- Email: [email protected]
The effect of Helicobacter pylori on neutrophil chemotaxis is independent of cagA
FEMS Immunology and Medical Microbiology 24 (1999) 209^213
The e¡ect of Helicobacter pylori on neutrophil chemotaxis is independent of cagA Yakut Akyo«n *, Gulsen Hascelik Hacettepe University, Medical Faculty, Department of Clinical Microbiology and Microbiology, Sihhiye, 06100 Ankara, Turkey Received 25 November 1998 ; accepted 18 February 1999
Abstract Sixteen Helicobacter pylori strains were studied in order to determine their neutrophil chemotactic activity and the association with the presence cagA gene. Neutrophil chemotactic activity was detected by a modified Boyden chamber method and the results were expressed in terms of chemotactic index (CI). The presence of cagA was determined by PCR. Of the 16 strains, eight were cagA and eight were cagA3 . All of the isolated strains showed chemotactic activity. The mean value of CI of the patient group was significantly higher than the negative control (P 6 0.01). The mean value of CI of zymosan-activated serum (P 6 0.05) and the reference strain H. pylori NCTC 11637 (HP11637) (P 6 0.01) was significantly higher than the patient group's mean value of CI. There were no statistical significance in the CI between cagA and cagA3 strains (P s 0.05). It is concluded that H. pylori attracts neutrophils by chemotaxis, however, there is no association with cagA. ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Helicobacter pylori; cagA; Neutrophil chemotaxis; Duodenal ulcer; Gastritis
1. Introduction Helicobacter pylori is the aetiological agent inducing chronic gastric in£ammation and peptic ulcer and plays a major role in gastric cancer and MALT lymphomas. The pathogenesis of the tissue damage in chronic gastritis and peptic ulcer is un-
* Corresponding author. Tel.: +90 (312) 311 47 52; Fax: +90 (312) 311 52 50.
known, but toxic oxidative metabolites from neutrophils may play a role. Neutrophils are attracted by a variety of stimuli and this induces a chemotactic response which play an important role in the immunopathology associated with gastroduodenal H. pylori infection [1,2]. The cytotoxin-associated gene (cagA) has now been identi¢ed as a virulence marker because of its strong association with the vacuolating cytotoxin (VacA) of this organism. cagA strains have been shown to be more virulent, but it is not known whether this results in an increase in chemotaxis [3]. The aim of this study was to investigate the chemotactic e¡ect of H. pylori on neutrophils and the association with cagA.
0928-8244 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 9 2 8 - 8 2 4 4 ( 9 9 ) 0 0 0 2 8 - 0
FEMSIM 1019 6-5-99
210
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
2. Materials and methods
2.3. Preparation of H. pylori supernatants
2.1. Patients
The reference strain and all the H. pylori strains were subcultured for 3 days as described above. H. pylori strains were harvested after 72 h into 3 ml BHI broth+10% foetal calf serum to a concentration of 1.2U109 CFU ml31 and centrifuged for 20 min at 4000 rpm. The supernatants were sterile-¢ltered through a 0.22 Wm Millipore membrane ¢lter and used as test chemoattractants.
Sixteen H. pylori strains were isolated from eight females and eight males. The age range was 11^57 years (mean: 36.1). The age, sex distribution and endoscopic diagnosis of the 16 patients are shown in Table 1. 2.2. Isolation of H. pylori H. pylori was recovered from one antral biopsy of each dyspeptic patient who had undergone diagnostic upper gastrointestinal endoscopy. The specimens were inoculated on brain heart infusion (BHI) agar (Oxoid), containing 7% horse blood and H. pyloriselective supplement (Oxoid-SR 147E) and then incubated under microaerobic conditions (5% O2 , 10% CO2 , 85% N2 ) at 37³C for 3^7 days. The bacteria were identi¢ed as H. pylori based on colony morphology, Gram stain, motility and production of urease, catalase and oxidase reactions. H. pylori isolates from 16 patients were included in the study. H. pylori NCTC 11637 was used as the reference strain. All 16 strains were stored in tubes containing skim milk at 370³C, until cagA PCR and neutrophil chemotaxis were implemented.
