- Email: [email protected]
The cytoplasmic tail of the neuraminidase protein of influenza A virus does not play an important role in the packaging of this protein into viral envelopes
ELSEVIER
Virus Research 37 (1995) 37-47
Virus Research
The cytoplasmic tail of the neuraminidase protein of influenza A virus does not play an important role in the packaging of this protein into viral envelopes A d o l f o G a r c i a - S a s t r e *'1, P e t e r P a l e s e Department of Microbiology, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York, N Y 10029, USA Received 21 December 1994; revised and accepted 30 January 1995
Abstract
We have rescued a transfectant influenza virus, NA/TAIL(-), whose neuraminidase (NA) protein lacks the predicted cytoplasmic tail. The virus was attenuated (one log10 reduction) both in tissue culture and in mouse lungs. Attenuation correlated with a 50% reduction of the level of NA in infected cells and levels of incorporation of the tail-less NA protein into viral particles paralleled that in infected cells. This result indicates that the signal for packaging of the NA protein into the viral envelope is not located in its cytoplasmic domain.
Keywords: Influenza virus; Virus packaging; Virus budding; Reverse genetics
Many animal viruses derive an envelope from m e m b r a n e s of infected ceils during the budding process. Specific viral proteins (spike proteins) are anchored in the viral envelope by their t r a n s m e m b r a n e domains. For most of the enveloped viruses, a mechanism for excluding the cellular m e m b r a n e proteins and specifically incorporating only the viral proteins into the envelope has been suggested. This mechanism may involve p r o t e i n - p r o t e i n interactions between the spike proteins and an internal component of the virus, such as the nucleoproteins or the matrix proteins. These interactions may also be responsible for triggering the budding
* Corresponding author. 1 On leave of absence from the Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Salamanca, Salamanca, Spain. 0168-1702/95/$09.50 © 1995 Elsevier Science B.V. All rights reserved SSDI 0 1 6 8 - 1 7 0 2 ( 9 5 ) 0 0 0 1 7 - 8
38
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
process. The transmembrane and cytoplasmic domains of the spike proteins are obvious candidates for such interactions, since they have the potential to interact with other membrane or cytoplasmic components. For example, in the case of alphaviruses, the cytoplasmic tail of the E2 glycoprotein is able to bind to the nucleocapsid in vitro (Metsikko and Garoff, 1990), and it appears to be essential for the budding process (Gaedigk-Nitschko and Schlesinger, 1991; Ivanova and Schlesinger, 1993; Zhao et al., 1994). However, in the case of retroviruses, viral glycoproteins are not essential for budding and it is not clear that the cytoplasmic and transmembrane domains of the spike proteins contain the signals for specific incorporation into virions (for a recent review, see Hunter, 1994). Thus, it appears that different enveloped viruses may have a variety of mechanisms for budding and viral envelope assembly. The influenza A viruses are enveloped and contain 3 different transmembrane proteins in their viral envelopes, the hemagglutinin (HA), the neuraminidase (NA) and the M2 proteins. The mechanism for incorporation of these viral proteins into the envelope is not clearly understood. In this paper we provide evidence that the cytoplasmic tail of the NA is not necessary for the incorporation of the NA into the viral envelope. The NA protein of influenza A viruses is a type II membrane glycoprotein that is anchored in the membrane by its amino-terminal domain (for a review, see Colman, 1989). Type II glycoproteins are characterized by an aminoterminal signal peptide that, after directing translocation of the protein into the endoplasmic reticulum, is not cleaved and mediates the anchoring of the protein into the membrane. The function of the NA in the virus cycle is to facilitate the release and spreading of the virus by removing sialic acids from both the viral and cellular surfaces (Palese et al., 1974). The NA protein is found as a homotetramer both in the virus and in infected cells. Each monomer has a mushroom-like shape and contains - from its amino-terminus to its carboxy-terminus - a short cytoplasmic tail, a transmembrane domain, a stalk region, and a globular head. The 3-dimensional structure of the head of the NA has been determined (Varghese et al., 1983; Baker et al., 1987), and it is known that the active site as well as the important antigenic sites of the protein are located in the head. The stalk region of the NA separates the head from the viral envelope, and it is poorly conserved among different strains of influenza viruses. In addition, reverse genetics experiments have shown that this region can accommodate insertions and deletions (Castrucci and Kawaoka, 1993; Luo et al., 1993; Castrucci et al., 1994). In contrast, the cytoplasmic tail of the NA is highly conserved among strains. The sequence of the cytoplasmic tail of NAs belonging to 9 different subtypes is MNPNQK. The only known exceptions are the NAs of influenza A / s w i n e / W i s c o n s i n / 1 5 / 3 0 and influenza A / N e w J e r s e y / 7 6 viruses, whose cytoplasmic tails have the amino acid sequence M N T N Q K and M N T N Q R , respectively (Blok and Air, 1982; Miki et al., 1983). The extraordinary conservation of the amino-terminus of the protein suggests that the NA tail is involved in an important viral function. However, this domain does not appear to play a role in the translocation of the NA across the endoplasmic reticulum membrane, nor in the polarized transport of the NA to the
39
A. Garcfa-Sastre, P. Palese / Virus Research 37 (1995) 37-47
apical p l a s m a m e m b r a n e (Nayak a n d J a b b a r , 1989; H o g u e a n d Nayak, 1994). It is t h e n attractive to speculate that the cytoplasmic tail of the N A interacts with i n t e r n a l c o m p o n e n t s of the virus d u r i n g the b u d d i n g process. T h e s e i n t e r a c t i o n s could be r e s p o n s i b l e for the specific i n c o r p o r a t i o n of the N A p r o t e i n into viral envelopes. T h e d e v e l o p m e n t of a reverse genetics m e t h o d o l o g y to genetically m a n i p u l a t e i n f l u e n z a viruses (Luytjes et al., 1989; E n a m i et al., 1990; Garcfa-Sastre a n d Palese, 1993) has allowed the g e n e r a t i o n of t r a n s f e c t a n t viruses c o n t a i n i n g m u t a t i o n s in the cytoplasmic tail of the N A p r o t e i n (Bilsel et al., 1993). T h e i n s e r t i o n of a g l u t a m i n e r e s i d u e b e t w e e n the cytoplasmic tail a n d the t r a n s m e m b r a n e d o m a i n of the N A d e c r e a s e d the i n c o r p o r a t i o n into virus particles. I n addition, d e l e t i o n of the cytoplasmic tail or s u b s t i t u t i o n of the p r o l i n e at position 3 by an a l a n i n e i m p a i r e d the rescue of viable viruses, a l t h o u g h these m u t a t i o n s did not affect the t r a n s p o r t of the N A or its enzymatic activity. T h e s e results suggest that the cytoplasmic tail of the N A is r e q u i r e d for the p a c k a g i n g of the N A p r o t e i n into virus particles (Bilsel et al., 1993). EBb
NA/TAI
Bc
pT3NA/TAIL(-)
H
UCGUUUUCGUCCUCAAAUU CGAUCGACCUUC UACUAG_UA~ ,3 Met lie lie
WSN
UCGUUUUCGUCCUCAAAUU UACUUAGGUUUGGUCUUUUAUUAU Met Ash Pro Asn Gin Lys lie lie
CT
TM
Fig. 1. Schematic representation of plasmid pT3NA/TAIL( - ). pT3NA/TAIL( - ) contains the cDNA of the NA gene of influenza A/WSN/33 (WSN) virus. Nucleotides encoding amino acid residues 2-6 of the cytoplasmic tail of the NA have been deleted, pT3NA/TAIL(-) was constructed as follows. First, a PCR product was obtained using universal primer (USB) and 5'-AGATCGATCCAATGGTTATGATCATCTTCC-3' primer and pT3GP2/BIP-NA as template. The obtained PCR product was digested with EcoRI and ClaI restriction enzymes and it was cloned into E c o R I / C l a I digested pT3GP2/BIP-NA (Garcia-Sastre et al., 1994). Then, the undesired sequences between the Nhel and BstXI sites were deleted. As a result, a linker sequence of 12 nt was inserted before the ATG of the NA/TAIL(-) open reading frame. The nucleotide sequence of the 3'-end of the NA RNA of NA/TAIL(-) and of WSN wild-type viruses is represented in the figure. Italic letters represent the 12-nt linker. A silent change that creates a new BclI restriction site is underlined. The beginning of the coding sequences is indicated by an asterisk. Coding assignments are indicated underneath the sequences. Amino acid residues located in the cytoplasmic tail (CT) and in the beginning of the transmembrane domain (TM) of the WSN NA are also indicated. Domains in the plasmid pT3NA/ TAIL(-) are represented as follows: 3'NC and 5'NC, 3'- and Y-non-coding sequences of the NA gene; NA ORF, NA open reading frame; T3, truncated T3 RNA polymerase promoter. Selected restriction sites are also indicated: Bb, BbsI; Bc, BclI; E, EcoRI; H, HindIII. WSN NA sequences are according to Hiti and Nayak (1982).
