The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology

Article The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation Chih-Wei Fan,1 Baozhi Chen,1 Irene Franco,3 Jianming Lu,2 Heping Shi,2 Shuguang Wei,2 Changguang Wang,2 Xiaofeng Wu,1 Wei Tang,1 Michael G. Roth,2 Noelle S. Williams,2 Emilio Hirsch,3 Chuo Chen,2 and Lawrence Lum1,* 1Department

of Cell Biology, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390, USA of Biochemistry, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75390, USA 3Molecular Biotechnology Center, Department of Molecular Biotechnology and Health Sciences, University of Torino, 10126 Torino, Italy *Correspondence: [email protected] http://dx.doi.org/10.1016/j.chembiol.2014.10.013 2Department

SUMMARY

Misactivation of the seven-transmembrane protein Smoothened (Smo) is frequently associated with basal cell carcinoma and medulloblastoma. Cellular exposure to secreted Hedgehog (Hh) protein or oncogenic mutations in Hh pathway components induces Smo accumulation in the primary cilium, an antenna-like organelle with mostly unknown cellular functions. Despite the data supporting an indispensable role of the primary cilium in Smo activation, the mechanistic underpinnings of this dependency remain unclear. Using a cell-membrane-impermeable Smo antagonist (IHR-1), we demonstrate that Smo supplied with a synthetic agonist or activated with oncogenic mutations can signal without ciliary accumulation. Similarly, cells with compromised ciliary Smo trafficking due to loss of the phosphatidylinositol-4-phosphate 3-kinase (PI3K)-C2a retain transcriptional response to an exogenously supplied Smo agonist. These observations suggest that assembly of a Smo-signaling complex in the primary cilium is not a prerequisite for Hh pathway activation driven by Smo agonists or oncogenic Smo molecules.

INTRODUCTION Small molecules that disrupt the hedgehog (Hh) signal transduction pathway are targeted therapeutic agents with proven anticancer efficacy (Low and de Sauvage, 2010). The foundation of this strategy is chemical inhibitors of Smoothened (Smo), a seven-transmembrane protein with similarity to G-proteincoupled receptors (GPCRs) that controls through a signaling cascade the Gli family of DNA-binding proteins. Under homeostatic conditions, the 12-transmembrane protein Patched (Ptch) restrains Smo activity when Ptch is not directly bound to Hh ligand (Ingham and McMahon, 2001). Given the structural similarity of Ptch to small-molecule transporters and its activity dependency on residues essential to the action of such trans-

porters, Ptch likely regulates Smo by gating its access to an endogenous small molecule with Smo-modulatory activity (Briscoe and Therond, 2013; Taipale et al., 2002). Misactivation of Smo in
90% of basal cell carcinoma and
20% of medulloblastoma most commonly results from either loss-of-function mutations in PTCH1 (Hahn et al., 1996; Johnson et al., 1996) or gainof-function mutations in Smo (Lam et al., 1999; Xie et al., 1998). Two pockets that support small-molecule-mediated modulation of activity present in Smo further lend support for the existence of endogenous Smo ligands. One pocket is formed by the seven-transmembrane (7TM) bundle and another by the extracellular cysteine-rich domain (CRD). Whereas the 7TM bundle is accessible to a number of Smo modulators including the anticancer agent vismodegib and a Smo agonist (SAG) (Wang et al., 2013, 2014), the CRD-localized pocket binds oxysterols (Myers et al., 2013; Nachtergaele et al., 2013; Nedelcu et al., 2013; Rana et al., 2013). A model of Smo-dependent regulation by Ptch that emerges from these studies is that the 7TM bundle constitutes the primary site of Smo regulation by a substrate of Ptch whereas the CRD pocket constitutes an allosteric site that supports maximal Smo activity. Activation of the Hh pathway is associated with the accumulation of Smo in the primary cilium, an enigmatic antenna-like cellular structure found in most cells (Goetz and Anderson, 2010). Efforts to understand the importance of Smo subcellular redistribution in response to Hh using genetic strategies has been hindered by the multiple roles that the primary cilium plays in Hh response including those directly relating to Gli regulation (Ocbina and Anderson, 2008). For example, mutations in some intraflagellar trafficking proteins that support ciliary integrity also inactivate Gli proteins, thus compromising functional analysis of Smo-cilium relationships (Ocbina and Anderson, 2008). In addition, the primary cilium is essential to the proteolytic processing of two of the three Gli protein family members (Gli2 and Gli3) into transcriptional repressors in the absence of Hh signaling (Huangfu et al., 2003; Liu et al., 2005). The ability of some Smo agonists and antagonists alike to promote Smo accumulation in the primary cilium suggests that this cellular event is not sufficient for pathway activation (Rohatgi et al., 2009; Wang et al., 2009, 2012). Indeed, these observations support a two-step model of Smo activation—Smo accumulation in the primary cilium and its adoption of an active conformation presumably in the primary cilium. Our understanding of how

Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved 1

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

Smo accumulation in the primary cilium and its activation are coupled remains unclear. From a large chemical library screen intended to expand the number of chemical probes useful for studying Hh signaling and cilia biology, we identified several pharmacophores not previously associated with Smo inhibitory activity. As part of our in-depth study of the most potent compound identified, inhibitor of hedgehog response 1 (IHR-1), we observed that Smo bypasses the need to accumulate in the primary cilium for activation when exogenously provided with an agonist or when it harbors an oncogenic mutation. Using ciliary protein-trafficking defective cells, we confirm that Smo ciliary accumulation and its ability to induce Gli activation can be uncoupled with the introduction of a Smo agonist. These observations suggest that the assembly of a Smo-signaling complex in the primary cilium is not essential for oncogenic Smo signaling. RESULTS A small collection of Hh-signaling inhibitors (IHR compounds) was identified from screening a diverse synthetic chemical library using a cultured cell-based reporter of cell-autonomous Hh pathway response (Figure 1A and Figure S1A available online). Following a battery of counterscreens to identify specific Hh pathway inhibitors, we retained several potent compounds that do not inhibit other signal transduction pathways (Figure 1B; see Figures S1A and S1B) or disrupt ciliogenesis (Figure S1C) but do disable Hh-mediated transcriptional induction of endogenous targets (Figures S1D and S1E). The seven most-potent inhibitors (IHR-1–IHR-7) target Smo as measured by their ability to block Smo binding to Bodipy-cyclopamine (BD-cyclopamine), a fluorescently labeled Smo antagonist (Figures 1C, S1F, and S1G). For the most potent of these seven compounds, IHR-1 (Figure 1B), we also demonstrated direct Smo targeting based on its ability to (1) block Hh-induced movement of Smo into the primary cilium (Figure 1D), (2) disengage Smo-dependent abrogation of Gli2 and Gli3 proteolytic processing (Figures 1E, S2A, and S2B), and (3) inhibit Gli activity induced by loss of PTCH1 (Figure S2C). To more directly define the IHR-1-binding site in Smo, we engineered a fluorescently labeled IHR-1 compound that retains activity against Hh pathway response (IHR-Cy3; Figures 1F and S3A–S3C). Further establishing the utility of IHR-1 as specific probes for Smo, we observed IHR-1 activity and Smo binding are both influenced by its regiochemistry (Figures S3D and S3E). Similar to the results from studies using BD-cyclopamine, the Smo agonist SAG is able to abolish IHR-Cy3 labeling of Smoexpressing cells, suggesting that IHR-1 and SAG compete for binding to the same pocket formed by the heptahelical bundle (Figure 1G). Further supporting this conclusion, IHR-Cy3 binding to Smo was not disrupted by 20(S)-hydroxycholesterol (20(S)OHC), which engages the lipid-binding pocket in the Smo CRD (see Figure 1G; Myers et al., 2013; Nachtergaele et al., 2013; Nedelcu et al., 2013). Surprisingly, despite its potent activity against Hh-induced pathway activity and its shared binding pocket with SAG, IHR1 exhibited a markedly reduced maximal inhibitory response for SAG-induced pathway activation (a maximal 100-fold excess of IHR-1 to SAG was evaluated; Figure 2A). Consistent with our ability to compete away IHR-Cy3 cell labeling with SAG and