2.4. Preparation of the neutrophils Human peripheral neutrophils were prepared as described by Boyum [4]. Heparinised blood obtained from healthy volunteers was incubated for 1 h at 37³C, in order to separate the plasma and white blood cells from the erythrocytes. Plasma with white blood cells was added to polypropylene tubes containing 3 ml of Histopaque-1077 (Sigma Chemical Company, St. Louis, MO, USA) and were centrifuged at 1650 rpm for 30 min. Following the removal of the supernatant gently with a polypropylene pasteur pipette 3 ml of RPMI 1640 (Sigma Chemical Company, St. Louis, MO, USA) was added to the precipitate and washed three times by recentrifugation at 1200 rpm for 10 min. The neutrophil count was adjusted to 5U106 ml31 in RPMI 1640. 2.5. Preparation of zymosan-activated serum (ZAS)
Table 1 The age, sex distribution and endoscopic diagnosis of 16 patients Patient
Age
Sex
Endoscopic diagnosis
1. MS 2. SO 3. VU 4. MDON 5. AA 6. HH 7. MD 8. AB 9. AE 10. MC 11. IA 12. RG 13. RA 14. GK 15. AC 16. SA
41 44 42 38 45 55 28 42 24 45 35 15 57 11 20 35
M F M F M M M F M F F F F F M M
Duodenal ulcer Duodenal ulcer Gastritis Duodenal ulcer Duodenal ulcer Duodenal ulcer Gastritis Gastritis Duodenal ulcer Gastritis Duodenal ulcer Normal Gastritis Gastritis Oesophagitis Gastritis
In this study, ZAS was used as a reference chemoattractant. 10 ml of blood obtained from three AB Rh(+) healthy donors, was left at room temperature for 20 min, and centrifuged at 4³C for 20 min at 1400 rpm. 5 mg ml31 zymosan-A (Sigma Chemical Company, St. Louis, MO, USA) was added to the serum and 0.3-ml aliquots were stored at 320³C. 2.6. Chemotaxis The chemokinetic and chemotactic responses of polymorphonuclear leukocytes (PMNL) were determined by a modi¢ed Boyden chamber method [5,6]. PMNL chemotaxis was performed in duplicate by placing 0.5 ml of the cell suspension in the upper compartment of the Boyden chamber which is separated from the lower compartment by a nitrocellu-
FEMSIM 1019 6-5-99
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
211
Fig. 1. Ampli¢cation products of cagA. Columns : 1, marker (100 bp); 2, HP11637; 3, negative control; 4, SO; 5, MD ; 6, IA; 7, MS; 8, HH ; 9, RG; 10, GK ; 11, SA; 12, MC; 13, AE; 14, AA; 15, AC; 16, VU.
lose ¢lter with a pore size of 3 Wm. The lower compartment was ¢lled with 0.5 ml of the H. pylori supernatant or ZAS. In each experiment, the spontaneous migration towards the medium (brain heart infusion broth+10% foetal calf serum) was assessed as a negative control. For each H. pylori strain the experiment was performed twice with a di¡erent neutrophil donor. ZAS, being chemotactically active for neutrophils, was used as a positive control. The chambers were incubated in 5% CO2 atmosphere at 37³C for 60 min. The ¢lters were ¢xed with ethanol, stained with haematoxylin and mounted on slides. The cells which had migrated completely through the ¢lter were counted by direct microscopy in 10 ¢elds on each ¢lter and the results are expressed as number of PMNL per ¢eld. The ratio of chemotactic movement (A) to random migration (B) was regarded as the chemotactic index (CI).
5PC3P GATAACAGGCAAGCTTTTGAGG and CTGCAAAAGATTGTTTGGCAGA. The PCR program for cagA was: 95³C, 5 min, 1 cycle; 94³C, 30 s (denaturation), 55³C, 1 min (annealing), 72³C, 2 min (polymerisation) 35 cycles; 72³C 5 min, 1 cycle. A 348-bp internal fragment of cagA was ampli¢ed and the PCR products were resolved on a 1% agarose gel. H. pylori NCTC 11637 served as positive control and sterile distilled water was used as negative control. All the samples were tested twice on di¡erent days.