40
A. Garcia-Sastre, P. Palese / Virus Research 37 (1995) 37-47
For the present study, we generated a transfectant influenza virus whose N A protein lacks the entire conserved cytoplasmic tail. This virus was able to package the mutated N A into virus particles at levels which were similar to those found for wild-type viruses. These results demonstrate that the cytoplasmic tail of the N A is not required for N A incorporation into virus particles. We first constructed plasmid p T 3 N A / T A I L ( - ) (Fig. 1). This plasmid contains the N A c D N A of influenza A / W S N / 3 3 virus (WSN), in which the coding sequences for amino acid residues 2 - 6 were deleted at the same time that a new restriction site, BclI, was created. In addition, a non-coding linker of 12 nucleotides was inserted between the non-coding region of the gene and the A T G codon due to the cloning strategy. After linearization of p T 3 N A / T A I L ( - ) with BbsI restriction enzyme and in vitro T3 R N A polymerase transcription, an R N A molecule of negative polarity was generated containing the same 3'- and 5'-ends of the N A R N A of WSN virus. The synthetic N A / T A I L ( - ) R N A was incubated with purified influenza virus polymerase in order to reconstitute biologically active ribonucleoprotein (RNP) complexes, and transfected into M D B K cells infected with W S N - H K virus, as previously described (Enami and Palese, 1991). In this way, transfectant viruses were rescued, suggesting that the deletion of the NA cytoplasmic tail did not impair the viability of the virus. In order to confirm the identity of the rescued N A / T A I L ( - ) virus, the transfectant virus was plaque-purified 3 times on M D B K cells and one plaque was amplified for a seed virus preparation. The seed virus was further amplified through infection at low multiplicity of three 175-cm 2 flasks containing confluent monolayers of M D B K cells. Medium from infected cells was harvested 2 days after infection and virus was purified by differential ultracentrifugation (Garcia-Sastre et al., 1994). R N A was then extracted from purified virus as previously described (Luo et al., 1992). The 3'-end of the N A R N A segment of the transfectant virus was amplified as follows. First, 100 ng of virion R N A s was used for a reverse t r a n s c r i p t i o n r e a c t i o n using the p r i m e r 5 ' - G C G C G A A T T C T C T T T C G A G C A A A A G C A G G - 3 ' (EKFLU, annealing to the last 12 nt at the 3'-end of the
Bcl I
~ i~ ~!~i~
~
' i'~ill
~iiiii!ii! '==
134
= "
75
Fig. 2. Restriction analysis of the NA cDNA from N A / T A I L ( - ) transfectant. The first 112 nt at the 3'-end of the NA viral RNA from purified N A / T A I L ( - ) viruses were amplified by coupled reverse transcription-PCR, as described in the text. The PCR product (139 nt in length) was incubated at 37°C for 2 h in the presence or absence of 10 units of Bcll restriction enzyme. Samples were then run on a 2% agarose gel and stained with ethidium bromide. Faster migrating bands at the bottom of the gel probably correspond to unextended primers. Size markers in nt are indicated on the right.
A. Garc{a-Sastre, P. Palese/ VirusResearch 37 (1995) 37-47
41
influenza A virus RNAs) and SuperScript reverse transcriptase (Gibco-BRL). The c D N A was PCR-amplified by using the primers E K F L U and 5 ' - G C G C A A G C T T T A T T G A G A T T A T A T T T C C - 3 ' (containing nt 115-98 of the N A gene of WSN). A P C R product of 139 nt was amplified, corresponding to the 3'-end of the N A viral R N A . Since the transfected N A clone contains a specific BclI site at nt position 33 which is not found in wild type WSN N A cDNA, the resulting PCR product was tested for its ability to be digested by BclI. As shown in Fig. 2, the length of the P C R product was decreased after BclI digestion, indicating that the rescued virus contained the transfected N A gene. Further confirmation was obtained by cloning the P C R product between E c o R I and HindlII restriction sites (located at the ends of the primers) into pUC19. The resultant plasmid was sequenced with a D N A sequencing kit and universal and reverse primers (United States Biochemical). The sequence was identical to that of the transfected N A / T A I L ( - ) RNA. However, we cannot rule out possible compensatory mutations in the genome of the rescued virus which lie outside the sequenced region of the N A gene. We compared the amount of N A protein expressed in cells infected with NA/TAIL(-) and with wild-type WSN viruses. The viral NP protein was used as an internal control. We infected M D B K cells in 35-mm-diameter dishes at an m.o.i, of 2 with N A / T A I L ( - ) or WSN viruses. Cells 4 h postinfection were labeled with L-[35S]cysteine for 4 h, and lysed in 100 /1,1 of 0.15 M NaCI, 20 mM Tris-HC1 (pH 7.4) containing 1.5% n-octylglucoside and 1 mM CaCI 2 (lysis buffer). Then, 5 or 10/zl of cell extracts were used for immunoprecipitation with a mixture Cell e x t r a c t s Virus Ab
5 ~t I
lO ~ I
NA/TAIL(-)
WSN
NAJ-FAIL(-)
WSN
(~NP (~NA (;~NP (;~NA (~NP (~NA (~NP (~NA
iii!i~iii!i!!i
i iiii!!!'~!.
~
.
.
~v
. ----'69 46
~30 Fig. 3. Quantification of the levels of NA expression in NA/TAIL(-) transfectant-infected cells. Labeled cell extracts from infected MDBK cells were obtained as described in the text. Different amounts (5 or 10 /zl) of MDBK cell extracts were used for immunoprecipitation with monoclonal antibodies against the NP or the NA protein. Immunoprecipitated samples were run on a 10% SDS-polyacrylamide gel. After electrophoresis, the gel was fixed, dried, and autoradiographed. Molecular size markers in thousands are indicated on the right.
42
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
1
2
3
4 97
HA0
-'~
"-N P -%,. NA ~
46
HA1 M1 -%.
