The detection of dioxin- and estrogen-like pollutants in marine and freshwater fishes cultivated in Pearl River Delta, China

Environmental Pollution 158 (2010) 2302e2309

Contents lists available at ScienceDirect

Environmental Pollution journal homepage: www.elsevier.com/locate/envpol

The detection of dioxin- and estrogen-like pollutants in marine and freshwater fishes cultivated in Pearl River Delta, China X. Wei a, L.Y. Ching a, S.H. Cheng c, M.H. Wong a, b, Chris K.C. Wong a, b, * a

Department of Biology, Hong Kong Baptist University, Kowloon, Hong Kong Croucher institute of Environmental Sciences, Hong Kong Baptist University, Kowloon, Hong Kong c Department of Biology and Chemistry, City University of Hong Kong, Hong Kong b

The data reveals the potential risk of dietary intake of endocrine-disrupting chemicals.

a r t i c l e i n f o

a b s t r a c t

Article history: Received 11 May 2009 Received in revised form 12 January 2010 Accepted 6 February 2010

In this study we aimed to assess the dioxin- and estrogen-like activities of contaminants extracted from twenty species of freshwater and seawater fishes, using luciferase reporter assays. Transfected MCF7 cells were treated with sample extracts and luciferase activities were then measured at 24-h of post-treatment. The mean values of the detected dioxin- and estrogen-like activities in the freshwater fishes were 25.3 pg TEQ/g ww and 102.3 pM EEQ/g ww whereas in the seawater fishes, the values were 46.2 pg TEQ/ g ww and 118.8 pM EEQ/g ww. Using sample-relevant dosage of estrogen, inductions of cell proliferation markers (i.e. retinoblastoma, cyclin D) and stimulations of cell growth were revealed by Western blotting, colony formation and BrdU uptake assays. A cotreatment with TCDD significantly reduced these effects. Using the sample extracts with different dioxin- and estrogen-like activities, similar observation was revealed. The data highlighted the mixture effect of food contaminants on human health. Ó 2010 Elsevier Ltd. All rights reserved.

Keywords: Luciferase MCF7 Real-time PCR Western blot Colony formation assay

1. Introduction The emission of environmental pollutants causes the contamination and deterioration of natural resources. Among the different types of environmental pollutants, chemical toxicants are known to impose potential risk to animal and human health via different mechanisms of action (Judson et al., 2009; Rhind, 2008; Wigle et al., 2008). Some of the chemical pollutants are known as endocrine disruptors (EDs) since their molecular structures are similar to the endogenous hormones and/or can interfere the associated receptormediated signaling cascade (Crews and McLachlan, 2006; DiamantiKandarakis et al., 2009). Endocrine-disrupting chemicals (EDCs) can affect the hormonal system via (but not limited to) estrogenic, androgenic, anti-androgenic and anti-thyroid mechanisms (Phillips et al., 2008; Phillips and Foster, 2008). With the benefit of hindsight, the endocrine disruptive effects of environmental contaminants have been shown to impose long-term effect on animal health and development (Anway et al., 2005; Dolinoy et al., 2007; Leranth et al., 2008). There are also evidences from animal and epidemiological studies to support the link of pollutant exposure to an

* Corresponding author at: Department of Biology, Hong Kong Baptist University, Kowloon, Hong Kong. Tel.: þ86 852 3411 7053; fax: þ86 852 3411 5995. E-mail address: [email protected] (C.K.C. Wong). 0269-7491/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.envpol.2010.02.006

increased incidence of human breast cancers (Brody et al., 2007; Dewailly et al., 1994; Mukherjee et al., 2006; Stripp et al., 2003). In the past 60 years, more than 80,000 synthetic chemical compounds have been made, and more than 3000 new chemicals are produced each year (Landrigan et al., 2002). Without doubt, these chemicals are ubiquitous and are dispersed in the air, water, soil and daily necessity. For the identification and quantification of all these contaminants, substantial labor and financial cost are required. In year 2000, however, only less than 7% of the synthetic chemical compounds were tested for their chronic and developmental toxicity (Goldman and Koduru, 2000). The biological effects of most chemicals unfortunately are therefore still largely unknown. As it is impractical to test every single compound from this large inventory of existing chemicals (Judson et al., 2009), there is a need to adopt a fast and an effective approach to screen the major biological/toxicological activities of food contaminants. With reference to the literatures, dioxin- and estrogen-like activities are two of the most common biological activities that can be detected in most EDs (Hotchkiss et al., 2008; McLachlan, 2001). Global environmental contaminants (i.e. dichlorodiphenyl- trichloroethane (DDT), hydroxylated polychlorinated biphenyls (PCBs), bisphenol A, p-nonylphenol & dioxins, perfluorinated compounds (PFOA) and flame retardant) and heavy metals (i.e. cadmium & mercury) can exhibit either or both dioxin- and estrogen-like activities (Maras et al., 2006; Martin et al., 2003; McLachlan, 2001; Meerts

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309

et al., 2001). As most of the released/disposed chemical pollutants finally get into water systems and are then accumulated and biomagnified in food chains, the most important route for human exposure to organic chemical pollutants is therefore via food consumption (Liem et al., 2000), contributing over 90% of total exposure in one's lifetime. In oceanic cities with heavy industrial activities, fish products made the greatest contribution to this exposure (Kannan et al., 1997). In this study, we evaluated the risk and the potential effects of EDCs to the health of coastal populations in the Pearl River Delta. We aimed to assess the dioxin- and estrogen-like activities of contaminants extracted from twenty species of freshwater and seawater fishes, using the in vitro luciferase reporter methods. According to the mean levels of the measured activities, the growth stimulating effects of the sample-equivalent doses of dioxin and estrogen as well as the sample extracts were investigated using the human breast carcinoma cells, MCF7. The data can be extrapolated to the possible health risk to people living in coastal cities with heavy industrial activities.