2.7. Ampli¢cation of cagA
3. Results
Chromosomal DNA was extracted by the cetyltrimethyl-ammonium bromide (CTAB) method according to the DNA Miniprep protocol of Wilson to determine the presence of cagA [7]. The precipitate was redissolved in 50 Wl of TE (10 mM Tris and 1 mM EDTA pH 8.0). The primer set used for the detection of the cagA fragment from DNA was
Of the 16 strains, eight were cagA and eight were cagA3 . The cagA status and the endoscopic diagnosis of the 16 patients are shown in Table 2. The ampli¢cation products of the cagA gene are shown in Fig. 1. The chemotactic index of the 16 H. pylori strains isolated from patients, ZAS, BHI broth with 10%
2.8. Statistical methods Statistical analysis was done by the signed rank test, t-test and Mann-Whitney U-test. P 6 0.05 was considered signi¢cant.
FEMSIM 1019 6-5-99
212
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
4. Discussion
Fig. 2. Chemotactic index values of the positive control (ZAS), negative control (BHI broth with 10% foetal calf serum), reference strain (H. pylori NCTC 11637), eight cagA-positive strains (mean = 2.8) and eight cagA-negative strains (mean = 2.6).
foetal calf serum (medium) and HP11637 are shown in Fig. 2 and Table 3. The CI of the media was 1.25. ZAS had a CI of 3.2 and the type strain HP11637 had the highest chemotactic activity (CI 3.4). All of the isolated strains showed chemotactic activity ranging from CI 1.66 to CI 3.92. Four patients (nos. 5, 9, 10, 11) and HP11637 had higher chemotactic activity than ZAS (Table 3). Three of these strains were cagA . The mean value of CI of the patient group was higher than the negative control (P 6 0.01). Statistically there was no signi¢cant di¡erence in the CI's of ZAS and HP1637 (P s 0.05). The mean values of CI of ZAS (t = 2.82, P 6 0.05) and the reference strain HP11637 (t = 3.90, P 6 0.01) were statistically higher than the patient group's mean value of CI (Fig. 2). The mean value of CI of cagA strains was 2.8. The mean value of CI of cagA3 strains was 2.6. There was no statistical signi¢cance in the CI of the cagA and cagA3 strains (P s 0.05) (Fig. 2).
Table 2 cagA status and the endoscopic diagnosis of the patients
cagA cagA3 Total a
DUa
G
O
N
Total
5 2 7
3 4 7
0 1 1
0 1 1
8 8 16
DU, duodenal ulcer; G, gastritis; O, oesophagitis; N, normal.
In this study, eight of the 16 patients were found to be cagA-positive. Five of them were endoscopically diagnosed as having duodenal ulcer and three had gastritis. cagA positivity was higher in the duodenal ulcer group, which is similar to the previous reports [8,9]. All 16 H. pylori strains isolated from patients and the reference strain showed chemotactic activity against PMNL. Previous reports support this result [10^14]. The chemotactic index values for all 16 strains were di¡erent, which shows that the neutrophil activation was di¡erent for each strain; this ¢nding is similar to the report by Rautelin et al. [15]. These di¡erences could also be donor-dependent as di¡erent donors respond di¡erently to the same strain [16]. There was no signi¢cant di¡erence in the chemotactic index values of the duodenal ulcer and gastritis groups of patients. In contrast to this result, Rautelin et al. [15] showed that the neutrophil activation was higher in the peptic ulcer group of patients than in the gastritis group. But some of the previous reports support our result [11,16]. In our study there was no signi¢cant di¡erence between the CI values of the cagA-positive and -negative strains. cagA is the marker for the Cag pathoTable 3 cagA, chemotaxis and CIs of the strains isolated from the patients Patient
cagA
Chemotaxis (mean þ S.E.M.) (Wm þ S.E.M.)