further suggesting that IHR-1 does not function as a partial antagonist is our ability to achieve maximal transcriptional SAG response in the presence of IHR-1 (Figure S3F). Taken together, these observations reveal a population of Smo that is activated by SAG and likely inaccessible to IHR-1. Indeed, SAG is a cellpermeable compound that is able to penetrate the blood brain barrier in animal studies, suggesting that SAG may activate an intracellular pool of Smo inaccessible to IHR-1 (Heine et al., 2011). Our synthetic strategy for achieving the IHR-Cy3 molecule resulted in a derivative (IHR-NAc) that remarkably exhibits improved maximal inhibitory action against SAG-induced Smo response (Figure 2B). At the same time, IHR-NAc exhibited slightly more-potent activity than IHR-1 against Hh-induced transcriptional response and retained its ability to block BD-cyclopamine from binding Smo as compared to IHR-1 (see Figures 2B and S4A). Supporting little change in their ability to attack Smo, IHR-1 and IHR-NAc inhibited activity associated with overexpressed wild-type Smo with equal potency (Figure 2C). A difference in the ability of IHR-1 and IHR-NAc to access an intracellular pool of active Smo could explain the poor maximal inhibitory activity of IHR-1 in the presence of SAG. We directly measured the relative cell permeability of IHR-1 and IHR-NAc using a workhorse assay for assessing chemical cell permeability based upon the ability of a molecule of interest to cross a monolayer of Caco-2 cells that form cell-cell tight junctions (Figure 2D; Li et al., 2007). Our results from this study revealed that IHR-NAc exhibited superior ability as compared to IHR-1 to traverse a cell monolayer (Figure 2E). As Caco-2 cells are derived from the gut and may also utilize active transport mechanisms for drug absorption, we executed a similar test using another workhorse assay for monitoring cell permeability (parallel artificial membrane permeability [PAMPA]; Figures 2F and 2G). Both Caco-2 and PAMPA results provide evidence that breaking the symmetry of IHR-1 by changing a chlorine atom into a hydrogen bond donor/acceptor in IHR-1 markedly improves its cell penetration without compromising its ability to inhibit Smo (Figure 2H). Furthermore, we confirm that SAG is membrane permeable using PAMPA. The majority of an oncogenic form of Smo (SmoM2) when overexpressed in cultured cells is localized to the ER likely as a consequence of its compromised ability to fold due to the W535L substitution (Chen et al., 2002a). Cell-permeable Smo agonists and antagonists are able to promote SmoM2 exit from the ER likely by facilitating protein folding, thereby affording a fairly universal assay for monitoring intracellular Smo interaction with chemicals binding the Smo heptahelical cavity (Chen et al., 2002a). In agreement with our assigned relative cell membrane permeability for these chemicals, IHR-NAc, but not IHR-1, induced SmoM2 protein to exit the ER (Figures S4B–S4D). Our cellular activity and cell membrane permeability data taken together reveals a strong correlation between IHR-1/IHR-NAc cell membrane permeability and their ability to inhibit SAGinduced Smo activation. In order to better understand the basis for their different activities against SAG-induced, but not Hh-induced, pathway response, we next evaluated the effects of IHR-1 and IHR-NAc on several biochemical markers of Hh signaling. Smo activation induces the ciliary depletion of Gpr161, a seven-transmembrane

2 Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

Figure 1. Identification of IHR-1, an Hh Pathway Inhibitor that Targets the Heptahelical Domain of Smo

A

B

C

Compound

D

E

F

G

protein that regulates cellular cyclic AMP levels and proteinkinase-A-dependent Gli processing (Mukhopadhyay et al., 2013). Consistent with the effects of IHR-1 and IHR-NAc on SAG-induced Gli activity, IHR-NAc, but not IHR-1, blocked SAG-induced Gpr161 ciliary depletion (Figure 3A). Two additional markers of Hh pathway response—abrogation of Gli pro-

(A) Schematic of the screening platform used to identify Hh pathway antagonists. Compounds that induced loss of firefly luciferase (FL) activity, which reports cell-autonomous Hh-dependent Gli transcriptional activity (GliBS reporter), without changing levels of a control Renilla luciferase (RL) in 3T3-ShhFL cells were identified as potential Hh pathway inhibitors. (B) IC50 of the seven most potent IHR compounds as determined using the 3T3-ShhFL cells. Cyclopamine and SANT1 are established Smo inhibitors. (C) IHR compounds directly target Smo. Cells transfected with either Smo or Frizzled 4 (Fzd4) (a Smo-related molecule that functions in Wnt-mediated signaling) were treated with a fluorescently labeled Smo antagonist (BD-cyclopamine) in the presence of one of seven IHR compounds identified from the chemical screen or a control compound. Percent of Bodipylabeled cells were then scored using fluorescence-activated cell sorting (FACS) analysis to determine the ability of unlabeled compounds (1 mM) to compete with BD-cyclopamine (5 nM) for Smo binding. Cyclopamine, SANT1, and SAG directly bind to Smo. IWR-1 is a Wnt/ b-catenin pathway inhibitor and serves as a negative control. (D) IHR-1 prevents Smo from accumulating in the primary cilium. Percent of NIH 3T3 cells with Smo-GFP colocalizing with acetylated tubulin (labeling the primary cilium) was quantified (n = 100). Conditioned medium containing ShhN protein (ShhN CM). Vismodegib is a FDA-approved Smo antagonist. Data are mean + SEM of three fields. (E) IHR-1 blocks Hh-induced suppression of Gli processing into repressor molecules. Gli3F, fulllength Gli3; Gli3R, Gli3 repressor. (F) Structures of IHR-1 and a fluorophore-labeled IHR-1 compound (IHR-Cy3). (G) IHR-1 and SAG target the Smo heptahelical pocket. SAG targeting the Smo 7TM domain, but not 20(S)-hydroxycholesterol (20(S)-OHC) targeting the extracellular Smo cysteine-rich domain, competes with IHR-Cy3 for Smo binding. Cells transfected with either Smo or Fzd4 were treated with 5 mM IHR-Cy3 with and without 10 mM SAG or 20(S)-OHC. Percent of Cy3-labeled cells were then scored using FACS analysis.