2303

transferred into a vial and evaporated to dryness under a stream of nitrogen. Samples were re-dissolved in 100 ml of dimethyl sulfoxide (DMSO) and were then used in different bioassays. 2.2. Sulforhodamine B (SRB) assay The human breast cancer cell-line, MCF7 (American Type Culture Collection) was grown in phenol red-free Dulbecco's Minimum Essential Medium (DMEM) supplemented with 10% charcoal-stripped fetal bovine serum (Hyclone), 50 U/ml penicillin and 50 mg/ml streptomycin (GIBCO/BRL) at a density of 2  104 cells per well in 96-well plates (Falcon). The cells were incubated in 5% CO2 at 37  C. After overnight incubation, the cells were exposed to the fish muscle extracts for 24, 48 and 72 h. After the exposure to the predetermined time intervals, MCF7 cells were fixed by adding 10% of cold trichloroacetic acid (Sigma) and were then kept at 4  C for 1 h. The culture plate was then washed with tap water and was air-dried at room temperature. The SRB assay was conducted according to the optimized protocol reported by Vichai and coworkers (Vichai and Kirtikara, 2006). In brief, SRB solution (0.057% w/v, Sigma) was added into each well of the culture plate and was then incubated at room temperature for 30 min. The plate was rinsed with 1% (v/v) acetic acid to remove unbound dye and was then air-dried at room temperature. Proteinbound SRB was solubilized in 10 mM Tris base solution (Sigma). OD was measured at 510 nm in a microplate reader (BioTek). 2.3. Plasmids

2. Materials and methods 2.1. Fish sample preparation Twenty species of freshwater and seawater fishes were purchased from the local markets in Hong Kong (Table 1). For each species, at least three individuals were collected for the study. Ventral muscles were dissected and freeze-dried. The samples were extracted as previously described (Cheung et al., 2007, 2008; Kong et al., 2005). Briefly the sample (1.5 g) was mixed with 50 ml of 1:1 dichloromethane: acetone, and was Soxhlet extracted in a shaking incubator at 40  C for 18 h. The organic phase was collected and was then concentrated using a rotary evaporator at 60  C until 2 ml of solution was left. The solution was cleaned up using a micro-florisil column with 10 ml of 1:1 dichloromethane:hexane as an elutant. The solution was then evaporated with a gentle stream of nitrogen until 5 ml of solvent was obtained. Of which, 1 ml of the solution was used for fat content measurement by solvent evaporation until a constant weight was obtained. The rest of 4 ml solution was further cleaned up by a gel permeation chromatography (GPC, Gilson) to remove residual fat tainted in the solvent. Six hundred ml of the extract was

Table 1 Fish species obtained from local markets in Hong Kong. Common name Freshwater fish Big head Carp Catfish Grass Carp Grey Mullet Mandarin Fish Mud Fish Rice field eel Snakehead Spotted Snakehead Tilapia Marine fish Bartail Flathead Bigeye Bleeker's Grouper Goldspotted rabbitfish Golden Threadfin Bream Orange-spotted grouper Snubnose Pompano Tongue Sole Yellow Croaker Yellowfin Seabream

Latin name

Aristichthys nobilis Claris fuscus Ctenopharyngodon idellus Mulgil cephalus Siniperca kneri Cirrhina molitorella Monopterus albus Channa asiatiea Channa maculate

Mean size (gram/cm) 1000/27.9 315.7/30.5 916.7/38 378.8/30.6 1518.5/42.7 413.6/28.0 201.3/38.0 253.6/28.8 450.0/31.6

Feeding mode

Filter feeder Carnivorous Herbivorous Bottom feeder Carnivorous Bottom feeder Carnivorous Carnivorous Carnivorous

Oreochromis ossambicus

436.4/25.8

Omnivorous

Platycephalus indicus Priacanthus acracanthus Epinephelus bleekeri Siganus punctatus