CI
1. MS 2. SO 3. VU 4. MDON 5. AA 6. HH 7. MD 8. AB 9. AE 10. MC 11. IA 12. RG 13. RA 14. GK 15. AC 16. SA
+ 3 + + + + 3 3 + + 3 3 3 3 3 +
93.65 þ 1.53 79.65 þ 2.87 79 þ 1.83 107.5 þ 2.70 87.25 þ 2.44 122.75 þ 3.58 118.25 þ 3.68 110.25 þ 3.76 115.75 þ 2.39 112.25 þ 2.09 104.75 þ 2.12 105.5 þ 2.76 88 þ 2.41 90.5 þ 2.63 78.75 þ 2.11 87.75 þ 1.68
1.97 1.67 1.66 2.49 3.64 2.64 2.54 2.37 3.92 3.81 3.55 3.15 2.63 2.70 1.92 2.14
FEMSIM 1019 6-5-99
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
genicity island, but it has no relation to chemotactic activity of neutrophils when stimulated with H. pylori. In conclusion, cagA can be used as a virulence marker, but there is no association with the neutrophil chemotaxis.
References [1] Plusa, S.S.F., Peichl, P., Lindley, I., Primrose, J. and Crabtree, J. (1993) Secretion of immunologically and biologically active interleukin-8 by a gastric epithelial cell line. Gut 34, (Suppl. 4) S15. [2] Nielsen, H. and Andersen, L.P. (1992) Chemotactic activity of Helicobacter pylori sonicate for human polymorphonuclear leucocytes and monocytes. Gut 33, 738^742. [3] Megraud, F. (1997) Pathogenic diversity of Helicobacter pylori. J. Gastroenterol. 32, 278^281. [4] Boyum, A. (1968) Isolation of mononuclear cells and granulocytes from human blood. Scand. J. Clin. Lab. Invest. 21, (Suppl. 97) 77^86. [5] Boyden, S. (1962) The chemotactic e¡ect of mixtures of antibody and antigen on polymorphonuclear leukocytes. J. Exp. Med. 115, 454^466. [6] Zigmond, S.H. and Hirsch, J.G. (1973) Leukocyte locomotion and chemotaxis. New methods for evaluation and demonstration of a cell-derived chemotactic factor. J. Exp. Med. 137, 387^410. [7] Wilson, K. (1987) Preparation of genomic DNA from bacteria. In: Current Protocols in Molecular Biology, Unit 2.4.1. Wiley, New York.
213
[8] Ito, A., Fujioka, T., Kodama, K., Nishizono, A. and Nasu, M. (1997) Virulence-associated genes as markers of strain diversity in Helicobacter pylori infection. J. Gastroenterol. Hepatol. 12, 666^669. [9] Takata, T., Fujimoto, S., Anzai, K., Shirotani, T., Okada, M., Sawae, Y. and Ono, J. (1998) Analysis of the expression of CagA and VacA and the vacuolating activity in 167 isolates from patients with either peptic ulcers or non-ulcer dyspepsia. Am. J. Gastroenterol. 93, 30^34. [10] Kozol, R., McCurdy, B. and Czanko, B.S. (1993) A neutrophil activating factor present in H. pylori but absent in H. mustelae. Dig. Dis. Sci. 38, 137^141. [11] Craig, P.M., Territo, M.C., Karnes, W.E. and Walsh, J.H. (1992) Helicobacter pylori secretes a chemotactic factor for monocytes and neutrophils. Gut 33, 1020^1023. [12] Mooney, C., Keenan, J., Munster, D., Wilson, I., Allardyce, R., Bagshaw, P., Chapman, B. and Chadwick, V. (1991) Neutrophil activation by Helicobacter pylori. Gut 32, 853^857. [13] Norgaard, A., Andersen, L.P. and Nielsen, H. (1995) Neutrophil degranulation by Helicobacter pylori proteins. Gut 36, 354^357. [14] Evans Jr., D.J., Evans, D.G., Takemura, T., Nakano, H., Lampert, H.C., Graham, D.Y., Granger, D.N. and Kvietys, P.R. (1995) Characterization of a Helicobacter pylori neutrophil-activating protein. Infect. Immun. 63, 2213^2220. [15] Rautelin, H., Blomberg, B., Fredlund, H., Jarnerot, G. and Danielsson, D. (1993) Incidence of Helicobacter pylori strains activating neutrophils in patients with peptic ulcer disease. Gut 34, 599^603. [16] Nielsen, H. and Andersen, L.P. (1995) Activation of phagocytes by Helicobacter pylori correlates with clinical presentation of gastric infection. Scand. J. Infect. Dis. 27, 347^350.