69
~30
HA2 - / " Fig. 4. Quantification of the amount of NA protein incorporated into N A / T A I L ( - ) virions. Labeled viruses were purified as described in the text. Similar amounts of purified N A / T A I L ( - ) and WSN viruses were used for immunoprecipitation with monoclonal antibodies against the NA protein. Samples before and after immunoprecipitation were analyzed by 10% S D S - P A G E . After electrophoresis, the gel was fixed, dried, and autoradiographed. Lanes 1 and 2, purified WSN and N A / T A I L ( - ) viruses, respectively. Lanes 3 and 4, immunoprecipitated samples from purified WSN and N A / T A I L ( - ) viruses, respectively. Note that the NA protein of N A / T A I L ( - ) virus, which is 5 amino acids shorter, migrates slightly faster than that of WSN virus. Viral proteins are indicated on the left. Numbers on the right are molecular weights in thousands.
of monoclonal antibodies 10C9 and 3C8 (specific for WSN NA), or with monoclonal antibody HT-103 (specific for the NP protein of influenza virus), as described (Percy et al., 1994). Immunoprecipitated proteins were analyzed by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis ( S D S - P A G E ) . The results are shown in Fig. 3. Immunoprecipitated bands were quantitated by a Phosphorimaging System (Molecular Dynamics, CA). Under these conditions there was a linear increase of the immunoprecipitated signal with the amount of cell extracts used. The ratio of N A / N P found in WSN-infected cells was 0.275 _+ 0.035 (average of two experiments), and in N A / T A I L ( - ) virus-infected cells it was 0.13 +_ 0.02 (average of two experiments). Thus, the amount of NA protein in N A / T A I L ( - ) virus-infected cells was approximately 50% of that in WSN virus-infected cells. Similar values were found when the amount of NA protein incorporated into virions was analyzed (Fig. 4). MDBK cells in 35-mm-diameter dishes were infected and labeled as in the previous experiment, except that 8 h postinfection, cold medium was added and cells were incubated 10 h more. Supernatants at 18 h postinfection were harvested, mixed with cold virus, and purified by differential ultracentrifugation (Garcla-Sastre et al., 1994). Purified viruses were disrupted in lysis buffer, and the NA protein in these samples was quantitated by immunoprecipitation and S D S - P A G E . The specific NA signals were standardized against total labeled viral proteins which were run at the same time in the polyacrylamide gel. The amount of NA protein incorporated into N A / T A I L ( - ) viruses was 65% of that found in WSN viruses (Fig. 4), which parallels the reduced level of the
A. Garcfa-Sastre, P. Palese / Virus Research 37 (1995) 3 7 - 4 7
8
43
S
6
id. 13_ ~4 0
i___u-WS N ) I~,]i NA/TAIL( 0 -- --
20
40
60
80
Hours after infection Fig. 5. Growth curve of N A / T A I L ( - ) transfectant. Confluent M D B K monolayers in 35-mm-diameter dishes were infected with N A / T A I L ( - ) or WSN viruses (m.o.i. = 0.001) and, at 12 h intervals, numbers of infectious particles present in the media were titrated by plaque assay in MDBK cells.
tail-less NA in infected cells. Total amount of viral proteins in purified N A / T A I L ( - ) viruses was approximately 10 times less than in wild-type viruses, suggesting that the absolute number of viruses produced in N A / T . A I L ( - ) infected cells was reduced (see below). We have also characterized the growth properties of N . A / T A I L ( - ) virus in tissue culture and in mice. The growth kinetics of the transfectant N_A/TAIL(-) virus in MDBK cells is compared with that of WSN virus in Fig. 5. Cells were infected at an m.o.i, of 0.001 and supernatants were harvested at different times postinfection, and titrated by plaque assay on MDBK cells. The peak titer of N_A/TAIL(-) transfectant virus was approximately 1 log~0 lower than that of wild-type WSN virus. -Accordingly, peak titers of hemagglutinin activity were also approximately 10-fold lower in supernatants from N A / T . A I L ( - ) infected cells (data not shown). Table 1 shows virus titers achieved in lungs of mice infected with N-A/T.AIL(-) virus or with WSN virus. Six-week-old female BALB/c mice were infected intranasally with 1000 plaque-forming-units (PFU) of virus. Three days
Table 1 Attenuation of the influenza N A / T A I L ( - )
transfectant in mice
Virus administered a
No. of mice
Virus in lungs (PFU) b
NA/TA1L( - ) WSN
4 3
5.44 _+0.08 6.13 _+0.67
Each mouse received 103 PFU intranasally in a 0.05-ml inoculum. b Lungs were homogenized 3 days after virus administration and titers (mean logl0 PFU + S.E.) were determined by plaque assay on MDBK cells. a
44
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995)37-47
later, mouse lungs were homogenized in cold PBS, and the samples were titrated by plaque assay on M D B K cells. In mouse lungs N A / T A I L ( - ) virus grew on average to approximately 1 log~0 lower titers than wild-type virus. In addition, the maximum PFU titer achieved on M D C K cells was 0.5 log10 lower than wild-type (data not shown). In this report, we found that the levels of the mutant NA packaged into virions correlated with the amount in infected cells. This result indicates that the deletion of the cytoplasmic tail of the NA does not impair the packaging of the NA into viral envelopes. Similarly, the expression of H A proteins lacking a cytoplasmic tail did not affect the incorporation of the H A protein into pseudotype virions (Simpson and Lamb, 1992; Naim and Roth, 1993). Furthermore, reverse genetics experiments have allowed the rescue of a transfectant influenza virus with a deletion in the cytoplasmic tail of the H A (Jin et al., 1994). These findings and our results suggest that the signal for incorporation of the NA and H A proteins into virus particles is not contained within their cytoplasmic tails. Bilsel et al. (1993) did not succeed in the generation of an influenza virus whose NA protein lacks the cytoplasmic tail, and the reason for this remains unclear. However, they rescued transfectant influenza viruses which contained single amino acid mutations in the cytoplasmic tail of the NA. In this case, packaging of the NA protein was affected only when an additional amino acid was inserted between the cytoplasmic tail and the transmembrane domain. This would suggest that the transmembrane domain close to the cytoplasm is involved in the packaging of the NA. In the case of the HA, it has been suggested that the signal for specific incorporation into virus particles is contained in the transmembrane domain of the protein (Naim and Roth, 1993). Support for this hypothesis also comes from the fact that a foreign protein containing the transmembrane and cytoplasmic domains of the H A is packaged into virions (Garcia-Sastre et al., 1994). However, further investigation is needed in order to understand the precise role of the transmembrahe domains of the H A and NA proteins in the incorporation of these proteins into budding viruses. Why is the sequence of the cytoplasmic tail of the NA so highly conserved if it is not required for the incorporation of the NA into virus particles? Although we have not determined the rate of transport to the membrane of the NA in N A / T A I L ( - ) virus-infected cells, the deletion of the cytoplasmic tail of the NA appears not to affect this process (Davis et al., 1983; Jones et al., 1985). The specific neuraminidase activity from purified viruses was also not altered by the deletion of the cytoplasmic tail, as measured with the synthetic substrate 4-methylumbelliferyl-~-D-N-acetylneuraminic acid (data not shown). This suggests that tetramerization of the NA was not affected, since it is thought that only NA tetramers are enzymatically active (Paterson and Lamb, 1990). In contrast, we were able to show that the amount of NA protein in infected cells was reduced to 50% when the cytoplasmic tail was deleted. This finding might reflect the fact that the cytoplasmic tail of the NA contributes to the stability of the protein, and that its deletion results in an increase of incorrectly folded proteins that are quickly degraded. Another explanation for the reduced levels of NA is that the efficiency
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
45
of translation of the protein might have been affected in the new construct. The nucleotide sequence close to the A T G of the m R N A differs from that of wild type gene which might influence the translation efficiency (Kozak, 1986). Regardless of the mechanism, the reduction in N A expression may be responsible for the attenuation of the N A / T A I L ( - ) virus in tissue culture and in mice. Similarly, Castrucci et al. (1992) reported that the insertion of a foreign sequence in the stalk of the N A of a transfectant virus led to a two-fold decrease in N A activity and to attenuation of the virus. The decrease in virus titers that is observed when the cytoplasmic tail of the N A is deleted could provide a selective pressure sufficient to maintain an optimal configuration of this domain. Wild-type levels of N A activity may be required in order to efficiently remove sialic acids from the surface of viruses and cell membranes. In the absence of the N A , viruses aggregate and remain attached to the cell membrane because the H A cannot separate from the cell's sialic acid-containing receptors (Palese et al., 1974). In addition, the level of the N A activity may affect the efficiency of cleavage of HA0 into HA1 and HA2 in infected cells (Schulman and Palese, 1977; Li et al., 1993). This cleavage is needed for the fusion activity of the HA. The reduced levels of N A in N A / T A L L ( - ) infected cells could be the reason for the increase of uncleaved HA0 which is found in purified N A / T A I L ( - ) virus (Fig. 4, lane 2). Thus, the possible decrease in efficiency of virus release a n d / o r the altered H A cleavage due to reduced N A expression could account for the observed attenuation of the N A / T A I L ( - ) transfectant virus. In summary, although the cytoplasmic tail of the N A may provide a growth advantage to the virus, this domain is not required for the incorporation of the N A into virus envelopes.