775.0/37.2 201.7/24.4 121.9/19.7 281.3/28.5

Bottom feeder Carnivorous Carnivorous Herbivorous

Nemipterus virgatus

500.0/29.76

Carnivorous

Epinephelus coioides

857.5/42.5

Carnivorous

Trachinotus blochii

409.4/26.5

Carnivorous

Cynoglossus robustus Pseudosciaena crocea Acanthopagrus latus

302.0/37.3 352.3/30.4 380.0/22.3

Bottom feeder Carnivorous Omnivorous

The pSG5.hERa containing an insert of the full-length cDNA clone of the human estrogen receptor-a (ERa) and the estrogen responsive element (ERE) reporter gene, pGL2-ERE-luciferase (Luc) were gifts from Dr. Calvin Lee (The University of Hong Kong). The pGL3-dioxin responsive element (DRE)-Luc reporter was constructed from pGL3-SV40-Luc (Promega) by inserting the PCR amplified segments (873/ 1392) of human CYP1A1 promoter using primers shown in Table 2. PCR amplification was conducted using a high-fidelity Taq DNA polymerase (Invitrogen) and the sequence of the insert was verified by DNA sequencing (Tech Dragon, Hong Kong). 2.4. Cell culture and the detection of DRE- and ERE-driven luciferase activities MCF7 cells were plated into 24-well tissue culture dishes at a density reaching 70e80% confluence by the time of transfection. The cells were grown in phenol redfree DMEM supplemented with 10 % charcoal-stripped fetal bovine serum. Transfection was performed using Lipofect AMINEÔ 2000 reagent (Invitrogen). For EREreporter assay, the pSG5.hERa and pGL2-ERE-luc (1:10) were cotransfected in MCF7 cells. For DRE-reporter assay, only the pGL3-DRE-luc was transfected into the cells. Six hours after the transfection, the medium was replaced by a complete medium and the cells were then incubated overnight in 5% CO2/95% air at 37  C. The transfected cells were either treated with an increasing dosage of E2 (10 fM e 100 pM, Sigma), 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) (0.39 pg/ml e 400 pg/ml) (Cambridge Isotope Laboratories, Inc.), DMSO (solvent control), or fish sample extracts for 24 h. The cells were then lysed in a passive lysis buffer (Promega) for luciferase assays. Twenty microliters of the supernatant was used to determine the luciferase activities, using the Luciferase reporter assay system (Promega) and an InfiniteÔ F200 luminometer (TECAN). 2.5. Real-time and Western blot analysis MCF7 cells were plated at a density of 1  105 per well of 12-well plates and were treated with the sample-equivalent dosages of E2 (110 pM) and/or TCDD (35 pg/ml), as measured in the in vitro reporter assays for the fish sample extracts. The treated cells were washed with 2e3 changes of cold PBS. Adherent cells were either extracted with TRIZOL reagent (Invitrogen) for real-time PCR assay or scraped in a cold lysis buffer (250 mM Tris/HCl, pH 8.0, 1% NP-40 and 150 mM NaCl) for Western blotting. The cell lysates were pelleted and the supernatants were assayed for protein concentration (DC Protein Assay Kit II, Bio-Rad Pacific Ltd). For real-time PCR assay, total RNA with A260/A280 ratio between 1.6 and 1.8 was used in the study. Complementary DNA (cDNA) was synthesized from 1 mg of total cellular RNA using the iScriptÔ cDNA synthesis kit (Bio-Rad). Real-time PCR was conducted with the condition of 95 C for 3 min and 40 cycles of 95 C for 30 s, 56 C for 30 s and 72 C for 1 min. The primers were designed on the basis of the published sequence of human trefoil factor-1 (pS2/TFF1) [ATGGAGAAC AAGGTGATCTGCG-forward and GCCACTGTACACGTCTCTGTC-reverse], human

Table 2 Primers used for the amplification of regions of DRE from the upstream promoter of the human CYP1A1. Amplicon

Construct

Forward primer (50 e30 )

Reverse primer (50 e30 )

1

pGL3-DRESV40

ccggctagcttgcgtgcgcc

gccaggttgagctaggcacgcaaat

2304

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309

cyclooxygenase-2 (Cox-2) [TCTCCTATTATACTAGAGCCCTTC-forward and TCCA CAATCTCATTTGAATCAGG-reverse], human cytochrome P4501A1 (CYP1A1) [AGTTTCTC CATTGCCTCTGAC-forward and GATACCACCACATACCTGTAGG-reverse] and actin [GACTACCTCATGAAGATCCTCACC-forward & TCTCCTTAATGTCACGCACGATT-reverse]. Quantitated standards and sample cDNAs were analyzed with the iCycler iQ real-time PCR detection system using iQÔ SYBRÒ Green Supermix (BioRad). The copy number for each sample was calculated and all the data were normalized to actin. The occurrence of primer-dimers and secondary products were inspected using melting curve analysis. Control amplifications were done either without RT or without RNA. All glass- and plastic-ware were treated with diethyl pyrocarbonate and autoclaved. For Western blotting, samples were subjected to electrophoresis in 10% polyacrylamide gels. Gels were blotted onto PVDF membranes (PerkinElmer Life Sciences). Western blot was conducted using rabbit antibody to human phosphorylated retinoblastoma (Rb) (Cell signaling TechnologyÒ) or mouse antibody to human cyclin D (Cell Signaling TechnologyÒ), followed by an incubation with horseradish peroxidase-conjugated goat anti-rabbit or anti-mouse antibody (Bio-Rad). Specific bands were visualized with chemiluminescent reagents (Western-lightening Plus, PerkinElmer Life Sciences). Blots were then washed in PBS and re-probed with rabbit anti-actin serum (Sigma). 2.6. Colony formation assay MCF7 cells were plated at a density of 5  102 cells in each well of a 6-well plate and were treated with an equivalent dosage of estrogen (110 pM) and/or TCDD (35 pg/ml), as determined in the in vitro reporter assays for fish sample extracts. The culture and the drugs were changed every other day. After 14 days of incubation, cells were washed, fixed with absolute methanol for 15 min at 20 C, and incubated for 15 min at room temperature with crystal violet (Sigma) in 25% methanol, then photographed. The number of cell colonies was scored as sensitivity to the respective treatment. 2.7. Cell proliferation assay Growth of MCF7 cells treated with estrogen/TCDD or fish muscle extracts were determined by using DELFIAÒ cell proliferation kit (PerkinElmer). MCF7 cells were plated in triplicate in 96-well plates in the phenol red-free medium, supplemented with 10 % charcoal-stripped fetal bovine serum. After overnight incubation, the cells were exposed either estrogen/TCDD or sample extracts for 24 h. Six hours before measurement, the cells were incubated with BrdU labeling solution. Fluorescent signal was measured using a multilabel reader VICTORÔ X4 (PerkinElmer). 2.8. Statistical analysis All data were presented as mean  standard deviation. Variation in estrogenand TCDD-induced transcript levels of pS2/TFF1, Cox-2 and CYP1A1 as well as the data from the colony formation assay were tested by one-way ANOVA followed by Duncan's Multiple Range Test. The level of significance was set at P value < 0.05.