FEMSIM 1019 6-5-99
The e¡ect of Helicobacter pylori on neutrophil chemotaxis is independent of cagA Yakut Akyo«n *, Gulsen Hascelik Hacettepe University, Medical Faculty, Department of Clinical Microbiology and Microbiology, Sihhiye, 06100 Ankara, Turkey Received 25 November 1998 ; accepted 18 February 1999
Abstract Sixteen Helicobacter pylori strains were studied in order to determine their neutrophil chemotactic activity and the association with the presence cagA gene. Neutrophil chemotactic activity was detected by a modified Boyden chamber method and the results were expressed in terms of chemotactic index (CI). The presence of cagA was determined by PCR. Of the 16 strains, eight were cagA and eight were cagA3 . All of the isolated strains showed chemotactic activity. The mean value of CI of the patient group was significantly higher than the negative control (P 6 0.01). The mean value of CI of zymosan-activated serum (P 6 0.05) and the reference strain H. pylori NCTC 11637 (HP11637) (P 6 0.01) was significantly higher than the patient group's mean value of CI. There were no statistical significance in the CI between cagA and cagA3 strains (P s 0.05). It is concluded that H. pylori attracts neutrophils by chemotaxis, however, there is no association with cagA. ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Helicobacter pylori; cagA; Neutrophil chemotaxis; Duodenal ulcer; Gastritis
1. Introduction Helicobacter pylori is the aetiological agent inducing chronic gastric in£ammation and peptic ulcer and plays a major role in gastric cancer and MALT lymphomas. The pathogenesis of the tissue damage in chronic gastritis and peptic ulcer is un-
* Corresponding author. Tel.: +90 (312) 311 47 52; Fax: +90 (312) 311 52 50.
known, but toxic oxidative metabolites from neutrophils may play a role. Neutrophils are attracted by a variety of stimuli and this induces a chemotactic response which play an important role in the immunopathology associated with gastroduodenal H. pylori infection [1,2]. The cytotoxin-associated gene (cagA) has now been identi¢ed as a virulence marker because of its strong association with the vacuolating cytotoxin (VacA) of this organism. cagA strains have been shown to be more virulent, but it is not known whether this results in an increase in chemotaxis [3]. The aim of this study was to investigate the chemotactic e¡ect of H. pylori on neutrophils and the association with cagA.
0928-8244 / 99 / $20.00 ß 1999 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 9 2 8 - 8 2 4 4 ( 9 9 ) 0 0 0 2 8 - 0
FEMSIM 1019 6-5-99
210
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
2. Materials and methods
2.3. Preparation of H. pylori supernatants
2.1. Patients
The reference strain and all the H. pylori strains were subcultured for 3 days as described above. H. pylori strains were harvested after 72 h into 3 ml BHI broth+10% foetal calf serum to a concentration of 1.2U109 CFU ml31 and centrifuged for 20 min at 4000 rpm. The supernatants were sterile-¢ltered through a 0.22 Wm Millipore membrane ¢lter and used as test chemoattractants.
Sixteen H. pylori strains were isolated from eight females and eight males. The age range was 11^57 years (mean: 36.1). The age, sex distribution and endoscopic diagnosis of the 16 patients are shown in Table 1. 2.2. Isolation of H. pylori H. pylori was recovered from one antral biopsy of each dyspeptic patient who had undergone diagnostic upper gastrointestinal endoscopy. The specimens were inoculated on brain heart infusion (BHI) agar (Oxoid), containing 7% horse blood and H. pyloriselective supplement (Oxoid-SR 147E) and then incubated under microaerobic conditions (5% O2 , 10% CO2 , 85% N2 ) at 37³C for 3^7 days. The bacteria were identi¢ed as H. pylori based on colony morphology, Gram stain, motility and production of urease, catalase and oxidase reactions. H. pylori isolates from 16 patients were included in the study. H. pylori NCTC 11637 was used as the reference strain. All 16 strains were stored in tubes containing skim milk at 370³C, until cagA PCR and neutrophil chemotaxis were implemented.