cessing and Gli interaction with its cytoplasmic inhibitory partner Suppressor of Fused (Sufu)—were further examined to confirm the differences in the ability of IHR-NAc and IHR-1 to inhibit SAG-induced pathway response (Figures 3B and S5). In addition to Gpr161, several other Hh pathway components exhibit subcellular redistribution upon Hh stimulation including

Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved 3

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

Figure 2. Markedly Different Cell Membrane Permeability of IHR-1 and Its Derivative IHRNAc Correlates with Their Ability to Inhibit SAG-Induced Hh Pathway Activation

A C

(A) IHR-1 is incapable of blocking SAG-induced Hh pathway response. IC50s of IHR-1 against Hh pathway response induced by either expression of Shh or SAG (0.1 mM) treatment were obtained in NIH 3T3 cells transfected with the GliBS reporter. Data are mean + SEM from triplicate experiments. (B) The IHR-1 derivative IHR-NAc exhibits greater maximal inhibitory activity against SAG-induced pathway response as compared to IHR-1. IHR-NAc activity in Hh-induced response is similar to that observed for IHR-1. Data are mean + SEM from triplicate experiments. (C) Basal wild-type Smo activity is equally sensitive to IHR-1 and IHR-NAc. Data are mean + SEM from triplicate experiments. (D) Schematic of a transwell assay to measure cellular permeability of small-molecule modulators of Smo activity. Smo antagonists are deposited in a growth chamber that is separated into two chambers by a monolayer of Caco-2 cells and a porous membrane (0.4 mm). (E) IHR-NAc exhibits improved ability to transverse a cell monolayer as compared to IHR-1. Mass spectrometric analysis of compound levels that have traversed the Caco-2 cell monolayer for IHR-1 and IHR-NAc. Indicated compounds (10 mM) were deposited in the donor well and concentration of compound found in receiver well determined by mass spectrometry. Propranolol and nadolol are typical positive and negative controls for permeability, respectively. Data are mean + SEM from triplicate experiments with two separate studies reported. (F) Schematic of parallel artificial membrane permeability assay (PAMPA). A phospholipid membrane separates the donor and receiving chambers. (G) IHR-NAc exhibits improved ability to transverse a lipid bilayer as compared to IHR-1. Verapamil and atenolol represent permeable and impermeable reference molecules, respectively. IHR-NAc exhibits
100-fold greater cell membrane permeability than IHR-1. n = 3 in each experiment. (H) Model of IHR-1 and IHR-NAc action in SAGstimulated cells. Extracellularly exposed Smo is accessible to both IHR-1 and IHR-NAc. However, intracellularly localized activated Smo is accessible only to the cell-permeable IHR-NAc.

B

D

E

F

G

H

Gli2 accumulation at the tip of the primary cilium and Smo accumulation throughout the organelle (Goetz and Anderson, 2010). Perhaps not unexpectedly given the transcriptional response data presented so far, IHR-NAc, but not IHR-1, blocked Gli2 accumulation at the ciliary tip in response to SAG treatment (Figure 3C). At the same time, both compounds were equally proficient at inhibiting Smo from accumulating in the primary cilium in the presence of SAG despite the differences in their ability to influence SAG-induced Gli activation (Figure 3D). The ability of IHR-1 and IHR-NAc to block Smo accumulation in the primary cilium reaffirms our position that both chemicals are able to bind to Smo in the presence of SAG. More importantly, it reveals Smo accumulation in the primary cilium can be uncoupled from

several well-established biochemical and cell biological events previously associated with Smo activity within the primary cilium. We further investigated this observation using a genetically based approach. Loss of the phosphoinositide-3-kinase, class 2, alpha (PI3K-C2a) protein results in ciliary trafficking defects that affect the ability of Smo to accumulate in the primary cilium in response to Hh protein and SAG (Franco et al., 2014). Whereas absence of Smo accumulation is associated with compromised Hh-dependent response in cells with PI3K-C2a loss (Franco et al., 2014), Smo response to SAG stimulation under these conditions remains untested. Consistent with the previous report, cells harboring a Pik3-c2a small hairpin RNA (shRNA) construct exhibited loss of PI3K-C2a protein (Figure 4A) and diminished

4 Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

A

B A

B

C

C

D D

Figure 4. Loss of PI3K-C2a Uncouples Smo Accumulation and Activity Induced by SAG

Figure 3. IHR-1 Blocks Smo Accumulation in the Primary Cilium without Inhibiting SAG-Induced Pathway Response (A) IHR-NAc, but not IHR-1, blocks SAG-induced depletion of Gpr161 from the primary cilium. Percent of IMCD3 cells with Gpr161 localized to the primary cilium (labeled with an acetylated tubulin antibody) is indicated for each chemical condition (n = 100). Compound concentrations: 0.1 mM SAG; 10 mM IHR-1; and 10 mM IHR-NAc. Data are mean + SEM of three fields. (B) IHR-NAc, but not IHR-1, blocks Smo-mediated disengagement of Gli3 proteolytic processing and Sufu/Gli interaction. NIH 3T3 cells were treated with SAG and IHR-1 or IHR-NAc. Cellular lysates isolated 24 hr later were either directly subjected to western blot analysis or immunoprecipitation with a Sufu antibody. Controls for Sufu immunoprecipitation are provided in Figure S5. IgG, immunoglobulin G; IP, immunoprecipitation. (C) SAG-induced Gli2 accumulation at the ciliary tip is blocked by IHRNAc, but not IHR-1. The percent of NIH 3T3 cells with Gli2 at the primary cilium tip was quantified (n = 50) at each time point subsequent to addition of SAG (0.1 mM) with or without IHR-1 or IHR-NAc (each 10 mM). Data are mean + SEM of three fields. Representative images are shown on the right. (D) IHR-1 and IHR-NAc both inhibit Smo accumulation in the primary cilium. Percent of NIH 3T3 cells with endogenous Smo in primary cilia were quantified at each time point as described in (C). Data are mean + SEM of three fields.

(A) Validation of on-target effect of a lentivirally delivered Pik3c2a shRNA construct in NIH 3T3 cells. (B) Representative images of primary cilia and Smo in cells harboring a Pik3c2a shRNA construct in the presence of SAG. (C) Quantification of cilia with Smo accumulation in the presence of SAG in cells treated with a control or Pik3c2a shRNA construct. Data are mean + SEM of three fields. (D) SAG induces similar transcription of Ptch1 in cells harboring a control or Pik3c2a shRNA construct. Data are mean + SEM from triplicate experiments.