3. Results In detecting the presence of dioxin- and estrogen-like contaminants from the extracts of fish samples, we adopted two in vitro luciferase reporter assays for the measurement. In the screening of dioxin-like contamination, we cloned the dioxin responsive element (DRE) from the promoter of human CYP1A1 gene into pGL3-SV40luciferase vector. To test the responsiveness of the cloned cis-acting element, the DRE containing vector was transfected into MCF7 cells. A dose dependent induction of DRE-driven luciferase activities were measured with an increasing dosage of TCDD (0.39e400 pg/ml, r ¼ 0.98) (Fig. 1A). From the lowest to the highest doses of TCDD treatment, there was about 36-fold induction of the detected luciferase activity. Using the DRE-Luc reporter assay, we screened the dioxin-like activities in the fish muscle extracts from 10 freshwater (6.96e53.3 pg TEQ/g wet weight (ww)) and 10 seawater fishes (below the detection limit e 116.1 pg TEQ/g ww) collected from the local fish markets (Fig. 1BeC). The data indicated that most of the fish samples contained detectable dioxin-like activities. The mean and median TEQ values of freshwater fishes were 25.3 and 12.66 pg TEQ/ g ww whereas values of 46.2 and 23 pg TEQ/g ww were detected in the seawater fishes (Table 3A). In the measurement of the estrogenic activities from the fish muscle extracts, an ERE-Luc reporter assay was conducted. Fig. 2, A shows the doseeresponse curve of ERE-Luc

activities induced by E2 (0.1e100 pM, r ¼ 0.95) in MCF7 cells. In this assay, the maximum fold of induction was about 6.5. In the screening of the fish samples, estrogen-equivalent (EEQ) activities measured from the muscle extracts of the freshwater and seawater fishes were 29.51e167.2 pM EEQ/g ww and 91.15e158.4 pM EEQ/g ww, respectively (Fig. 2BeC). The mean and median estrogenic activities detected in freshwater fishes were 102.3 and 51.17 pM EEQ/g ww whereas in seawater fishes, the values were 118.8 and 59.41 pM EEQ/ g ww respectively (Table 3B). Because there was a great variation in the fat contents (0.46e27.4%) of different species of freshwater and seawater fishes, in the present study the detected dioxin- and estrogen-like activities were expressed per sample fresh weight as suggested by other study (Bignert et al., 2007), in order to reflect the actual amount of the contamination in the fishes. Throughout the treatment, no noticeable increase of cell mortality was observed as revealed by SRB assay (data not shown). With reference to the measured dioxin-like and estrogenicequivalent values, we conducted experiments to test the effects of TCDD and/or estrogen to the proliferation of MCF7 cells. The mean concentration of 35 pg/ml (for TCDD) and 110 pM (for estrogen) were used for the experiments. Real time PCR analysis revealed that estrogen treatment stimulated the expression levels of both pS2/TFF-1 and Cox-2 mRNA (Fig. 3A). TCDD significantly stimulated the expression of CYP1A1 mRNA, but had no significant effect on the transcript levels of pS2/TFF-1 and Cox-2. Western blot analysis elucidated that estrogen treatment significantly increased the level of phosphorylated Rb and cyclin D (Fig. 3B, left panel). Concomitant with this, data from the colony formation assay (Fig. 3B, right panel) supports the notion that the sampleequivalent dose of estrogen could stimulate cell proliferation. The estrogen-stimulated cell proliferation was significantly reduced by TCDD cotreatment, probably via the reduction of phosphorylated Rb levels. To illustrate if the measured estrogenic activities in fish muscle extracts can cause cell proliferation, a sensitive assay for the measurement of BrdU incorporation during DNA synthesis was adopted. Fig. 4 demonstrated the fish muscle extracts with higher measured estrogenic activity and lower dioxin-like activity that showed high potency to induce cell proliferation. 4. Discussion In the past century, over 100,000 of synthetic compounds have been produced and are present around us everywhere (i.e. air, soil, water and even daily necessity). Many of these have been identified with ED activities that can interfere with the cell signaling system and epigenetic reprogramming at low dose (Skinner, 2008). This more in-depth understanding led to a conceptual shift where we traditionally only measured the damaging effects to cells and tissues as the standard end-point (Calabrese and Baldwin, 2003). Numerous studies have now demonstrated the subtle functional disabilities in animals following ED exposure, hence proving the hijacking effect of EDC's on cellular messenger systems (Anway et al., 2005; Anway and Skinner, 2008; Dolinoy et al., 2007; Leranth et al., 2008). Even more striking is the finding that these disabilities may be inherited to the next generations. Among the biological activities of EDCs, pollutants that possess dioxin- and/or estrogen-like activities are known to have significant effect on animals (Hotchkiss et al., 2008; McLachlan, 2001). The most toxic man-made pollutant e dioxins, are known to impose biological effects via (but not limited to) the aryl hydrocarbon receptor (AHR), which exhibits its transcriptional activity primarily via ligand-dependent nuclear translocation (Mimura and Fujii-Kuriyama, 2003). Other AHR mediated regulatory functions include the modulation of other transcriptional factors, including Rb/ E2F, NFkB and the estrogen (ERa and ERb) and androgen receptors (Beischlag and Perdew, 2005; Matthews et al., 2005; Ohtake et al.,

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309

2305

Fig. 1. The dioxin-like activities of the fish muscle extracts measured using the MCF7/DRE-Luc cells. (A) Induction of luciferase activities by 2,3,7,8-TCDD (0.39e400 pg/ml) in MCF7 cells after 24 h of post-treatment. (B) The dioxin-like activity of muscle extracts from the 10 species of freshwater fishes. (C) The dioxin-like activity of muscle extracts from the 10 species of seawater fishes.

2003, 2007; Puga et al., 2000; Vogel et al., 2007; Wormke et al., 2003). Comparable to the dioxin/AHR mediated actions, contaminants that possess estrogen and/or anti-estrogen activities also demonstrated striking effects on animals, showing the power of estrogen in environmental signaling (McLachlan, 2001). This is

Table 3A TCDD-TEQ values in fish samples from Hong Kong Markets.

