- Email: [email protected]
The detection and persistence of Cannabis sativa DNA on skin
SCIENTIFIC & TECHNICAL
The detection and ~ersistenceof Cannabis sativa DNA on skin M WILKINSON and AMT LINACRE* Forensic Science Unit, Department of Pure & Applied Chemistry, University of Strathclyde, 204 George Street, Glasgow GI lm United Kingdom Science & Justice 2000: 40: 11-14 Received 16 June 1999; accepted 10 September 1999
The presence of Cannabis sativa DNA was detected on the skin of persons who have recently handled both leaf and resinous material. The persistence of C. sativa DNA was examined on the skin. The subjects were asked to either repeatedly rub their hands on their trousers, place their hands repeatedly into their pockets or wash their hands in soap and water. After rubbing the hands on trousers or placing them in pockets C. sativa DNA could still be detected. No DNA could be detected after washing the hands.
Auf der Haut von Personen, die erst kiirzlich sowohl Blatter als auch harzige Materialien von C. sativa in ihren Hiinden hielten, konnte DNA dieser F'flanzen nachgewiesen werden. Die Venveildauer der C. sativa DNA auf der Haut wurde untersucht. Die Probanden wischten sich entweder mehrmals die Hiinde an ihren Hosen ab oder steckten die H b d e wiederholt in die Hosentaschen. In beiden Fdlen konnte anschlieBend noch C. sativa DNA auf den Hiinden nachgewiesen werden. Dagegen fiihrte das Waschen rnit Wasser und Seife zum einem volligen Verlust der C. sativa DNA auf den Hiinden der Probanden.
La prksence d'ADN de Cannabis sativa a Ct6 d6tectCe sur la peau de personnes qui avaient manipulC rkcemment des feuilles et du mattriel rksineux. La persistance sur la peau de 1'ADN du Cannabis sativa a CtC examinte. Les sujets devaient soit frotter leurs mains de manibre rCpCt6e sur leur pantalon, placer leurs mains de manibre rCpCtCe dans leurs poches ou laver leurs mains avec du savon et de l'eau. Aprbs avoir frottC les mains sur des pantalons ou aprbs les avoir placCes dans les poches, I'ADN de Cannabis sativa pouvait encore $we dCtectC. Aucun ADN ne pouvait $tre dCtectC apr&sle lavage des mains.
Se ha detectado la presencia de DNA de Cannabis sativa en la pie1 de personas que han manejado recientemente tanto la hoja como la resina. La persistencia del DNA del Cannabis sativa se ha examinado en la piel. Se les pidi6 a 10s sujetos que se frotasen repetidamente las manos en sus pantalones, las metieran repetidas veces en 10s bolsillos o se las lavaran con agua y jab6n. DespuCs de frotarse en 10s pantalones y de meterlas en 10s bolsillos, se pudo detectar DNA de Cannabis sativa. No se pudo detectar DNA despuCs de lavarse las manos.
Key Words: Forensic science; Drugs of abuse; Cannabis; Chloroplast; DNA; Detection; Skin.