SAG-induced Smo accumulation in the primary cilium (Figures 4B and 4C). On the other hand, the ability of SAG to promote transcription of the well-validated Hh target gene Ptch1 surprisingly was not compromised in cells harboring the Pik3-c2a shRNA (Figure 4D). We find this genetically based observation to be consistent with our conclusion that Smo can signal from a subcellular compartment outside of the primary cilium when activated with SAG. The cancer-associated Smo mutations W535L (also known as the M2 mutation) and L412F localize to different TM domains that form the narrow cavity occupied by Smo modulators such as vismodegib and SAG (Figures 5A and 5B; Wang et al., 2013, 2014). Because IHR-1 likely binds to the heptahelical cavity, we initiated studies to determine if IHR-1 and IHR-NAc may be useful against the constitutively active SmoM2 and SmoL412F molecules. We

Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved 5

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

A

Figure 5. Extraciliary Oncogenic Smo Contributes to Deviant Gli Activation

B

(A) Location of two cancer-associated Smo mutations superimposed on a crystal structure of the Smo heptahelical domain (modified from Wang et al., 2013). (B) SmoM2 and SmoL412F exhibit similar levels of activity. The GliBS reporter system was used to monitor Gli activity in cells. Data are mean + SEM from triplicate experiments. (C) IHR-NAc, but not IHR-1, is capable of inhibiting Hh pathway response induced by SmoM2 and SmoL412F. The GliBS reporter system was used to monitor Gli activity in cells overexpressing SmoM2 or SmoL412F. Data are mean + SEM from triplicate experiments. (D) IHR-1 and IHR-NAc both block SmoM2 and SmoL412F accumulation in the primary cilia. Percent of cells with SmoM2 localized to the primary cilium was quantified as before (n = 100). Data are mean + SEM of three fields.

C

D protein folding as a consequence of Smo mutagenesis, an inability to engage a cytoplasmic signaling component, or the absence of localization to the primary cilium (Bijlsma et al., 2012).

compared the effects of IHR-1 and IHR-NAc against SmoM2and SmoL412F-induced Gli activation at a dose well above their respective half-maximal inhibitory concentration (IC50s) in Hhinduced pathway response (Figure 5C). As expected, the US Food and Drug Administration (FDA)-approved Smo antagonist Vismodegib promoted a substantial loss of Smo-dependent Gli activity. Surprisingly, whereas IHR-NAc was as equally effective as Vismodegib, the presence of IHR-1 had limited impact on SmoM2 or SmoL412F signaling. The different sensitivity of SmoM2 to these compounds was also reflected in differences of Gli3 processing and ciliary Gpr161 levels in SmoM2-expressing cells treated with IHR-1 or IHR-NAc (Figures S6A and S6B). At the same time, whereas IHR-NAc but not IHR-1 compromised oncogenic Smo activity, both compounds blunted SmoM2 and SmoL412F accumulation in the primary cilium (Figure 5D). Thus, our observations suggest that SmoM2 and SmoL412F like SAG-bound Smo are capable of eliciting Gli activity from an intracellular compartment outside of the primary cilium. Finally, we note that a SmoM2 molecule lacking a cilia-localization signal was previously shown to be unable to activate Gli activity, although it is unclear if this inactivity is due to altered

Despite the general acceptance that the primary cilium functions as a nexus for Hh signaling in both normal and cancerous contexts (Berbari et al., 2009; Goetz and Anderson, 2010; Han et al., 2009; Wong et al., 2009), our understanding of how this antenna-like organelle supports to signaling remains rudimentary. In particular, the primary cilium’s direct support of Gli activation and proteolytic processing has contributed to the difficulties in understanding the organelle’s role in the activity of ‘‘upstream’’ pathway components such as Smo (Huangfu and Anderson, 2005; Humke et al., 2010; Liu et al., 2005). Our study has identified a chemically based strategy for uncoupling Smo accumulation in the primary cilium and Gli activation and proteolytic processing regulation (Figure 6). This should facilitate future studies aimed at dissecting the Smo-dependent signal transduction mechanisms in normal and oncogenic settings by minimizing unwanted perturbations to primary cilium function or Smo sequence that can confound subsequent data assessment. Notably, other Smo probes previously shown to exhibit weakened activity for SAG as compared to for Hh-induced pathway response may reflect similar differences in cell membrane permeability (Chen et al., 2002b; Frank-Kamenetsky et al., 2002). Our observations that extraciliary Smo activity can regulate Gli proteolytic processing and activation suggest that a direct engagement of Smo with a signaling complex found within the primary cilium is not a prerequisite for these biochemical events. Our findings however cannot rule out the possibility that pathway components presumed to function within the primary cilium may

Vismodegib

Vismodegib

DISCUSSION

6 Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

Figure 6. Model of Smo Signaling in Response to SAG, Oncogenic Mutations, and Hh In the presence of the synthetic Smo agonist SAG or in cancers expressing a constitutively active Smo protein, Gli is predominantly regulated by Smo found in an extraciliary compartment. On the other hand, Hh-induced Smo activation in the primary cilium may be dependent upon Smo interaction with an endogenous small molecule.

also act elsewhere in the cell to transduce SAG- or mutationinduced Smo activity (Briscoe and Therond, 2013; Nozawa et al., 2013). The Smo target protein Gpr161 when genetically ablated results in Gli activation irrespective of whether or not Smo is present (Mukhopadhyay et al., 2013). Thus, the ciliary depletion of Gpr161 in cells treated with SAG and IHR-1 likely contributes to Gli activity observed under these settings. Conceivably, IHR-1 and IHR-NAc could induce different Smo conformations that influence Gpr161 behavior that is not reflected by Smo ciliary accumulation and Gli activity readouts alone. This hypothesis could be tested in the future with a greater understanding of how Smo communicates with Gpr161 and the advent of biochemical tools for monitoring their signaling activities. At the same time, we note that the number of subcellular compartments capable of supporting GPCR activity outside of the plasma membrane continue to expand as technologies to monitor their activity improve (Vilardaga et al., 2014). Future studies relying on faithful biochemical reporters of endogenous Smo activity when they become available could be leveraged to visualize the subcellular compartments of Smo activity outside of the primary cilium plasma membrane. Our ability to bypass Smo ciliary localization for Gli regulation using a Smo agonist or activating Smo mutations raises the question of why Smo accumulation in the primary cilium is important for Hh-dependent signaling. Given the resemblance of the Hh receptor Ptch to small-molecule transporters (Taipale et al., 2002) and Smo sensitivity to a variety of small molecules

including those akin to cell-produced lipids (Nachtergaele et al., 2012), one possibility is that Smo ciliary accumulation gates its interaction with an endogenous ligand (see Figure 6). Indeed, several studies provide evidence for differences in the abundance of certain bioactive molecules found in the primary cilium and the plasma membrane (Bielas et al., 2009; Ha et al., 2014; Jacoby et al., 2009; Janich and Corbeil, 2007; Jin et al., 2014; Tyler et al., 2009). We hope the findings presented here will galvanize efforts to identify an endogenous Smo ligand and contribute to a framework for investigating candidate molecules that emerge from such efforts.