Acknowledgements We thank Michael Bergmann for his help in cloning p T 3 N A / T A I L ( - ) , and Scott Kerns and Ricardo Renvill for excellent technical assistance. This work was supported by an M E C / F u l b r i g h t scholarship (A.G.-S.) and by the N I H (P.P,).
References Baker, A.T., Varghese, J.N., Laver, W.G., Air, G.M. and Colman, P.M. (1987) Three-dimensional structure of neuraminidase of subtype N9 from an avian influenza virus. Protein Struct. Funct. Genet. 2, 111-117. Bilsel, P., Castrucci, M.R. and Kawaoka, Y. (1993) Mutations in the cytoplasmic tail of influenza A virus neuraminidase affect incorporation into virions. J. Virol. 67, 6762-6767. Blok, J. and Air, G.M. (1982) Sequence variation at the 3' end of the neuraminidase gene from 39 influenza type A viruses. Virology 121,211-229. Castrucci, M.R. and Kawaoka, Y. (1993) Biological importance of neuraminidase stalk length in influenza A virus. J. Virol. 67, 759-764. Castrucci, M.R., Bilsel, P. and Kawaoka, Y. (1992) Attenuation of influenza A virus by insertion of a foreign epitope into the neuraminidase. J. Virol. 66, 4647-4653.
46
A. Garcla-Sastre, P. Palese / Virus Research 37 (1995) 37-47
Castrucci, M.R., Hou, S., Doherty, P.C. and Kawaoka, Y. (1994) Protection against lethal lymphocytic choriomeningitis virus (LCMV) infection by immunization of mice with an influenza virus containing an LCMV epitope recognized by cytotoxic T lymphocytes. J. Virol. 68, 3486-3490. Colman, P.M. (1989) Neuraminidase: enzyme and antigen. In: R.M. Krug (Ed.), The Influenza Viruses. Plenum Press, New York, pp. 175-218. Davis, A.R., Bos, T.J. and Nayak, D.P. (1983) Active influenza virus neuraminidase is expressed in monkey cells from cDNA cloned in simian virus 40 vectors. Proc. Natl. Acad. Sci. U.S.A. 80, 3976-3980. Enami, M. and Palese, P. (1991) High-efficiency formation of influenza virus transfectants. J. Virol. 65, 2711-2713. Enami, M., Luytjes, W., Krystal, M. and Palese, P. (1990) Introduction of site-specific mutations into the genome of influenza virus. Proc. Natl. Acad. Sci. U.S.A. 87, 3802-3805. Gaedigk-Nitschko, K. and Schlesinger, M.J. (1991) Site-directed mutations in Sindbis virus E2 glycoprotein's cytoplasmic domain and the 6K protein lead to similar defects in virus assembly and budding. Virology 183, 206-214. Garc~a-Sastre, A. and Palese, P. (1993) Genetic manipulation of negative-strand RNA virus genomes. Annu. Rev. Microbiol. 47, 765-790. Garcla-Sastre, A., Muster, T., Barclay, W.S., Percy, N. and Palese, P. (1994) Use of a mammalian internal ribosomal entry site element for expression of a foreign protein by a transfectant influenza virus. J. Virol. 68, 6254-6261. Hiti, A.L. and Nayak, D.P. (1982) Complete nucleotide sequence of the neuraminidase gene of human influenza virus A/WSN/33. J. Virol. 41, 730-734. Hogue, B.G. and Nayak, D.P. (1994) Deletion mutation in the signal anchor domain activates cleavage of the influenza virus neuraminidase, a type II transmembrane protein. J. Gen. Virol. 75, 1015-1022. Hunter, E. (1994) Macromolecular interactions in the assembly of HIV and other retroviruses. Semin. Virol. 5, 71-83. Ivanova, L. and Schlesinger, M.J. (1993) Site-directed mutations in the Sindbis virus E2 glycoprotein identify palmitoylation sites and affect virus budding. J. Virol. 67, 2546-2551. Jin, H., Leser, G.P. and Lamb, R.A. (1994) The influenza virus hemagglutinin cytoplasmic tail is not essential for virus assembly or infectivity. EMBO J. 13, 5504-5515. Jones, L.V., Compans, R.W., Davis, A.R., Bos, T.J. and Nayak, D.P. (1985) Surface expression of influenza virus neuraminidase, an amino-terminally anchored viral membrane glycoprotein, in polarized epithelial cells. Mol. Cell. Biol. 5, 2181-2189. Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292. Li, S., Schulman, J., ltamura, S. and Palese, P. (1993) Glycosylation of neuraminidase determines the neurovirulence of influenza A / W S N / 3 3 virus. J. Virol. 67, 6667-6673. Luo, G., Bergmann, M., Garcia-Sastre, A. and Palese, P. (1992) Mechanism of attenuation of a chimeric influenza A / B transfectant virus. J. Virol. 66, 4679-4685. Luo, G., Chang, J. and Palese, P. (1993) Alterations of the stalk of the influenza virus neuraminidase: deletions and insertions. Virus Res. 29, 141-153. Luytjes, W., Krystal, M., Enami, M., Parvin, J.D. and Palese, P. (1989) Amplification, expression, and packaging of a foreign gene by influenza virus. Cell 59, 1107-1113. Metsikko, K. and Garoff, H. (1990) Oligomers of the cytoplasmic domain of the p62/E2 membrane protein of Semliki Forest virus bind to nucleocapsid in vitro. J. Virol. 64, 4678-4683. Miki, T., Nishida, Y., Hisajima, H., Miyata, T., Kumahara, Y., Nerome, K., Oya, A., Fukui, T., Ohtsuka, E., Ikehara, M. and Honjo, T. (1983) The complete nucleotide sequence of the influenza virus neuraminidase gene of A / N J / 8 / 7 6 strain and its evolution by segmental duplication and deletion. Mol. Biol. Med. 1,401-413. Naim, H.Y. and Roth, M.G. (1993) Basis for selective incorporation of glycoproteins into the influenza virus envelope. J. Virol. 4831-4841. Nayak, D.P. and Jabbar, M.A. (1989) Structural domains and organizational conformation involved in the sorting and transport of influenza virus transmembrane proteins. Annu. Rev. Microbiol. 43, 465-501.
A. Garc{a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
47
Palese, P, Tobita, K., Ueda, M. and Compans, R.W. (1974) Characterization of temperature-sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397-410. Paterson, R.G. and Lamb, R.A. (1990) Conversion of a class II integral membrane protein into a soluble and efficiently secreted protein: multiple intracellular and extracellular oligomeric and conformational forms. J. Cell. Biol. 110, 999-1011. Percy, N., Barclay, W.S., Garcfa-Sastre, A. and Palese, P. (1994) Expression of a foreign protein by influenza A virus. J. Virol. 68, 4486-4492. Schulman, J.L. and Palese, P. (1977) Virulence factors of influenza A viruses: WSN virus neuraminidase required for plaque production in MDBK cells. J. Virol. 24, 170-176. Simpson, D.A. and Lamb, R.A. (1992) Alterations to influenza virus hemagglutinin cytoplasmic tail modulate virus infectivity. J. Virol. 66, 790-803. Varghese, J.N., Laver, W.G. and° Colman, P.M. (1983) Structure of the influenza virus glycoprotein antigen neuraminidase at 2.9 A resolution. Nature 305, 35-40. Zhao, H., Lindqvist, B., Garoff, H, Von Bonsdorff, C.-H. and Liljestr6m, P. (1994) A tyrosinc-based motif in the cytoplasmic domain of the alphavirus envelope protein is essential for budding. EMBO J. 13, 4204-4211.