2.4. Preparation of the neutrophils Human peripheral neutrophils were prepared as described by Boyum [4]. Heparinised blood obtained from healthy volunteers was incubated for 1 h at 37³C, in order to separate the plasma and white blood cells from the erythrocytes. Plasma with white blood cells was added to polypropylene tubes containing 3 ml of Histopaque-1077 (Sigma Chemical Company, St. Louis, MO, USA) and were centrifuged at 1650 rpm for 30 min. Following the removal of the supernatant gently with a polypropylene pasteur pipette 3 ml of RPMI 1640 (Sigma Chemical Company, St. Louis, MO, USA) was added to the precipitate and washed three times by recentrifugation at 1200 rpm for 10 min. The neutrophil count was adjusted to 5U106 ml31 in RPMI 1640. 2.5. Preparation of zymosan-activated serum (ZAS)
Table 1 The age, sex distribution and endoscopic diagnosis of 16 patients Patient
Age
Sex
Endoscopic diagnosis
1. MS 2. SO 3. VU 4. MDON 5. AA 6. HH 7. MD 8. AB 9. AE 10. MC 11. IA 12. RG 13. RA 14. GK 15. AC 16. SA
41 44 42 38 45 55 28 42 24 45 35 15 57 11 20 35
M F M F M M M F M F F F F F M M
Duodenal ulcer Duodenal ulcer Gastritis Duodenal ulcer Duodenal ulcer Duodenal ulcer Gastritis Gastritis Duodenal ulcer Gastritis Duodenal ulcer Normal Gastritis Gastritis Oesophagitis Gastritis
In this study, ZAS was used as a reference chemoattractant. 10 ml of blood obtained from three AB Rh(+) healthy donors, was left at room temperature for 20 min, and centrifuged at 4³C for 20 min at 1400 rpm. 5 mg ml31 zymosan-A (Sigma Chemical Company, St. Louis, MO, USA) was added to the serum and 0.3-ml aliquots were stored at 320³C. 2.6. Chemotaxis The chemokinetic and chemotactic responses of polymorphonuclear leukocytes (PMNL) were determined by a modi¢ed Boyden chamber method [5,6]. PMNL chemotaxis was performed in duplicate by placing 0.5 ml of the cell suspension in the upper compartment of the Boyden chamber which is separated from the lower compartment by a nitrocellu-
FEMSIM 1019 6-5-99
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
211
Fig. 1. Ampli¢cation products of cagA. Columns : 1, marker (100 bp); 2, HP11637; 3, negative control; 4, SO; 5, MD ; 6, IA; 7, MS; 8, HH ; 9, RG; 10, GK ; 11, SA; 12, MC; 13, AE; 14, AA; 15, AC; 16, VU.
lose ¢lter with a pore size of 3 Wm. The lower compartment was ¢lled with 0.5 ml of the H. pylori supernatant or ZAS. In each experiment, the spontaneous migration towards the medium (brain heart infusion broth+10% foetal calf serum) was assessed as a negative control. For each H. pylori strain the experiment was performed twice with a di¡erent neutrophil donor. ZAS, being chemotactically active for neutrophils, was used as a positive control. The chambers were incubated in 5% CO2 atmosphere at 37³C for 60 min. The ¢lters were ¢xed with ethanol, stained with haematoxylin and mounted on slides. The cells which had migrated completely through the ¢lter were counted by direct microscopy in 10 ¢elds on each ¢lter and the results are expressed as number of PMNL per ¢eld. The ratio of chemotactic movement (A) to random migration (B) was regarded as the chemotactic index (CI).
5PC3P GATAACAGGCAAGCTTTTGAGG and CTGCAAAAGATTGTTTGGCAGA. The PCR program for cagA was: 95³C, 5 min, 1 cycle; 94³C, 30 s (denaturation), 55³C, 1 min (annealing), 72³C, 2 min (polymerisation) 35 cycles; 72³C 5 min, 1 cycle. A 348-bp internal fragment of cagA was ampli¢ed and the PCR products were resolved on a 1% agarose gel. H. pylori NCTC 11637 served as positive control and sterile distilled water was used as negative control. All the samples were tested twice on di¡erent days.