FW SW

Minimal Value (pg TEQ/g ww)

Maximal Value (pg TEQ/g ww)

Mean (pg TEQ/g ww)

Median (pg TEQ/g ww)

6.96 bdl

53.3 116.1

25.3 46.2

12.66 23.01

Bdl: below detection limits(0.8 pg TEQ/g ww).

particularly true when we look at it from an evolutionary perspective where the DNA-binding domain and the ligand-binding domain of estrogen receptor-a (ERa) are conserved across metazoans (McLachlan, 1993; Thornton et al., 2003). In the present study, we measured the contaminated levels of dioxin- and estrogen-like activities of muscle extracts from 20 species of freshwater and seawater fishes, all of them are frequently consumed food items in Hong Kong. The detection limit of the DRE-Luc reporter in this study is comparable to the CALUX bioassay (0.1 pg/g of sample) and H411E-luc assay (0.64 pg/ml) illustrated in other studies (Jiang et al., 2005; Schoeters et al., 2004) while the sensitivity of the ERE-luc assay is comparable to the one reported by Meerts and coworkers (Meerts et al., 2001), ranging from 0.1 pM to 100 pM of estrogen. In the present study, TCDD-TEQ values were

2306

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309

Fig. 2. The estrogenic activities of the fish muscle extracts measured using the MCF7/ERE-Luc cells. (A) Induction of luciferase activities by estrogen (E2, 0.01 pMe100 pM) in MCF7 cells after 24 h of post-treatment. (B) The estrogenic activity of muscle extracts from the 10 species of freshwater fishes. (C) The estrogenic activity of muscle extracts from the 10 species of seawater fishes.

detectable in almost all samples of market-ready fishes, with higher concentrations generally being found in carnivorous fishes and bottom feeders. Extracts of fish muscles with dioxin-like activities below limit of detection (around 0.8 pg TEQ/g ww) were only found in yellow croaker, a carnivorous marine fish from cultured farms. The wild seabream samples from Hong Kong markets contained higher dioxin-like activities (41.4 pg TEQ/g ww) than the same species from the UK market, which is about 1.5 pg TEQ/g ww, as reported by Food Standards Agency (2006). For the measurement of estrogenic activity, our data revealed that the

Table 3B Estrogenic Activities in fish samples from Hong Kong Markets.

FW SW

Minimal Value (pM EEQ/g ww)

Maximal Value (pM EEQ/g ww)

Mean (pM EEQ/g ww)

Median (pM EEQ/g ww)

29.51 91.15

167.2 158.4

102.3 118.8

51.17 59.41

measurable levels in the samples were in the range from 29.51 pM EEQ/g ww and 167.2 pM EEQ/g ww. The median value of estrogenicity detected in freshwater fish muscle extracts from Hong Kong market (51.17 pM EEQ/g ww) was considerably higher than that collected from European mountain lakes (0.7e11 pM EEQ/g ww) (Garcia-Reyero et al., 2007). No prevalence in the estrogenicity was detected among the carnivorous, herbivorous and other species of fishes, suggesting that the species diversity did not pose any influence on the concentration of estrogenic contaminants in the fish muscle extracts. The incidence of breast cancer has increased significantly in the past 60 years (Brody et al., 2007; Mukherjee et al., 2006). Many research groups have suggested that the increased cases may have been influenced by environmental factors (Brody et al., 2007; Laden et al., 2001; Mukherjee et al., 2006). Estrogen exposure is one of the major risk factors known to lead to the initiation and promotion of breast cancers (Parl et al., 2009; Yamaguchi and Hayashi, 2009). Fish consumption is known to be a major pathway for the exposure

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309

A

E2 + TCDD

E2 + TCDD

b a

TCDD

a b

TCDD

E2 c

E2

Ctrl c

Ctrl

2307

a b

0 100 200 300 400 500 600

0 2 4 6 8 10 12 14 16 18

Level of CYP1A1 mRNA

Level of Cox-2 mRNA

E2 + TCDD

a

TCDD

b a

E2 b

Ctrl

0

2

4

6

8

10 12

Level of pS2/TFF1 mRNA

Ct rl

TC TC E2 + D D D D 2

E

Phosphorylated Rb (Ser 807/811) cyclin D actin

Number of colonies

B 800

a b

b

600

c

400 200 0

Ctrl

E2 TCDD E2 + TCDD

Fig. 3. Effect of the sample-equivalent dosages of estrogen (E2) and 2,3,7,8-TCDD to the expression of the growth of MCF7 cells. MCF7 cells were treated with (i) E2 (110 pM), (ii) TCDD (35 pg/ml) and (iii) E2 þ TCDD for 24 h. (A) Total RNA was extracted for real-time PCR assay for the measurement of CYP1A1, Cox-2 and pS2/TFF1transcript levels. (B) Total cell lysates were used for Western blotting to determine the expression levels of phosphorylated Rb and cyclin D (left panel). The right panel shows the number of the colonyforming units in MCF7 cells treated with estrogen and/or TCDD. Bars with the same letter are not significantly different according to the results of one-way ANOVA followed by Duncan's multiple range test (p < 0.05).

to chemical pollutants (Brustad et al., 2008; Dovydaitis, 2008; Genuis, 2008). Stripp and coworkers reported a positive association between fish intake with the rate of breast cancer (Stripp et al., 2003). A positive correlation was also established between the frequencies of fish consumption to body loading of chemical pollutants (i.e. organochlorine pesticides and PCBs) (Kannan et al., 1997; Wong et al., 2002), as well as the body burden of DDT or DDE to ER þ breast tumors (Dewailly et al., 1994). Hong Kong was ranked 6th in global fish consumption (WWF, 1999; ECP, 2000) and was reported to have the highest breast cancer incidence in Asia (Leung et al., 2002). In the present study, our data revealed that the fish muscles contained the mean dioxin-like activity of 35 pg TEQ/g ww and the estrogenic activity of 110 pM EEQ/g ww. Using these mean levels as the reference, we tested their individual and combined effects to the proliferation of the human breast cancer cells, MCF7. Real-time PCR analysis revealed that estrogen treatment induced the expression of the trefoil factor 1 (pS2/TFF1) and cyclooxygenase 2 (Cox-2) in MCF7 cells. Both pS2/TFF1 and Cox-2 are known to

