium ringspot tombusvirus. Virology 201, 169 – 172. Martelli, G.P., Gallitelli, D., Russo, M., 1988. Tombusviruses. In: Koenig, R. (Ed.), The Plant Viruses, vol. 3. Plenum Publishing, New York, pp. 13 – 72. Oster, S.K., Wu, B., White, A., 1998. Uncoupled expression of p33 and p92 permits amplification of tomato bushy stunt virus RNAs. J. Virol. 72, 5845 – 5851. Rochon, D.M., Johnston, J.C., 1991. Infectious transcripts from cloned cucumber necrosis virus cDNA. Evidence for a bifunctional subgenomic mRNA. Virology 181, 656 – 665. Rubino, L., Burgya´n, J., Russo, M., 1995. Molecular cloning and complete nucleotide sequence of carnation Italian ringspot tombusvirus genomic and defective interfering RNAs. Arch. Virol. 140, 2027 – 2039. Russo, M., Burgya´n, J., Carrington, J.C., Hillman, B.I., Morris, T.J., 1988. Complementary DNA cloning and characterization of cymbidium ringspot virus genome. J. Gen. Virol. 69, 401 – 406. Russo, M., Burgya´n, J., Martelli, P.G., 1994. The molecular biology of Tombusviridae. Adv. Virus Res. 44, 382 – 424. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, second ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Sanger, F., Nicklen, S., Coulson, A.R., 1977. DNA seqencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74, 5463 – 5467.
136
G. Szittya et al. / Virus Research 69 (2000) 131–136
Scholthof, H.B., Morris, T.J., Jackson, A.O., 1993. The capsid protein gene of tomato bushy stunt virus is dispensable for systemic movement and can be replaced for localized expression of foreign genes. Mol. Plant-Microbe Ineract. 6, 309 – 322. Scholthof, K.-B.G., Scholthof, H.B., Jackson, A.O., 1995a. The tomato bushy stunt virus replicase proteins are coordinately expressed and membrane associated. Virology 208, 365 – 369. Scholthof, H.B., Scholthof, K.-B.G., Jackson, A.O., 1995b. Identification of tomato bushy stunt virus host-specific symptom determinants by expression of individual genes from a potato virus X vector. Plant Cell 7, 1157–1172. Scholthof, H.B., Scholthof, K.-B.G., Kikkert, M., Jackson, A.O., 1995c. Tomato bushy stunt virus spread is regu-
.
lated by two nested genes that function in cell-to-cell movement and host-dependent systemic invasion. Virology 213, 425 – 438. Voinnet, O., Pinto, Y.M., Baulcobe, D.C., 1999. Suppression of gene silencing: a general strategy used by diverse DNA and RNA viruses of plants. Proc. Natl. Acad. Sci. USA 96, 14147 – 14152. White, K.A., 1997. Formation and evolution of Tombusvirus defective interfering RNAs. Semin. Virol. 7, 409 – 416. Zimmern, D., Kaesberg, P., 1978. 3’-Terminal nucleotide sequence of encephalomyocarditis virus RNA determined by reverse transcription and chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 75, 4257 – 4261.