Virus Research 37 (1995) 37-47
Virus Research
The cytoplasmic tail of the neuraminidase protein of influenza A virus does not play an important role in the packaging of this protein into viral envelopes A d o l f o G a r c i a - S a s t r e *'1, P e t e r P a l e s e Department of Microbiology, Mount Sinai School of Medicine, 1 Gustave L. Levy Place, New York, N Y 10029, USA Received 21 December 1994; revised and accepted 30 January 1995
Abstract
We have rescued a transfectant influenza virus, NA/TAIL(-), whose neuraminidase (NA) protein lacks the predicted cytoplasmic tail. The virus was attenuated (one log10 reduction) both in tissue culture and in mouse lungs. Attenuation correlated with a 50% reduction of the level of NA in infected cells and levels of incorporation of the tail-less NA protein into viral particles paralleled that in infected cells. This result indicates that the signal for packaging of the NA protein into the viral envelope is not located in its cytoplasmic domain.
Keywords: Influenza virus; Virus packaging; Virus budding; Reverse genetics
Many animal viruses derive an envelope from m e m b r a n e s of infected ceils during the budding process. Specific viral proteins (spike proteins) are anchored in the viral envelope by their t r a n s m e m b r a n e domains. For most of the enveloped viruses, a mechanism for excluding the cellular m e m b r a n e proteins and specifically incorporating only the viral proteins into the envelope has been suggested. This mechanism may involve p r o t e i n - p r o t e i n interactions between the spike proteins and an internal component of the virus, such as the nucleoproteins or the matrix proteins. These interactions may also be responsible for triggering the budding
* Corresponding author. 1 On leave of absence from the Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Salamanca, Salamanca, Spain. 0168-1702/95/$09.50 © 1995 Elsevier Science B.V. All rights reserved SSDI 0 1 6 8 - 1 7 0 2 ( 9 5 ) 0 0 0 1 7 - 8
38
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
process. The transmembrane and cytoplasmic domains of the spike proteins are obvious candidates for such interactions, since they have the potential to interact with other membrane or cytoplasmic components. For example, in the case of alphaviruses, the cytoplasmic tail of the E2 glycoprotein is able to bind to the nucleocapsid in vitro (Metsikko and Garoff, 1990), and it appears to be essential for the budding process (Gaedigk-Nitschko and Schlesinger, 1991; Ivanova and Schlesinger, 1993; Zhao et al., 1994). However, in the case of retroviruses, viral glycoproteins are not essential for budding and it is not clear that the cytoplasmic and transmembrane domains of the spike proteins contain the signals for specific incorporation into virions (for a recent review, see Hunter, 1994). Thus, it appears that different enveloped viruses may have a variety of mechanisms for budding and viral envelope assembly. The influenza A viruses are enveloped and contain 3 different transmembrane proteins in their viral envelopes, the hemagglutinin (HA), the neuraminidase (NA) and the M2 proteins. The mechanism for incorporation of these viral proteins into the envelope is not clearly understood. In this paper we provide evidence that the cytoplasmic tail of the NA is not necessary for the incorporation of the NA into the viral envelope. The NA protein of influenza A viruses is a type II membrane glycoprotein that is anchored in the membrane by its amino-terminal domain (for a review, see Colman, 1989). Type II glycoproteins are characterized by an aminoterminal signal peptide that, after directing translocation of the protein into the endoplasmic reticulum, is not cleaved and mediates the anchoring of the protein into the membrane. The function of the NA in the virus cycle is to facilitate the release and spreading of the virus by removing sialic acids from both the viral and cellular surfaces (Palese et al., 1974). The NA protein is found as a homotetramer both in the virus and in infected cells. Each monomer has a mushroom-like shape and contains - from its amino-terminus to its carboxy-terminus - a short cytoplasmic tail, a transmembrane domain, a stalk region, and a globular head. The 3-dimensional structure of the head of the NA has been determined (Varghese et al., 1983; Baker et al., 1987), and it is known that the active site as well as the important antigenic sites of the protein are located in the head. The stalk region of the NA separates the head from the viral envelope, and it is poorly conserved among different strains of influenza viruses. In addition, reverse genetics experiments have shown that this region can accommodate insertions and deletions (Castrucci and Kawaoka, 1993; Luo et al., 1993; Castrucci et al., 1994). In contrast, the cytoplasmic tail of the NA is highly conserved among strains. The sequence of the cytoplasmic tail of NAs belonging to 9 different subtypes is MNPNQK. The only known exceptions are the NAs of influenza A / s w i n e / W i s c o n s i n / 1 5 / 3 0 and influenza A / N e w J e r s e y / 7 6 viruses, whose cytoplasmic tails have the amino acid sequence M N T N Q K and M N T N Q R , respectively (Blok and Air, 1982; Miki et al., 1983). The extraordinary conservation of the amino-terminus of the protein suggests that the NA tail is involved in an important viral function. However, this domain does not appear to play a role in the translocation of the NA across the endoplasmic reticulum membrane, nor in the polarized transport of the NA to the
39
A. Garcfa-Sastre, P. Palese / Virus Research 37 (1995) 37-47
apical p l a s m a m e m b r a n e (Nayak a n d J a b b a r , 1989; H o g u e a n d Nayak, 1994). It is t h e n attractive to speculate that the cytoplasmic tail of the N A interacts with i n t e r n a l c o m p o n e n t s of the virus d u r i n g the b u d d i n g process. T h e s e i n t e r a c t i o n s could be r e s p o n s i b l e for the specific i n c o r p o r a t i o n of the N A p r o t e i n into viral envelopes. T h e d e v e l o p m e n t of a reverse genetics m e t h o d o l o g y to genetically m a n i p u l a t e i n f l u e n z a viruses (Luytjes et al., 1989; E n a m i et al., 1990; Garcfa-Sastre a n d Palese, 1993) has allowed the g e n e r a t i o n of t r a n s f e c t a n t viruses c o n t a i n i n g m u t a t i o n s in the cytoplasmic tail of the N A p r o t e i n (Bilsel et al., 1993). T h e i n s e r t i o n of a g l u t a m i n e r e s i d u e b e t w e e n the cytoplasmic tail a n d the t r a n s m e m b r a n e d o m a i n of the N A d e c r e a s e d the i n c o r p o r a t i o n into virus particles. I n addition, d e l e t i o n of the cytoplasmic tail or s u b s t i t u t i o n of the p r o l i n e at position 3 by an a l a n i n e i m p a i r e d the rescue of viable viruses, a l t h o u g h these m u t a t i o n s did not affect the t r a n s p o r t of the N A or its enzymatic activity. T h e s e results suggest that the cytoplasmic tail of the N A is r e q u i r e d for the p a c k a g i n g of the N A p r o t e i n into virus particles (Bilsel et al., 1993). EBb
NA/TAI
Bc
pT3NA/TAIL(-)
H
UCGUUUUCGUCCUCAAAUU CGAUCGACCUUC UACUAG_UA~ ,3 Met lie lie
WSN
UCGUUUUCGUCCUCAAAUU UACUUAGGUUUGGUCUUUUAUUAU Met Ash Pro Asn Gin Lys lie lie
CT
TM
Fig. 1. Schematic representation of plasmid pT3NA/TAIL( - ). pT3NA/TAIL( - ) contains the cDNA of the NA gene of influenza A/WSN/33 (WSN) virus. Nucleotides encoding amino acid residues 2-6 of the cytoplasmic tail of the NA have been deleted, pT3NA/TAIL(-) was constructed as follows. First, a PCR product was obtained using universal primer (USB) and 5'-AGATCGATCCAATGGTTATGATCATCTTCC-3' primer and pT3GP2/BIP-NA as template. The obtained PCR product was digested with EcoRI and ClaI restriction enzymes and it was cloned into E c o R I / C l a I digested pT3GP2/BIP-NA (Garcia-Sastre et al., 1994). Then, the undesired sequences between the Nhel and BstXI sites were deleted. As a result, a linker sequence of 12 nt was inserted before the ATG of the NA/TAIL(-) open reading frame. The nucleotide sequence of the 3'-end of the NA RNA of NA/TAIL(-) and of WSN wild-type viruses is represented in the figure. Italic letters represent the 12-nt linker. A silent change that creates a new BclI restriction site is underlined. The beginning of the coding sequences is indicated by an asterisk. Coding assignments are indicated underneath the sequences. Amino acid residues located in the cytoplasmic tail (CT) and in the beginning of the transmembrane domain (TM) of the WSN NA are also indicated. Domains in the plasmid pT3NA/ TAIL(-) are represented as follows: 3'NC and 5'NC, 3'- and Y-non-coding sequences of the NA gene; NA ORF, NA open reading frame; T3, truncated T3 RNA polymerase promoter. Selected restriction sites are also indicated: Bb, BbsI; Bc, BclI; E, EcoRI; H, HindIII. WSN NA sequences are according to Hiti and Nayak (1982).