*corresponding author Science & Justice 2000; 40(1): 11-14
The detection and persistence of Cannabis sativa DNA on skin
Introduction
During the course of using the controlled substance cannabis, the user may handle the vegetative material or resin. There have been a number of tests developed to detect the presence of cannabis [1,2]. These methods make use of the botanical nature of cannabis and detect DNA from the plant Cannabis sativa L. (C. sativa). There has been interest in using DNA to link C. sativa samples, originally using random amplification of polymorphic DNA (RAPD) [3,4,5,6]. More specific tests identify the presence of C. sativa either based on specific regions of DNA in the chloroplast [I] or the intergenic spacer of the ribosomal gene in the nucleus [2]. Trace amounts of plant material originating from C. sativa can be detected on the skin of persons who have recently handled cannabis, although under the same conditions no detection of cannabis occurred on control surfaces such as bench tops (unpublished observations at Strathclyde University). Specific DNA primers to regions of the C. sativa genome have been used to amplify intervening DNA by the polymerase chain reaction (PCR). Chloroplasts are found in large numbers within each plant cell, in comparison to the one nucleus, and the chloroplast is protected by a protein membrane reducing bacterial breakdown of the chloroplast DNA. This gives the DNA test based on the chloroplast genome advantages over tests based on nuclear DNA. The specific DNA primers to the chloroplast genome amplify a region of the tRNA gene complex and are within regions of conserved DNA. This permits universal primers, which will amplify all green plants, to be used in conjunction with C. sativa specific DNA primers [Figure I]. Primer H is C. sativa specific while C and D are universal primers [I]. This paper reports that C. sativa DNA can be detected by PCR on the hands of subjects who have recently handled
C
0 X
a
100 bases
m 4
E
C
(cl
E
4-
FIGURE 1 A diagrammatic representation of the DNA sequence of the tRNA gene complex of chloroplast DNA. The boxes represent the conserved gene sequences; the line between the trnL 5' exon and trnL 3' exon represents the intron sequence, and the line between the trnL 3' exon and the trnF gene sequence represents the intergenic spacer. The vosition of the primers is shown by the arrows.
cannabis material and then performed a number of tasks. The DNA was at a level such that it could not be routinely detected after an initial thirty cycles of amplification. A second set of amplifications was performed internal to the first, amplifying specifically the products of the first PCR. Both vegetative material and resin were used. Materials and methods
Sampling One sample of leaf and one of resinous material from Cannabis sativa (C. sativa) were obtained. The leaf was from a plant of South African origin, and the resin was of unknown origin supplied through casework samples at the Forensic Science Unit, Strathclyde University. Before use, the resin material was gently heated in a flame to soften the material. Ten volunteers took part in this study and rubbed a small quantity of vegetative material or resin between forefinger and thumb for five seconds. No material could be visually detected. The volunteers were then asked to either rub their hands over their trousers, making sure the finger and thumb were in contact with the trousers. This was repeated two, five or ten times. A second set of volunteers was asked to place their hands in their pockets two, five or ten times. A third set of volunteers was asked to wash their hands using soap and water for five seconds. The hands were then dried on a paper towel. All the groups were sampled by swabbing the forefinger and thumb of each volunteer with a sterile cotton wool swab moistened with sterile double-distilled water (ddH20). A blank control was performed for each group, where an individual was chosen who had not handled cannabis. In this case a swab was taken from the forefinger and thumb of the negative control volunteer and treated in exactly the same manner as the experimental samples. DNA Extraction DNA was extracted using a protocol modified after that of Gigliano et a1 [6]. Swab heads were transferred into a 2 ml disposable microcentrifuge tube. Extraction buffer, 800 p1 (50mM Tris-HC1 pH 8.0; 20mM EDTA pH 8.0; 0.2% bovine serum albumin (BSA); 1% polyvinylpyrrolidone (PVP) and 0.1% P-mercaptoethanol) were added to the tube. The cells were lysed by adding 100 yl 20% sodium dodecyl sulphate (SDS) and incubated for 15 min in a water bath at 67°C.
The swab head was removed and the samples were briefly cooled in an ice bath and proteins precipitated by adding 0.3 vol 5M potassium acetate, followed by 20 min incubation on ice and 20 min centrifuging in an Eppendorf rnicrocentrifuge at 14000g. The supernatant was extracted with chloroform-isoamyl alcohol (24:l) and DNA precipitated by adding 2 vol ethanol and 0.1 vol 3M sodium acetate to the aqueous extract. Science & Justice 2000; 40(1): 11-14
M WILKINSON and AMT LINACRE
FIGURE 2 Photograph of results: PCR products from the DNA test separated on an agarose gel. Lane 1 is the 100 bp DNA size ladder; lane 2 is the positive control; lane 3 is the negative control; lane 4 is from leaf material; and lane 5 is from resin.