2.7. Ampli¢cation of cagA
3. Results
Chromosomal DNA was extracted by the cetyltrimethyl-ammonium bromide (CTAB) method according to the DNA Miniprep protocol of Wilson to determine the presence of cagA [7]. The precipitate was redissolved in 50 Wl of TE (10 mM Tris and 1 mM EDTA pH 8.0). The primer set used for the detection of the cagA fragment from DNA was
Of the 16 strains, eight were cagA and eight were cagA3 . The cagA status and the endoscopic diagnosis of the 16 patients are shown in Table 2. The ampli¢cation products of the cagA gene are shown in Fig. 1. The chemotactic index of the 16 H. pylori strains isolated from patients, ZAS, BHI broth with 10%
2.8. Statistical methods Statistical analysis was done by the signed rank test, t-test and Mann-Whitney U-test. P 6 0.05 was considered signi¢cant.
FEMSIM 1019 6-5-99
212
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
4. Discussion
Fig. 2. Chemotactic index values of the positive control (ZAS), negative control (BHI broth with 10% foetal calf serum), reference strain (H. pylori NCTC 11637), eight cagA-positive strains (mean = 2.8) and eight cagA-negative strains (mean = 2.6).
foetal calf serum (medium) and HP11637 are shown in Fig. 2 and Table 3. The CI of the media was 1.25. ZAS had a CI of 3.2 and the type strain HP11637 had the highest chemotactic activity (CI 3.4). All of the isolated strains showed chemotactic activity ranging from CI 1.66 to CI 3.92. Four patients (nos. 5, 9, 10, 11) and HP11637 had higher chemotactic activity than ZAS (Table 3). Three of these strains were cagA . The mean value of CI of the patient group was higher than the negative control (P 6 0.01). Statistically there was no signi¢cant di¡erence in the CI's of ZAS and HP1637 (P s 0.05). The mean values of CI of ZAS (t = 2.82, P 6 0.05) and the reference strain HP11637 (t = 3.90, P 6 0.01) were statistically higher than the patient group's mean value of CI (Fig. 2). The mean value of CI of cagA strains was 2.8. The mean value of CI of cagA3 strains was 2.6. There was no statistical signi¢cance in the CI of the cagA and cagA3 strains (P s 0.05) (Fig. 2).
Table 2 cagA status and the endoscopic diagnosis of the patients
cagA cagA3 Total a
DUa
G
O
N
Total
5 2 7
3 4 7
0 1 1
0 1 1
8 8 16
DU, duodenal ulcer; G, gastritis; O, oesophagitis; N, normal.
In this study, eight of the 16 patients were found to be cagA-positive. Five of them were endoscopically diagnosed as having duodenal ulcer and three had gastritis. cagA positivity was higher in the duodenal ulcer group, which is similar to the previous reports [8,9]. All 16 H. pylori strains isolated from patients and the reference strain showed chemotactic activity against PMNL. Previous reports support this result [10^14]. The chemotactic index values for all 16 strains were di¡erent, which shows that the neutrophil activation was di¡erent for each strain; this ¢nding is similar to the report by Rautelin et al. [15]. These di¡erences could also be donor-dependent as di¡erent donors respond di¡erently to the same strain [16]. There was no signi¢cant di¡erence in the chemotactic index values of the duodenal ulcer and gastritis groups of patients. In contrast to this result, Rautelin et al. [15] showed that the neutrophil activation was higher in the peptic ulcer group of patients than in the gastritis group. But some of the previous reports support our result [11,16]. In our study there was no signi¢cant di¡erence between the CI values of the cagA-positive and -negative strains. cagA is the marker for the Cag pathoTable 3 cagA, chemotaxis and CIs of the strains isolated from the patients Patient
cagA
Chemotaxis (mean þ S.E.M.) (Wm þ S.E.M.)