40
A. Garcia-Sastre, P. Palese / Virus Research 37 (1995) 37-47
For the present study, we generated a transfectant influenza virus whose N A protein lacks the entire conserved cytoplasmic tail. This virus was able to package the mutated N A into virus particles at levels which were similar to those found for wild-type viruses. These results demonstrate that the cytoplasmic tail of the N A is not required for N A incorporation into virus particles. We first constructed plasmid p T 3 N A / T A I L ( - ) (Fig. 1). This plasmid contains the N A c D N A of influenza A / W S N / 3 3 virus (WSN), in which the coding sequences for amino acid residues 2 - 6 were deleted at the same time that a new restriction site, BclI, was created. In addition, a non-coding linker of 12 nucleotides was inserted between the non-coding region of the gene and the A T G codon due to the cloning strategy. After linearization of p T 3 N A / T A I L ( - ) with BbsI restriction enzyme and in vitro T3 R N A polymerase transcription, an R N A molecule of negative polarity was generated containing the same 3'- and 5'-ends of the N A R N A of WSN virus. The synthetic N A / T A I L ( - ) R N A was incubated with purified influenza virus polymerase in order to reconstitute biologically active ribonucleoprotein (RNP) complexes, and transfected into M D B K cells infected with W S N - H K virus, as previously described (Enami and Palese, 1991). In this way, transfectant viruses were rescued, suggesting that the deletion of the NA cytoplasmic tail did not impair the viability of the virus. In order to confirm the identity of the rescued N A / T A I L ( - ) virus, the transfectant virus was plaque-purified 3 times on M D B K cells and one plaque was amplified for a seed virus preparation. The seed virus was further amplified through infection at low multiplicity of three 175-cm 2 flasks containing confluent monolayers of M D B K cells. Medium from infected cells was harvested 2 days after infection and virus was purified by differential ultracentrifugation (Garcia-Sastre et al., 1994). R N A was then extracted from purified virus as previously described (Luo et al., 1992). The 3'-end of the N A R N A segment of the transfectant virus was amplified as follows. First, 100 ng of virion R N A s was used for a reverse t r a n s c r i p t i o n r e a c t i o n using the p r i m e r 5 ' - G C G C G A A T T C T C T T T C G A G C A A A A G C A G G - 3 ' (EKFLU, annealing to the last 12 nt at the 3'-end of the
Bcl I
~ i~ ~!~i~
~
' i'~ill
~iiiii!ii! '==
134
= "
75
Fig. 2. Restriction analysis of the NA cDNA from N A / T A I L ( - ) transfectant. The first 112 nt at the 3'-end of the NA viral RNA from purified N A / T A I L ( - ) viruses were amplified by coupled reverse transcription-PCR, as described in the text. The PCR product (139 nt in length) was incubated at 37°C for 2 h in the presence or absence of 10 units of Bcll restriction enzyme. Samples were then run on a 2% agarose gel and stained with ethidium bromide. Faster migrating bands at the bottom of the gel probably correspond to unextended primers. Size markers in nt are indicated on the right.
A. Garc{a-Sastre, P. Palese/ VirusResearch 37 (1995) 37-47
41
influenza A virus RNAs) and SuperScript reverse transcriptase (Gibco-BRL). The c D N A was PCR-amplified by using the primers E K F L U and 5 ' - G C G C A A G C T T T A T T G A G A T T A T A T T T C C - 3 ' (containing nt 115-98 of the N A gene of WSN). A P C R product of 139 nt was amplified, corresponding to the 3'-end of the N A viral R N A . Since the transfected N A clone contains a specific BclI site at nt position 33 which is not found in wild type WSN N A cDNA, the resulting PCR product was tested for its ability to be digested by BclI. As shown in Fig. 2, the length of the P C R product was decreased after BclI digestion, indicating that the rescued virus contained the transfected N A gene. Further confirmation was obtained by cloning the P C R product between E c o R I and HindlII restriction sites (located at the ends of the primers) into pUC19. The resultant plasmid was sequenced with a D N A sequencing kit and universal and reverse primers (United States Biochemical). The sequence was identical to that of the transfected N A / T A I L ( - ) RNA. However, we cannot rule out possible compensatory mutations in the genome of the rescued virus which lie outside the sequenced region of the N A gene. We compared the amount of N A protein expressed in cells infected with NA/TAIL(-) and with wild-type WSN viruses. The viral NP protein was used as an internal control. We infected M D B K cells in 35-mm-diameter dishes at an m.o.i, of 2 with N A / T A I L ( - ) or WSN viruses. Cells 4 h postinfection were labeled with L-[35S]cysteine for 4 h, and lysed in 100 /1,1 of 0.15 M NaCI, 20 mM Tris-HC1 (pH 7.4) containing 1.5% n-octylglucoside and 1 mM CaCI 2 (lysis buffer). Then, 5 or 10/zl of cell extracts were used for immunoprecipitation with a mixture Cell e x t r a c t s Virus Ab
5 ~t I
lO ~ I
NA/TAIL(-)
WSN
NAJ-FAIL(-)
WSN
(~NP (~NA (;~NP (;~NA (~NP (~NA (~NP (~NA
iii!i~iii!i!!i
i iiii!!!'~!.
~
.
.
~v
. ----'69 46
~30 Fig. 3. Quantification of the levels of NA expression in NA/TAIL(-) transfectant-infected cells. Labeled cell extracts from infected MDBK cells were obtained as described in the text. Different amounts (5 or 10 /zl) of MDBK cell extracts were used for immunoprecipitation with monoclonal antibodies against the NP or the NA protein. Immunoprecipitated samples were run on a 10% SDS-polyacrylamide gel. After electrophoresis, the gel was fixed, dried, and autoradiographed. Molecular size markers in thousands are indicated on the right.
42
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
1
2
3
4 97
HA0
-'~
"-N P -%,. NA ~
46
HA1 M1 -%.
69
~30
HA2 - / " Fig. 4. Quantification of the amount of NA protein incorporated into N A / T A I L ( - ) virions. Labeled viruses were purified as described in the text. Similar amounts of purified N A / T A I L ( - ) and WSN viruses were used for immunoprecipitation with monoclonal antibodies against the NA protein. Samples before and after immunoprecipitation were analyzed by 10% S D S - P A G E . After electrophoresis, the gel was fixed, dried, and autoradiographed. Lanes 1 and 2, purified WSN and N A / T A I L ( - ) viruses, respectively. Lanes 3 and 4, immunoprecipitated samples from purified WSN and N A / T A I L ( - ) viruses, respectively. Note that the NA protein of N A / T A I L ( - ) virus, which is 5 amino acids shorter, migrates slightly faster than that of WSN virus. Viral proteins are indicated on the left. Numbers on the right are molecular weights in thousands.