SIGNIFICANCE The Smo protein is a major drug target in Hh-associated cancers and represents a growing number of GPCRs that rely on the primary cilium for signaling activity. Yet the contribution of Smo ciliary accumulation to Hh-dependent transcriptional responses remains unclear. Here, we provide chemical and genetic evidence that oncogenic Smo mutants with constitutive activity can signal without accumulation in the primary cilium. When considered with the evidence that Hh-dependent Smo activity is controlled by an endogenous lipid, our data suggest that Hh influences Smo interaction with a small molecule compartmentalized by the primary cilium. Our findings provide a conceptual framework for

Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved 7

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

interrogating cilium-dependent signaling controlled by Hh protein and possibly other signaling molecules. EXPERIMENTAL PROCEDURES Cell Lines and Reagents The GliBS Hh pathway reporter (provided by P.A. Beachy), 83 CBP Notch pathway reporter (provided by R. Kopan), and STF Wnt/b-catenin pathway reporter (provided by R. Moon) were previously described. Smo-myc was constructed in the pcDNA3 backbone using PCR-based cloning. Smo-M2-myc and SmoL412F-myc were generated from the Smo-myc backbone using PCR-based mutagenesis. The Frizzled4 (Fzd4) expression construct was purchased from Open Biosystems. BD-cyclopamine was kindly provided by J.K. Chen. Other Smo modulators used in this study include cyclopamine (Logan Natural Products), SANT1 (Sigma), and SAG (Alexis Biochemicals). Vismodegib was synthesized by C. Chen. ShhN-conditioned medium was prepared as previously described (Chen et al., 2002b). 3T3-ShhFL and L-Wnt-STF cell lines were previously described (Chen et al., 2009; Jacob et al., 2011). Caco-2, NIH 3T3, Shh LightII (referred to as LightII cells), C3H10T1/2, Cos-7, and human embryonic kidney 293 (HEK293) cells were purchased from American Type Culture Collection. Cell lines provided by other labs are listed as follows: FLAG-Gli2 and SMO/ cells (J.K. Chen), A1::Smo::GFP (referred to as Smo-GFP cells; A.P. McMahon), and PTCH1/ (M.P. Scott). For establishing the SmoM2-myc-NIH 3T3 cell line, Smo-M2-myc cDNA was transfected into NIH 3T3 cells and clones were selected in the presence of 400 mg/ml Geneticin. Subclones were then isolated from positive clones identified by western blot analysis for SmoM2-myc expression. SmoL412F-myc cell line was established in C3H10T1/2 cells as described above. Chemical Screen and Reporter-Based Assays For the primary screen and dose-response test, 7,000 3T3-ShhFL cells in Dulbecco’s modified Eagle’s medium (DMEM)/3% calf serum (CS) were seeded into 384-well plates and incubated at 37 C for 2 hr. Two hundred thousand compounds from University of Texas Southwestern Medical Center were added into each well by a Biomek FX liquid handler (Beckman Coulter Genomics). Luciferase activities were measured by Dual-Luciferase reporter assay kit (Promega) 72 hr after drug treatment. To test the effects of compounds of interest in Wnt signaling, 5,000 L-Wnt-STF cells were seeded into 384-well plates containing diluted compounds. Luciferase activities were measured 48 hr after drug treatment. Similarly, compounds were tested in the Notch pathway using the 83 CBP reporter in cells transfected with Notch intracellular domain. For the exogenous Hh test, 12,000 LightII cells were seeded into 96well plates. After 24 hr, culture medium was replaced with ShhN conditioned medium/3% CS. Luciferase activities were measured 48 hr after drug treatment. For testing the activity of IHR compounds against SmoM2 and SmoL412F-induced Hh pathway activity, SmoM2 DNA, SmoL412F DNA, the GliBS reporter, and a constitutive Renilla luciferase reporter were transfected into NIH 3T3 cells using Effectene (QIAGEN). For measuring the Hh pathway IC50 of IHR-1 in PTCH1/ cells, GliBS and Renilla luciferase reporter were transfected into PTCH1/ mouse embryonic fibroblasts using Effectene. To measure IC50s of IHR compounds against SAG-induced Hh pathway activation, LightII cells were seeded into 96-well plates. For all the reporter assays described above, culture media were replaced with DMEM/3% CS that were premixed with compounds after cells reached 100% confluency. Luciferase activities were measured 48 hr after drug treatment. For alkaline phosphatase assays in C3H10T1/2, cells treated for 5 days in DMEM/3% fetal bovine serum (FBS) in the presence of IHR compounds were lysed and alkaline phosphatase activity measured using the SensoLyte pNPP Alkaline Phosphatase Assay Kit according to manufacturer’s instructions. Biochemical Assays For analyzing Gli2 and Gli3 processing, FLAG-Gli2-expressing cells or NIH 3T3 cells were grown to confluence in 6-well plates. Culture medium was switched to ShhN conditioned medium or 100 nM SAG in the presence or absence of Smo antagonists in DMEM/3% CS. After 48 hr of treatment with chemicals, cells were lysed in radio immunoprecipitation assay buffer. For testing Sufu and Gli3 interaction, the same protocol was followed with the exception of