Samples were cooled on an ice bath and centrifuged for 15 min under the same conditions as above. The pellet was resuspended in 500 pl of ddH20. DNA was precipitated again with 85 p14M sodium chloride and 500 pl 20% polyethylene glycol (PEG-8000). Vials were then frozen in an ethanol-dry ice bath for 30 min. Finally, the DNA was collected by centrifuging for 15 min as above, washed in absolute ethanol and resuspended in 20 pl of ddH20. Nested PCR amplijication by universal and C. sativa specific primers C, D and H The chloroplast tRNA gene complex was amplified using the universal primer C (5'CATTACAAATGCGATGCTC3') and the C. sativa specific primer H (S'ACTAGAGGAClTGGACTATGTC3'). PCR amplifications were performed in a total volume of 20 pl containing 1 pl of DNA extracted from the swab, 200 pM of each dNTPs, PCR buffer (10mM Tris-HC1 pH 8.3, 50mM KCl, 1.5rnM MgC12), 1 unit of Tag polymerase (Promega), and lOOpM of each primer C and H (Genosys UK). Amplification proceeded for 30 cycles of 94°C for 30 sec, 63°C for 30 sec and 72°C for 30 sec, followed by 60°C for 30 min, using a PE Applied Biosystems 2400 thermal cycler. Science & Justice 2000; 40(1): 11-14
An internal amplification was performed by adding 1 p1 of the PCR product into 1 ml of ddH20. From this 1 pl was added to an amplification containing 100 pM of the universal C primer (S'CGAAATCGGTAGACGCTACG3') and universal D primer (S1GGGATAGAGGGACTTGAAC3') (Genosys UK). The amplifications were as described above. Electrophoresis The PCR products were separated on a 2% agarose gel prepared in 1 x TAE buffer (0.04M Tris acetate, 0.001M EDTA pH 8.0) containing 5nglml ethidium bromide. Electrophoresis occurred at 10 Vlcm. A lOObp marker (Promega) was run on the gel as a size ladder. The DNA bands were visualised on an ultraviolet transilluminator and photographed using 667 Polaroid film.
Results After amplification of the C. sativa DNA from the hands of the volunteers the PCR fragments were separated on an agarose gel. No PCR products were visible after 30 cycles. The nested approach using 30 cycles with primers C and H, which will only amplify C. sativa DNA and no other plant DNA, followed by two internal primers for a second series of 30 cycles produced PCR products. These produced DNA products of expected size. A positive result for the amplifications is as shown in Figure 2. In lane 2 is the amplified DNA running at approximately 350 bp, as compared to the 13
The detection and persistence of Cannabis sativa DNA on skin
size standard run in lane 1. This is in close correlation to the actual size of the DNA product between C and D; reported as 348bp [I]. The size of DNA product on the gels corresponds with the expected. No PCR products were detected in the negative controls after 30 or 60 cycles. Three activities were examined, rubbing hands on trousers, placing hands in pockets and washing hands. The detection of the PCR product after these activities is shown in Table 1. Each test was performed using volunteers from the laboratory and performed under the conditions described. The results are for both vegetative and resinous materials.
TABLE 1 Results of tests for C.sutiva DNA on the hands of volunteers. Activity
N ~ of. times pe$ormed
N ~ of. subjects
PCR product detected
Rubbing hands on trousers
10
10
Yes
Placing hands in pockets
10
10
Yes
Washing hands in water
5
5
No
After rubbing their hands on their trousers up to ten times C. sativa DNA was detected. The physical disturbance caused by this action is insufficient to remove the plant material from the hands. A result of this is shown in Figure 2, where lanes 4 and 5 come from swabs on the hand of persons who have handled leaf material and resin, and then been subjected to rubbing their hands on their trousers ten times. C. sativa DNA was still detected on individuals who had repeatedly placed their hands in the pockets ten times. This was the case for the vegetative material and the resin in both instances.
No C. sativa DNA was detected after the subjects washed their hands in soap and water. The effect of washing either removed the DNA or prevented amplification.