of monoclonal antibodies 10C9 and 3C8 (specific for WSN NA), or with monoclonal antibody HT-103 (specific for the NP protein of influenza virus), as described (Percy et al., 1994). Immunoprecipitated proteins were analyzed by sodium dodecyl sulfate-10% polyacrylamide gel electrophoresis ( S D S - P A G E ) . The results are shown in Fig. 3. Immunoprecipitated bands were quantitated by a Phosphorimaging System (Molecular Dynamics, CA). Under these conditions there was a linear increase of the immunoprecipitated signal with the amount of cell extracts used. The ratio of N A / N P found in WSN-infected cells was 0.275 _+ 0.035 (average of two experiments), and in N A / T A I L ( - ) virus-infected cells it was 0.13 +_ 0.02 (average of two experiments). Thus, the amount of NA protein in N A / T A I L ( - ) virus-infected cells was approximately 50% of that in WSN virus-infected cells. Similar values were found when the amount of NA protein incorporated into virions was analyzed (Fig. 4). MDBK cells in 35-mm-diameter dishes were infected and labeled as in the previous experiment, except that 8 h postinfection, cold medium was added and cells were incubated 10 h more. Supernatants at 18 h postinfection were harvested, mixed with cold virus, and purified by differential ultracentrifugation (Garcla-Sastre et al., 1994). Purified viruses were disrupted in lysis buffer, and the NA protein in these samples was quantitated by immunoprecipitation and S D S - P A G E . The specific NA signals were standardized against total labeled viral proteins which were run at the same time in the polyacrylamide gel. The amount of NA protein incorporated into N A / T A I L ( - ) viruses was 65% of that found in WSN viruses (Fig. 4), which parallels the reduced level of the
A. Garcfa-Sastre, P. Palese / Virus Research 37 (1995) 3 7 - 4 7
8
43
S
6
id. 13_ ~4 0
i___u-WS N ) I~,]i NA/TAIL( 0 -- --
20
40
60
80
Hours after infection Fig. 5. Growth curve of N A / T A I L ( - ) transfectant. Confluent M D B K monolayers in 35-mm-diameter dishes were infected with N A / T A I L ( - ) or WSN viruses (m.o.i. = 0.001) and, at 12 h intervals, numbers of infectious particles present in the media were titrated by plaque assay in MDBK cells.
tail-less NA in infected cells. Total amount of viral proteins in purified N A / T A I L ( - ) viruses was approximately 10 times less than in wild-type viruses, suggesting that the absolute number of viruses produced in N A / T . A I L ( - ) infected cells was reduced (see below). We have also characterized the growth properties of N . A / T A I L ( - ) virus in tissue culture and in mice. The growth kinetics of the transfectant N_A/TAIL(-) virus in MDBK cells is compared with that of WSN virus in Fig. 5. Cells were infected at an m.o.i, of 0.001 and supernatants were harvested at different times postinfection, and titrated by plaque assay on MDBK cells. The peak titer of N_A/TAIL(-) transfectant virus was approximately 1 log~0 lower than that of wild-type WSN virus. -Accordingly, peak titers of hemagglutinin activity were also approximately 10-fold lower in supernatants from N A / T . A I L ( - ) infected cells (data not shown). Table 1 shows virus titers achieved in lungs of mice infected with N-A/T.AIL(-) virus or with WSN virus. Six-week-old female BALB/c mice were infected intranasally with 1000 plaque-forming-units (PFU) of virus. Three days
Table 1 Attenuation of the influenza N A / T A I L ( - )
transfectant in mice
Virus administered a
No. of mice
Virus in lungs (PFU) b
NA/TA1L( - ) WSN
4 3
5.44 _+0.08 6.13 _+0.67
Each mouse received 103 PFU intranasally in a 0.05-ml inoculum. b Lungs were homogenized 3 days after virus administration and titers (mean logl0 PFU + S.E.) were determined by plaque assay on MDBK cells. a
44
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995)37-47
later, mouse lungs were homogenized in cold PBS, and the samples were titrated by plaque assay on M D B K cells. In mouse lungs N A / T A I L ( - ) virus grew on average to approximately 1 log~0 lower titers than wild-type virus. In addition, the maximum PFU titer achieved on M D C K cells was 0.5 log10 lower than wild-type (data not shown). In this report, we found that the levels of the mutant NA packaged into virions correlated with the amount in infected cells. This result indicates that the deletion of the cytoplasmic tail of the NA does not impair the packaging of the NA into viral envelopes. Similarly, the expression of H A proteins lacking a cytoplasmic tail did not affect the incorporation of the H A protein into pseudotype virions (Simpson and Lamb, 1992; Naim and Roth, 1993). Furthermore, reverse genetics experiments have allowed the rescue of a transfectant influenza virus with a deletion in the cytoplasmic tail of the H A (Jin et al., 1994). These findings and our results suggest that the signal for incorporation of the NA and H A proteins into virus particles is not contained within their cytoplasmic tails. Bilsel et al. (1993) did not succeed in the generation of an influenza virus whose NA protein lacks the cytoplasmic tail, and the reason for this remains unclear. However, they rescued transfectant influenza viruses which contained single amino acid mutations in the cytoplasmic tail of the NA. In this case, packaging of the NA protein was affected only when an additional amino acid was inserted between the cytoplasmic tail and the transmembrane domain. This would suggest that the transmembrane domain close to the cytoplasm is involved in the packaging of the NA. In the case of the HA, it has been suggested that the signal for specific incorporation into virus particles is contained in the transmembrane domain of the protein (Naim and Roth, 1993). Support for this hypothesis also comes from the fact that a foreign protein containing the transmembrane and cytoplasmic domains of the H A is packaged into virions (Garcia-Sastre et al., 1994). However, further investigation is needed in order to understand the precise role of the transmembrahe domains of the H A and NA proteins in the incorporation of these proteins into budding viruses. Why is the sequence of the cytoplasmic tail of the NA so highly conserved if it is not required for the incorporation of the NA into virus particles? Although we have not determined the rate of transport to the membrane of the NA in N A / T A I L ( - ) virus-infected cells, the deletion of the cytoplasmic tail of the NA appears not to affect this process (Davis et al., 1983; Jones et al., 1985). The specific neuraminidase activity from purified viruses was also not altered by the deletion of the cytoplasmic tail, as measured with the synthetic substrate 4-methylumbelliferyl-~-D-N-acetylneuraminic acid (data not shown). This suggests that tetramerization of the NA was not affected, since it is thought that only NA tetramers are enzymatically active (Paterson and Lamb, 1990). In contrast, we were able to show that the amount of NA protein in infected cells was reduced to 50% when the cytoplasmic tail was deleted. This finding might reflect the fact that the cytoplasmic tail of the NA contributes to the stability of the protein, and that its deletion results in an increase of incorrectly folded proteins that are quickly degraded. Another explanation for the reduced levels of NA is that the efficiency
A. Garc[a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
45
of translation of the protein might have been affected in the new construct. The nucleotide sequence close to the A T G of the m R N A differs from that of wild type gene which might influence the translation efficiency (Kozak, 1986). Regardless of the mechanism, the reduction in N A expression may be responsible for the attenuation of the N A / T A I L ( - ) virus in tissue culture and in mice. Similarly, Castrucci et al. (1992) reported that the insertion of a foreign sequence in the stalk of the N A of a transfectant virus led to a two-fold decrease in N A activity and to attenuation of the virus. The decrease in virus titers that is observed when the cytoplasmic tail of the N A is deleted could provide a selective pressure sufficient to maintain an optimal configuration of this domain. Wild-type levels of N A activity may be required in order to efficiently remove sialic acids from the surface of viruses and cell membranes. In the absence of the N A , viruses aggregate and remain attached to the cell membrane because the H A cannot separate from the cell's sialic acid-containing receptors (Palese et al., 1974). In addition, the level of the N A activity may affect the efficiency of cleavage of HA0 into HA1 and HA2 in infected cells (Schulman and Palese, 1977; Li et al., 1993). This cleavage is needed for the fusion activity of the HA. The reduced levels of N A in N A / T A L L ( - ) infected cells could be the reason for the increase of uncleaved HA0 which is found in purified N A / T A I L ( - ) virus (Fig. 4, lane 2). Thus, the possible decrease in efficiency of virus release a n d / o r the altered H A cleavage due to reduced N A expression could account for the observed attenuation of the N A / T A I L ( - ) transfectant virus. In summary, although the cytoplasmic tail of the N A may provide a growth advantage to the virus, this domain is not required for the incorporation of the N A into virus envelopes.