cell lysis using PBS with 1% Igepal CA-630 after 24 hr of chemical treatment. For Sufu immunoprecipitation, Sufu antibody was crosslinked to protein A agarose beads with dimethyl pimelimidate crosslinker (Thermo Scientific Pierce). For all the assays described above, whole-cell lysate was resuspended in SDS sample loading buffer and heated to 95 C for 1 min prior to SDS-PAGE. Antibodies used for analyzing the blots were: Gli3 (R&D Systems; AF3690), Flag epitope-tag (Sigma; F1804), PI3K-C2a (BD Transduction Laboratories; 611046), Sufu, a-tubulin, and GAPDH (Cell Signaling Technology; 2522S, 2125S, and 5174S, respectively). Immunofluorescence For Gpr161, Smo, or Gli2 cilia localization assays, IMCD3, NIH 3T3, Smo-GFP, Smo-M2-myc, or SmoL412F-myc cells were grown to confluence on 12 mm poly-L-lysine precoated glass coverslips (BD Biosciences). The indicated compounds were dissolved in DMEM/3% CS and then applied to cells for 48 hr or 72 hr. Cells were either fixed in 100% methanol for 5 min at 20 C or in 3.7% formaldehyde for 15 min at room temperature. The cells were further permeabilized in blocking buffer (5% normal goat serum and 0.2% Triton X100 in PBS) for 10 min. Coverslips were treated with anti-Smo (provided by P. A. Beachy), anti-Myc (Cell Signaling Technology; 2272), anti-GFP (MBL International; 598), anti-Gli2 and anti-Gpr161 (provided by S. Scales; Genentech), and anti-tubulin (Sigma; T6793) in blocking buffer each for 30 min. After several PBS washes, the coverslips were further incubated with Alexa-488conjugated goat anti-rabbit, Alexa-Fluor-594-conjugated goat anti-mouse, or Hoechst 33342 (Invitrogen) for 30 min. One hundred primary cilia were scored for the presence of Gpr161, Smo, SmoM2, SmoL412F, and Gli2 in each experiment. Flow Cytometry Fzd4 or Smo-myc DNA was transfected into Cos-7 cells (BD-cyclopaminebinding assay) or HEK293 cells (IHR-Cy3-binding assay) by using Fugene6 in 6-well plates. Two days after transfection, cells were incubated with medium containing fluorescently labeled compounds and the indicated competing compounds for 1 hr at 37 C. Cell pellets were collected after trypsinization and washed with cold PBS three times. Cells resuspended in cold PBS were analyzed by flow cytometry on a FACS Calibur (BD Biosciences). Ten thousand cells were sorted for each sample. A fluorescent-positive gate was selected in areas where minimum fluorescent-positive cells were detected in Fzd4 DNA-transfected cells. Statistical Analysis Unless otherwise noted, error bars represent SEM. Chemical Synthesis Synthesis of IHR-1, IHR-Cy3, and IHR-NAc is described in Supplemental Experimental Procedures. Caco-2 Cell Permeability Caco-2 cells were grown to confluence in 12-well transwell plates (Corning Life Sciences; 3460). Cell confluency was measured by Millicell-ERS volt-ohm meter (Millipore). Caco-2 cell monolayers with transepithelial electric resistance values greater than 950 ohm 3 cm2 were used for experiment. Culture medium was replaced with 10 mM of compounds in DMEM/3% CS and incubated for 6 hr. Media from the bottom chamber were collected, and drug concentrations were determined by mass spectrometric analysis as described below. Parallel Artificial Membrane Permeability Studies were executed by Cyprotex. Compounds were dissolved in PBS to a final concentration of 10 mM. A volume of 300 ml of the 10 mM compounds was added to the donor well of precoated PAMPA plates (BD Biosciences; 353015), and the acceptor well was filled with 200 ml of PBS. The plate was incubated for 5 hr at 37 C. Liquid chromatography-tandem mass spectrometry (LC-MS/MS) was used to analyze the samples of the donor and acceptor wells. The effective permeability (Pe) was calculated using the following equation:    VD VA ½drugA effective permeabilityðPeÞ : log Pe = log  ln 1  ; ðVD + VA ÞAt ½drugE

8 Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

where VD and VA are the volumes of the donor and acceptor compartments, A is the area of the membrane, t is the incubation time, and A and E subscripts on the concentration term refer to the acceptor and equilibrium concentrations, respectively. Mass Spectrometry One hundred microliters of each sample was mixed with 200 ml of acetonitrile containing 300 ng/ml N-benzylbenzamide (Sigma). The samples were vortexed for 15 s, allowed to sit 10 min at room temperature, and then centrifuged 5 min at 13,000 rpm. The supernatant was collected and centrifuged an additional time before analysis by LC-MS/MS. Standard curves were prepared using DMEM with 3% CS spiked with known concentrations of each compound. DMEM containing 3% CS was used to establish the limit of detection as three times the signal seen in these samples. In general, back calculation of standard curve points and quality control samples were within 15% of theoretical. The limit of quantification was set as the lowest point on the standard curve for which back calculation yielded values within 15% of theoretical. Analytical methods were developed to detect IHR-1 and IHR-NAc using an Applied Biosystems/MDS Sciex 3200 QTRAP mass spectrometer coupled to a Shimadzu Prominence LC. All compounds were detected as singly charged species and one daughter ion. The following transitions were monitored: IHR-1 454.8–173.0 and IHR-NAc 476.1–173.1. N-benzylbenzamide was used as an internal standard (transition 212.1–91.1). Chromatography was performed using an Agilent ZORBAX XDB-C18 column (5 microns; 4.6 3 50 mm) and the following gradient conditions: 0–1 min 5% buffer B; 1–1.5 min gradient to 100% buffer B; 1.5–3 min 100% buffer B; 3–3.5 min gradient to 5% buffer B; and 3.5–5 min 5% buffer B. For IHR-1 and IHR-NAc, buffer A consisted of 100% dH2O + 0.1% formic acid and buffer B consisted of 100% acetonitrile + 0.1% formic acid. Pik3-C2a Silencing An shRNA construct with the Pik3-C2a sequence 50 -GGCAAGATATGT TAGCTTT-30 was purchased from Thermo Scientific. Pik3-C2a shRNA lentivirus was produced in 293T cells. Filtered and concentrated virus-laden medium was incubated with NIH 3T3 cells for 48 hr. Infected NIH 3T3 cells were selected with puromycin (2 mg/ml) for 7 days. Cells with no more than three passages following were used for experiments.

Radiolabeled SmoM2 Pulse-Chase Experiment pBSK or SmoM2-myc was transfected into Cos-7 cells using Fugene6 in 6well plates. Two days after transfection, the cells were washed with PBS twice and were incubated with 1 ml of 10% dialyzed FBS in L-methionine- and Lcysteine-free DMEM. After 1 hr incubation at 37 C, the cells were pulsed with 1,000 mCi/ml of S35-Met/Cys protein labeling mix (NEG072014MC; PerkinElmer) for 15 min. Cells were washed with 33 PBS before replacing the medium with 2 ml of 10% FBS in the presence or absence of 10 mM of IHR-NAc. At different chasing time point, cells were lysed in PBS/1% Igepal CA-630/protease inhibitors and Smo immunoprecipitated using an anti-Myc (Santa Cruz Biotechnology; SC-40) antibody. SUPPLEMENTAL INFORMATION Supplemental Information includes Supplemental Experimental Procedures and six figures and can be found with this article online at http://dx.doi.org/ 10.1016/j.chembiol.2014.10.013. ACKNOWLEDGMENTS We thank J.K. Chen, P.A. Beachy, P.-T. Chuang, A.P. McMahon, M.P. Scott, R. Moon, R. Kopan, and S. Scales for reagents. We also thank J. Moon, L. Jacob, and Kate Luby-Phelps for technical assistance and Leni S. Jacob and James Kim for critical reading of this manuscript. The project described was supported by award numbers R01GM076398 (to L.L.) and R01CA168761 (to L.L.) from the National Institute of General Medical Sciences and National Cancer Institute, respectively. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institute of General Medical Sciences or the NIH. This work was also supported by the Cancer Prevention Research Institute of Texas (RP130212 to L.L. and C.C.) and the Welch Foundation (I-1665 to L.L. and I-1596 to C.C.). Received: May 20, 2014 Revised: October 22, 2014 Accepted: October 30, 2014 Published: December 4, 2014 REFERENCES

RT-PCR 3T3-ShhFL cells were grown to confluence in 6-well plates. Culture medium was replaced with IHR compounds (2.5 mM) in 3% CS and incubated at 37 C for 48 hr. For cDNA preparation, Trizol RNA extraction and ProtoScript M-MuLV First Strand cDNA Synthesis Kit (New England BioLabs) were used. We used 100%, 80%, 60%, and 40% of cDNA in the PCR reactions. Primers sequences were GAPDH forward: ATCCTGCACCACCAACT, GAPDH reverse: TGCCTGCTTCACCACCTT, Ptch1 forward: ACTGTCCAGCTACCCCAATG, and Ptch1 reverse: CATCATGCCAAAGAGCTCAA. For PI3K-C2a studies, Ptch1 forward: GGAAGGGGCAAAGCTACAGT and Ptch1 reverse: TCCACC GTAAAGGAGGCTTA.