Conclusions The use of primers specific to C. sativa DNA in PCR followed by internal primers is a sensitive test that will produce a DNA product even after repeated physical disruption to the hands. The sensitivity of the DNA technique is comparable to presumptive tests to detect the presence of cannabinoids followed by GCIMS (Dr Michael Cole, personal commmunication). Loss of C. sativa DNA was not achieved by physical disturbances. The persistence of the plant material is greater than reported for other sources of trace evidence, such as gunshot residue [7,8]. References 1. Linacre A and Thorpe J. Detection and Identification of cannabis by DNA. Forensic Science International 1998; 91:71-76. 2. Gigliano GS, Caputo P and Cozzolino S. Ribosomal DNA analysis as a tool for the identification of Cannabis sativa L. specimens of forensic interest. Science & Justice 1997; 3:171-174. 3. Gillan R, Cole MD, Linacre A, Thome JW and Watson ND. Comparison of Cannabis sativa by Random Amplification of Polymorphic DNA (RAPD) and HPLC of Cannabinoids - A preliminary study. Science & Justice 1995; 35:169-177. 4. Faeti V, Mandolin0 G and Ranalli P. Genetic diversity of Cannabis sativa germplasm based on RAPD markers. Plant Breeding 1996; 115: 367-370. 5. Jagadish V, Robertson J and Gibbs A. RAPD analysis distinguishes Cannabis sativa samples from different sources. Forensic Science International 1996; 79: 113-121. 6. Gigliano GS. Identification of Cannabis sativa L. (Cannabaceae) using restriction profiles of the Internal Transcribed Spacer II (ITS2). Science & Justice 1998; 38: 225-230. 7. Harrison HC and Gilroy R. Firearm discharge GSRs. Journal of Forensic Sciences 1959: 4(2): 184-1999 8. Kilty JW. Activity after shooting and its effects on the retention of primer GSR. Journal of Forensic Sciences 1975; 20(2): 228-246.
Science & Justice 2000; 40(1): 11-14
The detection and ~ersistenceof Cannabis sativa DNA on skin M WILKINSON and AMT LINACRE* Forensic Science Unit, Department of Pure & Applied Chemistry, University of Strathclyde, 204 George Street, Glasgow GI lm United Kingdom Science & Justice 2000: 40: 11-14 Received 16 June 1999; accepted 10 September 1999
The presence of Cannabis sativa DNA was detected on the skin of persons who have recently handled both leaf and resinous material. The persistence of C. sativa DNA was examined on the skin. The subjects were asked to either repeatedly rub their hands on their trousers, place their hands repeatedly into their pockets or wash their hands in soap and water. After rubbing the hands on trousers or placing them in pockets C. sativa DNA could still be detected. No DNA could be detected after washing the hands.
Auf der Haut von Personen, die erst kiirzlich sowohl Blatter als auch harzige Materialien von C. sativa in ihren Hiinden hielten, konnte DNA dieser F'flanzen nachgewiesen werden. Die Venveildauer der C. sativa DNA auf der Haut wurde untersucht. Die Probanden wischten sich entweder mehrmals die Hiinde an ihren Hosen ab oder steckten die H b d e wiederholt in die Hosentaschen. In beiden Fdlen konnte anschlieBend noch C. sativa DNA auf den Hiinden nachgewiesen werden. Dagegen fiihrte das Waschen rnit Wasser und Seife zum einem volligen Verlust der C. sativa DNA auf den Hiinden der Probanden.
La prksence d'ADN de Cannabis sativa a Ct6 d6tectCe sur la peau de personnes qui avaient manipulC rkcemment des feuilles et du mattriel rksineux. La persistance sur la peau de 1'ADN du Cannabis sativa a CtC examinte. Les sujets devaient soit frotter leurs mains de manibre rCpCt6e sur leur pantalon, placer leurs mains de manibre rCpCtCe dans leurs poches ou laver leurs mains avec du savon et de l'eau. Aprbs avoir frottC les mains sur des pantalons ou aprbs les avoir placCes dans les poches, I'ADN de Cannabis sativa pouvait encore $we dCtectC. Aucun ADN ne pouvait $tre dCtectC apr&sle lavage des mains.