stimulate cell proliferation and/or invasiveness of breast tumor cells (Burdette and Woodruff, 2007; Eltarhouny et al., 2008; Robertson et al., 2007). Western blot analysis revealed the upregulation of cell cycle progression markers, phosphorylated Rb and cyclin D in the estrogen treated cells. Colony formation assay and cell proliferation assay demonstrated that the sample-equivalent dose of estrogen stimulated the proliferation of the cells. In the cotreatment study, our data demonstrated that TCDD inhibited estrogen-mediated cell proliferation via the reduction in phosphorylated Rb. This observation mirrors those from a previous report, which indicated the growth inhibitory effect of dioxins to mammary tumors in rodents (Safe et al., 2000). These effects can also be observed in fish muscle extracts with different levels of estrogenic and dioxin-like activities. The data implied that the animal developmental and health effects imposed by exogenous estrogen can be compounded by the co-existence of dioxin contamination, thus highlighting the importance of investigating the mixture effect of chemical pollutants.

2308

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309

E2 (100pM) TCDD (35pg/ml) E2 + TCDD samples

1.8

1.4 1.2 1.0

.6 60 140

120

100

40 20

80

60 Estro 40 gen (pM E ic activity eq/g w w)

20

0

0

g

160

TE Q

180

ww )

140 120 100 80

.8

(p g/

Rate Cell Proliferation

1.6

Fig. 4. Effect of estrogen, TCDD and the fish muscle extracts to the proliferation of MCF7 cells. MCF7 cells were treated with (i) E2 (110 pM), (ii) TCDD (35 pg/ml), (iii) E2 þ TCDD or (iv) the fish muscle extracts for 24 h. The levels of BrdU incorporation during DNA synthesis in MCF7 cells were measured. The data illustrated that the fish muscle extracts with higher estrogenic activity and lower dioxin-like activity showed high potency to induce cell proliferation.

The present study reported the use of a battery of bioassays to investigate the endocrine disrupting activities, cytotoxicity and the cellular effects of fish samples. This approach provides a fast screening platform for a cost-effective routine measurement of potentially contaminated fish samples. It is particularly important for the monitoring fishery products harvested from polluted coastal areas. Without doubt, it can help to restrict the chemical analysis to highly contaminated samples and consequently reduce the cost and sample loads for chemical analysis. With respect to the data of the bioassays, subsequent chemical analysis can be conducted for further characterization of the contaminants. Although the connection between pollutant exposure and breast cancer risk has not been conclusive, it definitely warrants further investigation of their possible correlation. Acknowledgements This work was supported by the Super Faculty Research Grant, Hong Kong Baptist University (CKC Wong) and Collaborative Research Fund (HKBU 1/CRF/08), University Grants Committee (CKC Wong). References Anway, M.D., Cupp, A.S., Uzumcu, M., Skinner, M.K., 2005. Epigenetic transgenerational actions of endocrine disruptors and male fertility. Science 308, 1466e1469. Anway, M.D., Skinner, M.K., 2008. Epigenetic programming of the germ line: effects of endocrine disruptors on the development of transgenerational disease. Reprod. Biomed. Online 16, 23e25. Beischlag, T.V., Perdew, G.H., 2005. ER alpha-AHR-ARNT proteineprotein interactions mediate estradiol-dependent transrepression of dioxin-inducible gene transcription. J. Biol. Chem. 280, 21607e21611. Bignert, A., Nyberg, E., Sundqvist, K.L., Wiberg, K., 2007. Spatial variation in concentrations and patterns of the PCDD/F and dioxin-like-PCB content in herring from the northern Baltic Sea. J. Environ. Monit. 9, 550e556. Brody, J.G., Moysich, K.B., Humblet, O., Attfield, K.R., Beehler, G.P., Rudel, R.A., 2007. Environmental pollutants and breast cancer: epidemiologic studies. Cancer 109, 2667e2711.