Berbari, N.F., O’Connor, A.K., Haycraft, C.J., and Yoder, B.K. (2009). The primary cilium as a complex signaling center. Curr. Biol. 19, R526–R535.

Chemically Induced SmoM2 Maturation Assay Smo-myc and SmoM2-myc DNA were transfected into Cos-7 cells using Fugene 6. Twenty-four hours after transfection, indicated Smo antagonists were added at the described concentration. Cells were lysed in PBS with 1% Igepal CA-630 and protease inhibitors 24 hr later. SDS sample loading buffer was added to whole-cell lysates and heated to 50 C for 10 min. Enzymatic deglycosylation of protein was achieved with 1 ml of Endo H (Sigma) added to 30 ml of whole-cell lysate in sample loading buffer and incubating at 37 C for 4 hr. For Smo cell surface biotinylation, transfected Cos-7 cells were washed with ice-cold PBS and incubated in ice-cold PBS containing 2 mM Sulfo-NHS-SS-Biotin (Pierce) for 30 min. Biotinylation was quenched by washing and incubating cells with ice-cold PBS containing 100 mM glycine for 10 min. Cells were then lysed in PBS with 1% Igepal CA-630 and protease inhibitors. Agarose beads crosslinked to streptavidin (Sigma) were used to pull down biotinylated proteins. Bound proteins were recovered in sample loading buffer and separated by SDS-PAGE.

Chen, J.K., Taipale, J., Cooper, M.K., and Beachy, P.A. (2002a). Inhibition of Hedgehog signaling by direct binding of cyclopamine to Smoothened. Genes Dev. 16, 2743–2748.

Bielas, S.L., Silhavy, J.L., Brancati, F., Kisseleva, M.V., Al-Gazali, L., Sztriha, L., Bayoumi, R.A., Zaki, M.S., Abdel-Aleem, A., Rosti, R.O., et al. (2009). Mutations in INPP5E, encoding inositol polyphosphate-5-phosphatase E, link phosphatidyl inositol signaling to the ciliopathies. Nat. Genet. 41, 1032–1036. Bijlsma, M.F., Damhofer, H., and Roelink, H. (2012). Hedgehog-stimulated chemotaxis is mediated by smoothened located outside the primary cilium. Sci. Signal. 5, ra60. Briscoe, J., and Therond, P.P. (2013). The mechanisms of Hedgehog signalling and its roles in development and disease. Nature reviews 14, 416–429.

Chen, J.K., Taipale, J., Young, K.E., Maiti, T., and Beachy, P.A. (2002b). Small molecule modulation of Smoothened activity. Proc. Natl. Acad. Sci. USA 99, 14071–14076. Chen, B., Dodge, M.E., Tang, W., Lu, J., Ma, Z., Fan, C.W., Wei, S., Hao, W., Kilgore, J., Williams, N.S., et al. (2009). Small molecule-mediated disruption of Wnt-dependent signaling in tissue regeneration and cancer. Nat. Chem. Biol. 5, 100–107. Franco, I., Gulluni, F., Campa, C.C., Costa, C., Margaria, J.P., Ciraolo, E., Martini, M., Monteyne, D., De Luca, E., Germena, G., et al. (2014). PI3K class II a controls spatially restricted endosomal PtdIns3P and Rab11 activation to promote primary cilium function. Dev. Cell 28, 647–658. Frank-Kamenetsky, M., Zhang, X.M., Bottega, S., Guicherit, O., Wichterle, H., Dudek, H., Bumcrot, D., Wang, F.Y., Jones, S., Shulok, J., et al. (2002).

Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved 9

Please cite this article in press as: Fan et al., The Hedgehog Pathway Effector Smoothened Exhibits Signaling Competency in the Absence of Ciliary Accumulation, Chemistry & Biology (2014), http://dx.doi.org/10.1016/j.chembiol.2014.10.013

Chemistry & Biology Extraciliary Smoothened Activation of Hh Signaling

Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists. J. Biol. 1, 10.

tively regulates the Sonic hedgehog pathway via cAMP signaling. Cell 152, 210–223.

Goetz, S.C., and Anderson, K.V. (2010). The primary cilium: a signalling centre during vertebrate development. Nat. Rev. Genet. 11, 331–344.

Myers, B.R., Sever, N., Chong, Y.C., Kim, J., Belani, J.D., Rychnovsky, S., Bazan, J.F., and Beachy, P.A. (2013). Hedgehog pathway modulation by multiple lipid binding sites on the smoothened effector of signal response. Dev. Cell 26, 346–357.

Ha, T.S., Xia, R., Zhang, H., Jin, X., and Smith, D.P. (2014). Lipid flippase modulates olfactory receptor expression and odorant sensitivity in Drosophila. Proc. Natl. Acad. Sci. USA 111, 7831–7836. Hahn, H., Wicking, C., Zaphiropoulous, P.G., Gailani, M.R., Shanley, S., Chidambaram, A., Vorechovsky, I., Holmberg, E., Unden, A.B., Gillies, S., et al. (1996). Mutations of the human homolog of Drosophila patched in the nevoid basal cell carcinoma syndrome. Cell 85, 841–851. Han, Y.G., Kim, H.J., Dlugosz, A.A., Ellison, D.W., Gilbertson, R.J., and Alvarez-Buylla, A. (2009). Dual and opposing roles of primary cilia in medulloblastoma development. Nat. Med. 15, 1062–1065. Heine, V.M., Griveau, A., Chapin, C., Ballard, P.L., Chen, J.K., and Rowitch, D.H. (2011). A small-molecule smoothened agonist prevents glucocorticoidinduced neonatal cerebellar injury. Sci. Transl. Med. 3, 105ra104. Huangfu, D., and Anderson, K.V. (2005). Cilia and Hedgehog responsiveness in the mouse. Proc. Natl. Acad. Sci. USA 102, 11325–11330. Huangfu, D., Liu, A., Rakeman, A.S., Murcia, N.S., Niswander, L., and Anderson, K.V. (2003). Hedgehog signalling in the mouse requires intraflagellar transport proteins. Nature 426, 83–87. Humke, E.W., Dorn, K.V., Milenkovic, L., Scott, M.P., and Rohatgi, R. (2010). The output of Hedgehog signaling is controlled by the dynamic association between Suppressor of Fused and the Gli proteins. Genes Dev. 24, 670–682. Ingham, P.W., and McMahon, A.P. (2001). Hedgehog signaling in animal development: paradigms and principles. Genes Dev. 15, 3059–3087. Jacob, L.S., Wu, X., Dodge, M.E., Fan, C.W., Kulak, O., Chen, B., Tang, W., Wang, B., Amatruda, J.F., and Lum, L. (2011). Genome-wide RNAi screen reveals disease-associated genes that are common to Hedgehog and Wnt signaling. Sci. Signal. 4, ra4. Jacoby, M., Cox, J.J., Gayral, S., Hampshire, D.J., Ayub, M., Blockmans, M., Pernot, E., Kisseleva, M.V., Compe`re, P., Schiffmann, S.N., et al. (2009). INPP5E mutations cause primary cilium signaling defects, ciliary instability and ciliopathies in human and mouse. Nat. Genet. 41, 1027–1031. Janich, P., and Corbeil, D. (2007). GM1 and GM3 gangliosides highlight distinct lipid microdomains within the apical domain of epithelial cells. FEBS Lett. 581, 1783–1787. Jin, D., Ni, T.T., Sun, J., Wan, H., Amack, J.D., Yu, G., Fleming, J., Chiang, C., Li, W., Papierniak, A., et al. (2014). Prostaglandin signalling regulates ciliogenesis by modulating intraflagellar transport. Nat. Cell Biol. 16, 841–851.