Se ha detectado la presencia de DNA de Cannabis sativa en la pie1 de personas que han manejado recientemente tanto la hoja como la resina. La persistencia del DNA del Cannabis sativa se ha examinado en la piel. Se les pidi6 a 10s sujetos que se frotasen repetidamente las manos en sus pantalones, las metieran repetidas veces en 10s bolsillos o se las lavaran con agua y jab6n. DespuCs de frotarse en 10s pantalones y de meterlas en 10s bolsillos, se pudo detectar DNA de Cannabis sativa. No se pudo detectar DNA despuCs de lavarse las manos.
Key Words: Forensic science; Drugs of abuse; Cannabis; Chloroplast; DNA; Detection; Skin.
*corresponding author Science & Justice 2000; 40(1): 11-14
The detection and persistence of Cannabis sativa DNA on skin
Introduction
During the course of using the controlled substance cannabis, the user may handle the vegetative material or resin. There have been a number of tests developed to detect the presence of cannabis [1,2]. These methods make use of the botanical nature of cannabis and detect DNA from the plant Cannabis sativa L. (C. sativa). There has been interest in using DNA to link C. sativa samples, originally using random amplification of polymorphic DNA (RAPD) [3,4,5,6]. More specific tests identify the presence of C. sativa either based on specific regions of DNA in the chloroplast [I] or the intergenic spacer of the ribosomal gene in the nucleus [2]. Trace amounts of plant material originating from C. sativa can be detected on the skin of persons who have recently handled cannabis, although under the same conditions no detection of cannabis occurred on control surfaces such as bench tops (unpublished observations at Strathclyde University). Specific DNA primers to regions of the C. sativa genome have been used to amplify intervening DNA by the polymerase chain reaction (PCR). Chloroplasts are found in large numbers within each plant cell, in comparison to the one nucleus, and the chloroplast is protected by a protein membrane reducing bacterial breakdown of the chloroplast DNA. This gives the DNA test based on the chloroplast genome advantages over tests based on nuclear DNA. The specific DNA primers to the chloroplast genome amplify a region of the tRNA gene complex and are within regions of conserved DNA. This permits universal primers, which will amplify all green plants, to be used in conjunction with C. sativa specific DNA primers [Figure I]. Primer H is C. sativa specific while C and D are universal primers [I]. This paper reports that C. sativa DNA can be detected by PCR on the hands of subjects who have recently handled
C
0 X
a
100 bases
m 4
E
C
(cl
E
4-
FIGURE 1 A diagrammatic representation of the DNA sequence of the tRNA gene complex of chloroplast DNA. The boxes represent the conserved gene sequences; the line between the trnL 5' exon and trnL 3' exon represents the intron sequence, and the line between the trnL 3' exon and the trnF gene sequence represents the intergenic spacer. The vosition of the primers is shown by the arrows.