Brustad, M., Sandanger, T.M., Nieboer, E., Lund, E., 2008. 10th anniversary review: when healthy food becomes polluted-implications for public health and dietary advice. J. Environ. Monit. 10, 422e427. Burdette, J.E., Woodruff, T.K., 2007. Activin and estrogen crosstalk regulates transcription in human breast cancer cells. Endocr. Relat. Cancer 14, 679e689. Calabrese, E.J., Baldwin, L.A., 2003. Toxicology rethinks its central belief. Nature 421, 691e692. Cheung, K.C., Leung, H.M., Kong, K.Y., Wong, M.H., 2007. Residual levels of DDTs and PAHs in freshwater and marine fish from Hong Kong markets and their health risk assessment. Chemosphere 66, 460e468. Cheung, K.C., Zheng, J.S., Leung, H.M., Wong, M.H., 2008. Exposure to polybrominated diphenyl ethers associated with consumption of marine and freshwater fish in Hong Kong. Chemosphere 70, 1707e1720. Crews, D., McLachlan, J.A., 2006. Epigenetics, evolution, endocrine disruption, health, and disease. Endocrinology 147, S4eS10. Dewailly, E., Dodin, S., Verreault, R., Ayotte, P., Sauve, L., Morin, J., Brisson, J., 1994. High organochlorine body burden in women with estrogen receptor-positive breast cancer. J. Natl. Cancer Inst. 86, 232e234. Diamanti-Kandarakis, E., Bourguignon, J.P., Giudice, L.C., Hauser, R., Prins, G.S., Soto, A.M., Zoeller, R.T., Gore, A.C., 2009. Endocrine-disrupting chemicals: an endocrine society scientific statement. Endocr. Rev. 30, 293e342. Dolinoy, D.C., Huang, D., Jirtle, R.L., 2007. Maternal nutrient supplementation counteracts bisphenol A-induced DNA hypomethylation in early development. Proc. Natl. Acad. Sci. U S A 104, 13056e13061. Dovydaitis, T., 2008. Fish consumption during pregnancy: an overview of the risks and benefits. J. Midwifery Womens Health 53, 325e330. ECP (Earth Trends Country Profiles). Coastal and marine ecosystems-Hong Kong, 2000. http://earthtrends.wri.org/pdf_library/country_profiles/coa_cou_344.pdf. Eltarhouny, S.A., Elsawy, W.H., Radpour, R., Hahn, S., Holzgreve, W., Zhong, X.Y., 2008. Genes controlling spread of breast cancer to lung “gang of 4”. Exp. Oncol. 30, 91e95. Garcia-Reyero, N., Grimalt, J.O., Vives, I., Fernandez, P., Pina, B., 2007. Estrogenic activity associated with organochlorine compounds in fish extracts from European mountain lakes. Environ. Pollut. 145, 745e752. Genuis, S.J., 2008. To sea or not to sea: benefits and risks of gestational fish consumption. Reprod. Toxicol. 26, 81e85. Goldman, L.R., Koduru, S., 2000. Chemicals in the environment and developmental toxicity to children: a public health and policy perspective. Environ. Health Perspect. 108 (Suppl. 3), 443e448. Hotchkiss, A.K., Rider, C.V., Blystone, C.R., Wilson, V.S., Hartig, P.C., Ankley, G.T., Foster, P.M., Gray, C.L., Gray, L.E., 2008. Fifteen years after “Wingspread”eenvironmental endocrine disrupters and human and wildlife health: where we are today and where we need to go. Toxicol. Sci. 105, 235e259. Jiang, Q.T., Lee, T.K., Chen, K., Wong, H.L., Zheng, J.S., Giesy, J.P., Lo, K.K., Yamashita, N., Lam, P.K., 2005. Human health risk assessment of organochlorines associated with fish consumption in a coastal city in China. Environ. Pollut. 136, 155e165. Judson, R., Richard, A., Dix, D.J., Houck, K., Martin, M., Kavlock, R., Dellarco, V., Henry, T., Holderman, T., Sayre, P., Tan, S., Carpenter, T., Smith, E., 2009. The toxicity data landscape for environmental chemicals. Environ. Health Perspect. 117, 685e695. Kannan, K., Tanabe, S., Giesy, J.P., Tatsukawa, R., 1997. Organochlorine pesticides and polychlorinated biphenyls in foodstuffs from Asian and oceanic countries. Rev. Environ. Contam. Toxicol. 152, 1e55. Kong, K.Y., Cheung, K.C., Wong, C.K., Wong, M.H., 2005. Residues of DDTs, PAHs and some heavy metals in fish (Tilapia) collected from Hong Kong and mainland China. J. Environ. Sci. Health A Tox. Hazard. Subst. Environ. Eng. 40, 2105e2115. Laden, F., Collman, G., Iwamoto, K., Alberg, A.J., Berkowitz, G.S., Freudenheim, J.L., Hankinson, S.E., Helzlsouer, K.J., Holford, T.R., Huang, H.Y., Moysich, K.B., Tessari, J.D., Wolff, M.S., Zheng, T., Hunter, D.J., 2001. 1,1-Dichloro-2, 2-bis(pchlorophenyl)ethylene and polychlorinated biphenyls and breast cancer: combined analysis of five U.S. studies. J. Natl. Cancer Inst. 93, 768e776. Landrigan, P.J., Schechter, C.B., Lipton, J.M., Fahs, M.C., Schwartz, J., 2002. Environmental pollutants and disease in American children: estimates of morbidity, mortality, and costs for lead poisoning, asthma, cancer, and developmental disabilities. Environ. Health Perspect. 110, 721e728. Leranth, C., Hajszan, T., Szigeti-Buck, K., Bober, J., MacLusky, N.J., 2008. Bisphenol A prevents the synaptogenic response to estradiol in hippocampus and prefrontal cortex of ovariectomized nonhuman primates. Proc. Natl. Acad. Sci. U S A 105, 14187e14191. Leung, G.M., Thach, T.Q., Lam, T.H., Hedley, A.J., Foo, W., Fielding, R., Yip, P.S., Lau, E. M., Wong, C.M., 2002. Trends in breast cancer incidence in Hong Kong between 1973 and 1999: an age-period-cohort analysis. Br. J. Cancer 87, 982e988. Liem, A.K., Furst, P., Rappe, C., 2000. Exposure of populations to dioxins and related compounds. Food Addit. Contam. 17, 241e259. Maras, M., Vanparys, C., Muylle, F., Robbens, J., Berger, U., Barber, J.L., Blust, R., De Coen, W., 2006. Estrogen-like properties of fluorotelomer alcohols as revealed by mcf-7 breast cancer cell proliferation. Environ. Health Perspect. 114, 100e105. Martin, M.B., Reiter, R., Pham, T., Avellanet, Y.R., Camara, J., Lahm, M., Pentecost, E., Pratap, K., Gilmore, B.A., Divekar, S., Dagata, R.S., Bull, J.L., Stoica, A., 2003. Estrogen-like activity of metals in MCF-7 breast cancer cells. Endocrinology 144, 2425e2436. Matthews, J., Wihlen, B., Thomsen, J., Gustafsson, J.A., 2005. Aryl hydrocarbon receptor-mediated transcription: ligand-dependent recruitment of estrogen