CI
1. MS 2. SO 3. VU 4. MDON 5. AA 6. HH 7. MD 8. AB 9. AE 10. MC 11. IA 12. RG 13. RA 14. GK 15. AC 16. SA
+ 3 + + + + 3 3 + + 3 3 3 3 3 +
93.65 þ 1.53 79.65 þ 2.87 79 þ 1.83 107.5 þ 2.70 87.25 þ 2.44 122.75 þ 3.58 118.25 þ 3.68 110.25 þ 3.76 115.75 þ 2.39 112.25 þ 2.09 104.75 þ 2.12 105.5 þ 2.76 88 þ 2.41 90.5 þ 2.63 78.75 þ 2.11 87.75 þ 1.68
1.97 1.67 1.66 2.49 3.64 2.64 2.54 2.37 3.92 3.81 3.55 3.15 2.63 2.70 1.92 2.14
FEMSIM 1019 6-5-99
Y. Akyo«n, G. Hascelik / FEMS Immunology and Medical Microbiology 24 (1999) 209^213
genicity island, but it has no relation to chemotactic activity of neutrophils when stimulated with H. pylori. In conclusion, cagA can be used as a virulence marker, but there is no association with the neutrophil chemotaxis.
References [1] Plusa, S.S.F., Peichl, P., Lindley, I., Primrose, J. and Crabtree, J. (1993) Secretion of immunologically and biologically active interleukin-8 by a gastric epithelial cell line. Gut 34, (Suppl. 4) S15. [2] Nielsen, H. and Andersen, L.P. (1992) Chemotactic activity of Helicobacter pylori sonicate for human polymorphonuclear leucocytes and monocytes. Gut 33, 738^742. [3] Megraud, F. (1997) Pathogenic diversity of Helicobacter pylori. J. Gastroenterol. 32, 278^281. [4] Boyum, A. (1968) Isolation of mononuclear cells and granulocytes from human blood. Scand. J. Clin. Lab. Invest. 21, (Suppl. 97) 77^86. [5] Boyden, S. (1962) The chemotactic e¡ect of mixtures of antibody and antigen on polymorphonuclear leukocytes. J. Exp. Med. 115, 454^466. [6] Zigmond, S.H. and Hirsch, J.G. (1973) Leukocyte locomotion and chemotaxis. New methods for evaluation and demonstration of a cell-derived chemotactic factor. J. Exp. Med. 137, 387^410. [7] Wilson, K. (1987) Preparation of genomic DNA from bacteria. In: Current Protocols in Molecular Biology, Unit 2.4.1. Wiley, New York.
213
[8] Ito, A., Fujioka, T., Kodama, K., Nishizono, A. and Nasu, M. (1997) Virulence-associated genes as markers of strain diversity in Helicobacter pylori infection. J. Gastroenterol. Hepatol. 12, 666^669. [9] Takata, T., Fujimoto, S., Anzai, K., Shirotani, T., Okada, M., Sawae, Y. and Ono, J. (1998) Analysis of the expression of CagA and VacA and the vacuolating activity in 167 isolates from patients with either peptic ulcers or non-ulcer dyspepsia. Am. J. Gastroenterol. 93, 30^34. [10] Kozol, R., McCurdy, B. and Czanko, B.S. (1993) A neutrophil activating factor present in H. pylori but absent in H. mustelae. Dig. Dis. Sci. 38, 137^141. [11] Craig, P.M., Territo, M.C., Karnes, W.E. and Walsh, J.H. (1992) Helicobacter pylori secretes a chemotactic factor for monocytes and neutrophils. Gut 33, 1020^1023. [12] Mooney, C., Keenan, J., Munster, D., Wilson, I., Allardyce, R., Bagshaw, P., Chapman, B. and Chadwick, V. (1991) Neutrophil activation by Helicobacter pylori. Gut 32, 853^857. [13] Norgaard, A., Andersen, L.P. and Nielsen, H. (1995) Neutrophil degranulation by Helicobacter pylori proteins. Gut 36, 354^357. [14] Evans Jr., D.J., Evans, D.G., Takemura, T., Nakano, H., Lampert, H.C., Graham, D.Y., Granger, D.N. and Kvietys, P.R. (1995) Characterization of a Helicobacter pylori neutrophil-activating protein. Infect. Immun. 63, 2213^2220. [15] Rautelin, H., Blomberg, B., Fredlund, H., Jarnerot, G. and Danielsson, D. (1993) Incidence of Helicobacter pylori strains activating neutrophils in patients with peptic ulcer disease. Gut 34, 599^603. [16] Nielsen, H. and Andersen, L.P. (1995) Activation of phagocytes by Helicobacter pylori correlates with clinical presentation of gastric infection. Scand. J. Infect. Dis. 27, 347^350.
FEMSIM 1019 6-5-99