cannabis material and then performed a number of tasks. The DNA was at a level such that it could not be routinely detected after an initial thirty cycles of amplification. A second set of amplifications was performed internal to the first, amplifying specifically the products of the first PCR. Both vegetative material and resin were used. Materials and methods
Sampling One sample of leaf and one of resinous material from Cannabis sativa (C. sativa) were obtained. The leaf was from a plant of South African origin, and the resin was of unknown origin supplied through casework samples at the Forensic Science Unit, Strathclyde University. Before use, the resin material was gently heated in a flame to soften the material. Ten volunteers took part in this study and rubbed a small quantity of vegetative material or resin between forefinger and thumb for five seconds. No material could be visually detected. The volunteers were then asked to either rub their hands over their trousers, making sure the finger and thumb were in contact with the trousers. This was repeated two, five or ten times. A second set of volunteers was asked to place their hands in their pockets two, five or ten times. A third set of volunteers was asked to wash their hands using soap and water for five seconds. The hands were then dried on a paper towel. All the groups were sampled by swabbing the forefinger and thumb of each volunteer with a sterile cotton wool swab moistened with sterile double-distilled water (ddH20). A blank control was performed for each group, where an individual was chosen who had not handled cannabis. In this case a swab was taken from the forefinger and thumb of the negative control volunteer and treated in exactly the same manner as the experimental samples. DNA Extraction DNA was extracted using a protocol modified after that of Gigliano et a1 [6]. Swab heads were transferred into a 2 ml disposable microcentrifuge tube. Extraction buffer, 800 p1 (50mM Tris-HC1 pH 8.0; 20mM EDTA pH 8.0; 0.2% bovine serum albumin (BSA); 1% polyvinylpyrrolidone (PVP) and 0.1% P-mercaptoethanol) were added to the tube. The cells were lysed by adding 100 yl 20% sodium dodecyl sulphate (SDS) and incubated for 15 min in a water bath at 67°C.
The swab head was removed and the samples were briefly cooled in an ice bath and proteins precipitated by adding 0.3 vol 5M potassium acetate, followed by 20 min incubation on ice and 20 min centrifuging in an Eppendorf rnicrocentrifuge at 14000g. The supernatant was extracted with chloroform-isoamyl alcohol (24:l) and DNA precipitated by adding 2 vol ethanol and 0.1 vol 3M sodium acetate to the aqueous extract. Science & Justice 2000; 40(1): 11-14
M WILKINSON and AMT LINACRE
FIGURE 2 Photograph of results: PCR products from the DNA test separated on an agarose gel. Lane 1 is the 100 bp DNA size ladder; lane 2 is the positive control; lane 3 is the negative control; lane 4 is from leaf material; and lane 5 is from resin.
Samples were cooled on an ice bath and centrifuged for 15 min under the same conditions as above. The pellet was resuspended in 500 pl of ddH20. DNA was precipitated again with 85 p14M sodium chloride and 500 pl 20% polyethylene glycol (PEG-8000). Vials were then frozen in an ethanol-dry ice bath for 30 min. Finally, the DNA was collected by centrifuging for 15 min as above, washed in absolute ethanol and resuspended in 20 pl of ddH20. Nested PCR amplijication by universal and C. sativa specific primers C, D and H The chloroplast tRNA gene complex was amplified using the universal primer C (5'CATTACAAATGCGATGCTC3') and the C. sativa specific primer H (S'ACTAGAGGAClTGGACTATGTC3'). PCR amplifications were performed in a total volume of 20 pl containing 1 pl of DNA extracted from the swab, 200 pM of each dNTPs, PCR buffer (10mM Tris-HC1 pH 8.3, 50mM KCl, 1.5rnM MgC12), 1 unit of Tag polymerase (Promega), and lOOpM of each primer C and H (Genosys UK). Amplification proceeded for 30 cycles of 94°C for 30 sec, 63°C for 30 sec and 72°C for 30 sec, followed by 60°C for 30 min, using a PE Applied Biosystems 2400 thermal cycler. Science & Justice 2000; 40(1): 11-14
An internal amplification was performed by adding 1 p1 of the PCR product into 1 ml of ddH20. From this 1 pl was added to an amplification containing 100 pM of the universal C primer (S'CGAAATCGGTAGACGCTACG3') and universal D primer (S1GGGATAGAGGGACTTGAAC3') (Genosys UK). The amplifications were as described above. Electrophoresis The PCR products were separated on a 2% agarose gel prepared in 1 x TAE buffer (0.04M Tris acetate, 0.001M EDTA pH 8.0) containing 5nglml ethidium bromide. Electrophoresis occurred at 10 Vlcm. A lOObp marker (Promega) was run on the gel as a size ladder. The DNA bands were visualised on an ultraviolet transilluminator and photographed using 667 Polaroid film.