Acknowledgements We thank Michael Bergmann for his help in cloning p T 3 N A / T A I L ( - ) , and Scott Kerns and Ricardo Renvill for excellent technical assistance. This work was supported by an M E C / F u l b r i g h t scholarship (A.G.-S.) and by the N I H (P.P,).
References Baker, A.T., Varghese, J.N., Laver, W.G., Air, G.M. and Colman, P.M. (1987) Three-dimensional structure of neuraminidase of subtype N9 from an avian influenza virus. Protein Struct. Funct. Genet. 2, 111-117. Bilsel, P., Castrucci, M.R. and Kawaoka, Y. (1993) Mutations in the cytoplasmic tail of influenza A virus neuraminidase affect incorporation into virions. J. Virol. 67, 6762-6767. Blok, J. and Air, G.M. (1982) Sequence variation at the 3' end of the neuraminidase gene from 39 influenza type A viruses. Virology 121,211-229. Castrucci, M.R. and Kawaoka, Y. (1993) Biological importance of neuraminidase stalk length in influenza A virus. J. Virol. 67, 759-764. Castrucci, M.R., Bilsel, P. and Kawaoka, Y. (1992) Attenuation of influenza A virus by insertion of a foreign epitope into the neuraminidase. J. Virol. 66, 4647-4653.
46
A. Garcla-Sastre, P. Palese / Virus Research 37 (1995) 37-47
Castrucci, M.R., Hou, S., Doherty, P.C. and Kawaoka, Y. (1994) Protection against lethal lymphocytic choriomeningitis virus (LCMV) infection by immunization of mice with an influenza virus containing an LCMV epitope recognized by cytotoxic T lymphocytes. J. Virol. 68, 3486-3490. Colman, P.M. (1989) Neuraminidase: enzyme and antigen. In: R.M. Krug (Ed.), The Influenza Viruses. Plenum Press, New York, pp. 175-218. Davis, A.R., Bos, T.J. and Nayak, D.P. (1983) Active influenza virus neuraminidase is expressed in monkey cells from cDNA cloned in simian virus 40 vectors. Proc. Natl. Acad. Sci. U.S.A. 80, 3976-3980. Enami, M. and Palese, P. (1991) High-efficiency formation of influenza virus transfectants. J. Virol. 65, 2711-2713. Enami, M., Luytjes, W., Krystal, M. and Palese, P. (1990) Introduction of site-specific mutations into the genome of influenza virus. Proc. Natl. Acad. Sci. U.S.A. 87, 3802-3805. Gaedigk-Nitschko, K. and Schlesinger, M.J. (1991) Site-directed mutations in Sindbis virus E2 glycoprotein's cytoplasmic domain and the 6K protein lead to similar defects in virus assembly and budding. Virology 183, 206-214. Garc~a-Sastre, A. and Palese, P. (1993) Genetic manipulation of negative-strand RNA virus genomes. Annu. Rev. Microbiol. 47, 765-790. Garcla-Sastre, A., Muster, T., Barclay, W.S., Percy, N. and Palese, P. (1994) Use of a mammalian internal ribosomal entry site element for expression of a foreign protein by a transfectant influenza virus. J. Virol. 68, 6254-6261. Hiti, A.L. and Nayak, D.P. (1982) Complete nucleotide sequence of the neuraminidase gene of human influenza virus A/WSN/33. J. Virol. 41, 730-734. Hogue, B.G. and Nayak, D.P. (1994) Deletion mutation in the signal anchor domain activates cleavage of the influenza virus neuraminidase, a type II transmembrane protein. J. Gen. Virol. 75, 1015-1022. Hunter, E. (1994) Macromolecular interactions in the assembly of HIV and other retroviruses. Semin. Virol. 5, 71-83. Ivanova, L. and Schlesinger, M.J. (1993) Site-directed mutations in the Sindbis virus E2 glycoprotein identify palmitoylation sites and affect virus budding. J. Virol. 67, 2546-2551. Jin, H., Leser, G.P. and Lamb, R.A. (1994) The influenza virus hemagglutinin cytoplasmic tail is not essential for virus assembly or infectivity. EMBO J. 13, 5504-5515. Jones, L.V., Compans, R.W., Davis, A.R., Bos, T.J. and Nayak, D.P. (1985) Surface expression of influenza virus neuraminidase, an amino-terminally anchored viral membrane glycoprotein, in polarized epithelial cells. Mol. Cell. Biol. 5, 2181-2189. Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292. Li, S., Schulman, J., ltamura, S. and Palese, P. (1993) Glycosylation of neuraminidase determines the neurovirulence of influenza A / W S N / 3 3 virus. J. Virol. 67, 6667-6673. Luo, G., Bergmann, M., Garcia-Sastre, A. and Palese, P. (1992) Mechanism of attenuation of a chimeric influenza A / B transfectant virus. J. Virol. 66, 4679-4685. Luo, G., Chang, J. and Palese, P. (1993) Alterations of the stalk of the influenza virus neuraminidase: deletions and insertions. Virus Res. 29, 141-153. Luytjes, W., Krystal, M., Enami, M., Parvin, J.D. and Palese, P. (1989) Amplification, expression, and packaging of a foreign gene by influenza virus. Cell 59, 1107-1113. Metsikko, K. and Garoff, H. (1990) Oligomers of the cytoplasmic domain of the p62/E2 membrane protein of Semliki Forest virus bind to nucleocapsid in vitro. J. Virol. 64, 4678-4683. Miki, T., Nishida, Y., Hisajima, H., Miyata, T., Kumahara, Y., Nerome, K., Oya, A., Fukui, T., Ohtsuka, E., Ikehara, M. and Honjo, T. (1983) The complete nucleotide sequence of the influenza virus neuraminidase gene of A / N J / 8 / 7 6 strain and its evolution by segmental duplication and deletion. Mol. Biol. Med. 1,401-413. Naim, H.Y. and Roth, M.G. (1993) Basis for selective incorporation of glycoproteins into the influenza virus envelope. J. Virol. 4831-4841. Nayak, D.P. and Jabbar, M.A. (1989) Structural domains and organizational conformation involved in the sorting and transport of influenza virus transmembrane proteins. Annu. Rev. Microbiol. 43, 465-501.
A. Garc{a-Sastre, P. Palese / Virus Research 37 (1995) 37-47
47
Palese, P, Tobita, K., Ueda, M. and Compans, R.W. (1974) Characterization of temperature-sensitive influenza virus mutants defective in neuraminidase. Virology 61, 397-410. Paterson, R.G. and Lamb, R.A. (1990) Conversion of a class II integral membrane protein into a soluble and efficiently secreted protein: multiple intracellular and extracellular oligomeric and conformational forms. J. Cell. Biol. 110, 999-1011. Percy, N., Barclay, W.S., Garcfa-Sastre, A. and Palese, P. (1994) Expression of a foreign protein by influenza A virus. J. Virol. 68, 4486-4492. Schulman, J.L. and Palese, P. (1977) Virulence factors of influenza A viruses: WSN virus neuraminidase required for plaque production in MDBK cells. J. Virol. 24, 170-176. Simpson, D.A. and Lamb, R.A. (1992) Alterations to influenza virus hemagglutinin cytoplasmic tail modulate virus infectivity. J. Virol. 66, 790-803. Varghese, J.N., Laver, W.G. and° Colman, P.M. (1983) Structure of the influenza virus glycoprotein antigen neuraminidase at 2.9 A resolution. Nature 305, 35-40. Zhao, H., Lindqvist, B., Garoff, H, Von Bonsdorff, C.-H. and Liljestr6m, P. (1994) A tyrosinc-based motif in the cytoplasmic domain of the alphavirus envelope protein is essential for budding. EMBO J. 13, 4204-4211.