Nachtergaele, S., Mydock, L.K., Krishnan, K., Rammohan, J., Schlesinger, P.H., Covey, D.F., and Rohatgi, R. (2012). Oxysterols are allosteric activators of the oncoprotein Smoothened. Nat. Chem. Biol. 8, 211–220. Nachtergaele, S., Whalen, D.M., Mydock, L.K., Zhao, Z., Malinauskas, T., Krishnan, K., Ingham, P.W., Covey, D.F., Siebold, C., and Rohatgi, R. (2013). Structure and function of the Smoothened extracellular domain in vertebrate Hedgehog signaling. eLife 2, e01340. Nedelcu, D., Liu, J., Xu, Y., Jao, C., and Salic, A. (2013). Oxysterol binding to the extracellular domain of Smoothened in Hedgehog signaling. Nat. Chem. Biol. 9, 557–564. Nozawa, Y.I., Lin, C., and Chuang, P.T. (2013). Hedgehog signaling from the primary cilium to the nucleus: an emerging picture of ciliary localization, trafficking and transduction. Curr. Opin. Genet. Dev. 23, 429–437. Ocbina, P.J., and Anderson, K.V. (2008). Intraflagellar transport, cilia, and mammalian Hedgehog signaling: analysis in mouse embryonic fibroblasts. Dev. Dyn. 237, 2030–2038. Rana, R., Carroll, C.E., Lee, H.J., Bao, J., Marada, S., Grace, C.R., Guibao, C.D., Ogden, S.K., and Zheng, J.J. (2013). Structural insights into the role of the Smoothened cysteine-rich domain in Hedgehog signalling. Nat. Commun. 4, 2965. Rohatgi, R., Milenkovic, L., Corcoran, R.B., and Scott, M.P. (2009). Hedgehog signal transduction by Smoothened: pharmacologic evidence for a 2-step activation process. Proc. Natl. Acad. Sci. USA 106, 3196–3201. Taipale, J., Cooper, M.K., Maiti, T., and Beachy, P.A. (2002). Patched acts catalytically to suppress the activity of Smoothened. Nature 418, 892–897. Tyler, K.M., Fridberg, A., Toriello, K.M., Olson, C.L., Cieslak, J.A., Hazlett, T.L., and Engman, D.M. (2009). Flagellar membrane localization via association with lipid rafts. J. Cell Sci. 122, 859–866. Vilardaga, J.P., Jean-Alphonse, F.G., and Gardella, T.J. (2014). Endosomal generation of cAMP in GPCR signaling. Nat. Chem. Biol. 10, 700–706. Wang, Y., Zhou, Z., Walsh, C.T., and McMahon, A.P. (2009). Selective translocation of intracellular Smoothened to the primary cilium in response to Hedgehog pathway modulation. Proc. Natl. Acad. Sci. USA 106, 2623–2628.

Johnson, R.L., Rothman, A.L., Xie, J., Goodrich, L.V., Bare, J.W., Bonifas, J.M., Quinn, A.G., Myers, R.M., Cox, D.R., Epstein, E.H., Jr., and Scott, M.P. (1996). Human homolog of patched, a candidate gene for the basal cell nevus syndrome. Science 272, 1668–1671.

Wang, Y., Arvanites, A.C., Davidow, L., Blanchard, J., Lam, K., Yoo, J.W., Coy, S., Rubin, L.L., and McMahon, A.P. (2012). Selective identification of hedgehog pathway antagonists by direct analysis of smoothened ciliary translocation. ACS Chem. Biol. 7, 1040–1048.

Lam, C.W., Xie, J., To, K.F., Ng, H.K., Lee, K.C., Yuen, N.W., Lim, P.L., Chan, L.Y., Tong, S.F., and McCormick, F. (1999). A frequent activated smoothened mutation in sporadic basal cell carcinomas. Oncogene 18, 833–836.

Wang, C., Wu, H., Katritch, V., Han, G.W., Huang, X.P., Liu, W., Siu, F.Y., Roth, B.L., Cherezov, V., and Stevens, R.C. (2013). Structure of the human smoothened receptor bound to an antitumour agent. Nature 497, 338–343.

Li, C., Liu, T., Cui, X., Uss, A.S., and Cheng, K.C. (2007). Development of in vitro pharmacokinetic screens using Caco-2, human hepatocyte, and Caco-2/human hepatocyte hybrid systems for the prediction of oral bioavailability in humans. J. Biomol. Screen. 12, 1084–1091.

Wang, C., Wu, H., Evron, T., Vardy, E., Han, G.W., Huang, X.P., Hufeisen, S.J., Mangano, T.J., Urban, D.J., Katritch, V., et al. (2014). Structural basis for Smoothened receptor modulation and chemoresistance to anticancer drugs. Nat. Commun. 5, 4355.

Liu, A., Wang, B., and Niswander, L.A. (2005). Mouse intraflagellar transport proteins regulate both the activator and repressor functions of Gli transcription factors. Development 132, 3103–3111.

Wong, S.Y., Seol, A.D., So, P.L., Ermilov, A.N., Bichakjian, C.K., Epstein, E.H., Jr., Dlugosz, A.A., and Reiter, J.F. (2009). Primary cilia can both mediate and suppress Hedgehog pathway-dependent tumorigenesis. Nat. Med. 15, 1055–1061.

Low, J.A., and de Sauvage, F.J. (2010). Clinical experience with Hedgehog pathway inhibitors. J. Clin. Oncol. 28, 5321–5326. Mukhopadhyay, S., Wen, X., Ratti, N., Loktev, A., Rangell, L., Scales, S.J., and Jackson, P.K. (2013). The ciliary G-protein-coupled receptor Gpr161 nega-

Xie, J., Murone, M., Luoh, S.M., Ryan, A., Gu, Q., Zhang, C., Bonifas, J.M., Lam, C.W., Hynes, M., Goddard, A., et al. (1998). Activating Smoothened mutations in sporadic basal-cell carcinoma. Nature 391, 90–92.

10 Chemistry & Biology 21, 1–10, December 18, 2014 ª2014 Elsevier Ltd All rights reserved