Results After amplification of the C. sativa DNA from the hands of the volunteers the PCR fragments were separated on an agarose gel. No PCR products were visible after 30 cycles. The nested approach using 30 cycles with primers C and H, which will only amplify C. sativa DNA and no other plant DNA, followed by two internal primers for a second series of 30 cycles produced PCR products. These produced DNA products of expected size. A positive result for the amplifications is as shown in Figure 2. In lane 2 is the amplified DNA running at approximately 350 bp, as compared to the 13
The detection and persistence of Cannabis sativa DNA on skin
size standard run in lane 1. This is in close correlation to the actual size of the DNA product between C and D; reported as 348bp [I]. The size of DNA product on the gels corresponds with the expected. No PCR products were detected in the negative controls after 30 or 60 cycles. Three activities were examined, rubbing hands on trousers, placing hands in pockets and washing hands. The detection of the PCR product after these activities is shown in Table 1. Each test was performed using volunteers from the laboratory and performed under the conditions described. The results are for both vegetative and resinous materials.
TABLE 1 Results of tests for C.sutiva DNA on the hands of volunteers. Activity
N ~ of. times pe$ormed
N ~ of. subjects
PCR product detected
Rubbing hands on trousers
10
10
Yes
Placing hands in pockets
10
10
Yes
Washing hands in water
5
5
No
After rubbing their hands on their trousers up to ten times C. sativa DNA was detected. The physical disturbance caused by this action is insufficient to remove the plant material from the hands. A result of this is shown in Figure 2, where lanes 4 and 5 come from swabs on the hand of persons who have handled leaf material and resin, and then been subjected to rubbing their hands on their trousers ten times. C. sativa DNA was still detected on individuals who had repeatedly placed their hands in the pockets ten times. This was the case for the vegetative material and the resin in both instances.
No C. sativa DNA was detected after the subjects washed their hands in soap and water. The effect of washing either removed the DNA or prevented amplification.
Conclusions The use of primers specific to C. sativa DNA in PCR followed by internal primers is a sensitive test that will produce a DNA product even after repeated physical disruption to the hands. The sensitivity of the DNA technique is comparable to presumptive tests to detect the presence of cannabinoids followed by GCIMS (Dr Michael Cole, personal commmunication). Loss of C. sativa DNA was not achieved by physical disturbances. The persistence of the plant material is greater than reported for other sources of trace evidence, such as gunshot residue [7,8]. References 1. Linacre A and Thorpe J. Detection and Identification of cannabis by DNA. Forensic Science International 1998; 91:71-76. 2. Gigliano GS, Caputo P and Cozzolino S. Ribosomal DNA analysis as a tool for the identification of Cannabis sativa L. specimens of forensic interest. Science & Justice 1997; 3:171-174. 3. Gillan R, Cole MD, Linacre A, Thome JW and Watson ND. Comparison of Cannabis sativa by Random Amplification of Polymorphic DNA (RAPD) and HPLC of Cannabinoids - A preliminary study. Science & Justice 1995; 35:169-177. 4. Faeti V, Mandolin0 G and Ranalli P. Genetic diversity of Cannabis sativa germplasm based on RAPD markers. Plant Breeding 1996; 115: 367-370. 5. Jagadish V, Robertson J and Gibbs A. RAPD analysis distinguishes Cannabis sativa samples from different sources. Forensic Science International 1996; 79: 113-121. 6. Gigliano GS. Identification of Cannabis sativa L. (Cannabaceae) using restriction profiles of the Internal Transcribed Spacer II (ITS2). Science & Justice 1998; 38: 225-230. 7. Harrison HC and Gilroy R. Firearm discharge GSRs. Journal of Forensic Sciences 1959: 4(2): 184-1999 8. Kilty JW. Activity after shooting and its effects on the retention of primer GSR. Journal of Forensic Sciences 1975; 20(2): 228-246.
Science & Justice 2000; 40(1): 11-14