X. Wei et al. / Environmental Pollution 158 (2010) 2302e2309 receptor alpha to 2,3,7,8-tetrachlorodibenzo-p-dioxin-responsive promoters. Mol. Cell Biol. 25, 5317e5328. McLachlan, J.A., 1993. Functional toxicology: a new approach to detect biologically active xenobiotics. Environ. Health Perspect. 101, 386e387. McLachlan, J.A., 2001. Environmental signaling: what embryos and evolution teach us about endocrine disrupting chemicals. Endocr. Rev. 22, 319e341. Meerts, I.A., Letcher, R.J., Hoving, S., Marsh, G., Bergman, A., Lemmen, J.G., van der, B. B., Brouwer, A., 2001. In vitro estrogenicity of polybrominated diphenyl ethers, hydroxylated PDBEs, and polybrominated bisphenol A compounds. Environ. Health Perspect. 109, 399e407. Mimura, J., Fujii-Kuriyama, Y., 2003. Functional role of AhR in the expression of toxic effects by TCDD. Biochim. Biophys. Acta 1619, 263e268. Mukherjee, S., Koner, B.C., Ray, S., Ray, A., 2006. Environmental contaminants in pathogenesis of breast cancer. Indian J. Exp. Biol. 44, 597e617. Ohtake, F., Baba, A., Takada, I., Okada, M., Iwasaki, K., Miki, H., Takahashi, S., Kouzmenko, A., Nohara, K., Chiba, T., Fujii-Kuriyama, Y., Kato, S., 2007. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature 446, 562e566. Ohtake, F., Takeyama, K., Matsumoto, T., Kitagawa, H., Yamamoto, Y., Nohara, K., Tohyama, C., Krust, A., Mimura, J., Chambon, P., Yanagisawa, J., FujiiKuriyama, Y., Kato, S., 2003. Modulation of oestrogen receptor signalling by association with the activated dioxin receptor. Nature 423, 545e550. Parl, F.F., Dawling, S., Roodi, N., Crooke, P.S., 2009. Estrogen metabolism and breast cancer: a risk model. Ann. N.Y. Acad. Sci. 1155, 68e75. Phillips, K.P., Foster, W.G., 2008. Key developments in endocrine disrupter research and human health. J. Toxicol. Environ. Health B Crit. Rev. 11, 322e344. Phillips, K.P., Foster, W.G., Leiss, W., Sahni, V., Karyakina, N., Turner, M.C., Kacew, S., Krewski, D., 2008. Assessing and managing risks arising from exposure to endocrine-active chemicals. J. Toxicol. Environ. Health B Crit. Rev. 11, 351e372. Puga, A., Barnes, S.J., Dalton, T.P., Chang, C., Knudsen, E.S., Maier, M.A., 2000. Aromatic hydrocarbon receptor interaction with the retinoblastoma protein potentiates repression of E2F-dependent transcription and cell cycle arrest. J. Biol. Chem. 275, 2943e2950. Rhind, S.M., 2008. Endocrine disruptors and other food-contaminating environmental pollutants as risk factors in animal reproduction. Reprod. Domest. Anim. 43 (Suppl. 2), 15e22. Robertson, F.M., Mallery, S.R., Bergdall-Costell, V.K., Cheng, M., Pei, P., Prosperi, J.R., Ferrari, M., 2007. Cyclooxygenase-2 directly induces MCF-7 breast tumor cells

2309

to develop into exponentially growing, highly angiogenic and regionally invasive human ductal carcinoma xenografts. Anticancer Res. 27, 719e727. Safe, S., Wormke, M., Samudio, I., 2000. Mechanisms of inhibitory aryl hydrocarbon receptor-estrogen receptor crosstalk in human breast cancer cells. J. Mammary Gland. Biol. Neoplasia 5, 295e306. Schoeters, G., Goyvaerts, M.P., Ooms, D., Van Cleuvenbergen, R., 2004. The evaluation of dioxin and dioxin-like contaminants in selected food samples obtained from the Belgian market: comparison of TEQ measurements obtained through the CALUX bioassay with congener specific chemical analyses. Chemosphere 54, 1289e1297. Skinner, M.K., 2008. What is an epigenetic transgenerational phenotype? F3 or F2. Reprod. Toxicol. 25, 2e6. Stripp, C., Overvad, K., Christensen, J., Thomsen, B.L., Olsen, A., Moller, S., Tjonneland, A., 2003. Fish intake is positively associated with breast cancer incidence rate. J. Nutr. 133, 3664e3669. Thornton, J.W., Need, E., Crews, D., 2003. Resurrecting the ancestral steroid receptor: ancient origin of estrogen signaling. Science 301, 1714e1717. Vichai, V., Kirtikara, K., 2006. Sulforhodamine B colorimetric assay for cytotoxicity screening. Nat. Protoc. 1, 1112e1116. Vogel, C.F., Sciullo, E., Li, W., Wong, P., Lazennec, G., Matsumura, F., 2007. RelB, a new partner of aryl hydrocarbon receptor-mediated transcription. Mol. Endocrinol. 21, 2941e2955. Wigle, D.T., Arbuckle, T.E., Turner, M.C., Berube, A., Yang, Q., Liu, S., Krewski, D., 2008. Epidemiologic evidence of relationships between reproductive and child health outcomes and environmental chemical contaminants. J. Toxicol. Environ. Health B Crit. Rev. 11, 373e517. Wong, C.K., Leung, K.M., Poon, B.H., Lan, C.Y., Wong, M.H., 2002. Organochlorine hydrocarbons in human breast milk collected in Hong Kong and Guangzhou. Arch. Environ. Contam. Toxicol. 43, 364e372. Wormke, M., Stoner, M., Saville, B., Walker, K., Abdelrahim, M., Burghardt, R., Safe, S., 2003. The aryl hydrocarbon receptor mediates degradation of estrogen receptor alpha through activation of proteasomes. Mol. Cell Biol. 23, 1843e1855. WWF, 1999. Hong Kong Ranked 6th in global fish consumption in the WWF (World Wide Fund for nature Hong Kong) living planet report. www.wwf.org.hk/eng/ pdf/references/pressreleases_hongkong/prhk090999.pdf. Yamaguchi, Y., Hayashi, S., 2009. Estrogen-related cancer microenvironment of breast carcinoma. J. Endocr. 56, 1e7.