- Email: [email protected]
The helix-loop-helix transcription factor USF interacts with the basal promoter of human amyloid precursor protein
MOLECULAR BRAIN RESEARCH ELSEVIER
Molecular Brain Research 35 (1~;96) 3114-30g
Short communication
The helix-loop-helix transcription factor USF interacts with the basal promoter of human amyloid precursor protein Martin Bourbonni~re, Josephine Nalbantoglu Department of Neurology and Neuro~urgery, and McGill ("entre ]or Studie~ in Aging, McGill University, 3801 Unit ersi(v Street, Montreal, Que. H3A 2B4, ( "ana~hl Accepted lt~ August 1995
Abstract
Nuclear factors from HeLa, PC12, NGI08-15 and SK-N-SH cell lines recognized an oligonucleotide ( - 5 6 to - 3 7 : APP-EI containing an E box (CANNTG) which had previously been characterized as a DNase i-protected sequence in the basal promoter of the human amyloid precursor protein (APP) gene. Binding to APP-EI was competed with an oligonucleotide encompassing the recognition site of the transcription factor USF. Antibodies directed against USF interacted with the APP-El-protein complex and in vitro synthesized USF could bind APP-EI. Co-expression of USF eDNA transactivated a human APP-reporter gene construct. These results suggest that USF may play a role in the expression of the APP gcnc. K¢Tword.s: Am.',loid precursor protein; Promoter; E box: USF
Amyloid precursor protein (APP) represents a family of extensively processed protcins which are produced through the alternative splicing of a single copy gene on chromosome 21 (reviewed by Selkoc [19]). One of the proteolytic products of APP, a 3 9 - 4 2 amino acid pcptide labelled /3-amyloid, accumulates in insoluble deposits in cerebral tissue in Alzheimer's disease and Down's syndromc and, to a lesser extent, in normal aging [19]. Both altered processing of APP and altered metabolism of soluble /3-amyloid have been postulated to play a role in thc neuropathological changes [19]. It is not clear if APP transcription is increased in the brain of Alzheimcr paticnts at any point during the disease process, but the early appearance of brain amyloid deposits in Down's syndrome may be a consequence of the overexpression of APP duc to trisomy of chromosome 21 [1]. Although there is both developmental and ccll-typc specific regulation of the APP gene [16], APP expression in the adult is almost ubiquitous [23]. Accordingly, the promoter of the APP gene resembles that of housekeeping
• Corresponding author. Fax: (l) {514) 398-7371. 0169-328X/915/$15.(}0 :c lt~ge, Elsevier Science B.V. All rights reserved
SSDI 0 1 6 9 - 3 2 g X ( 9 5 ) 1 ) 0 2 1 ) ~ - I
gcnes with no CAAT or TATA boxes but with several GC boxes and multiple transcriptional start sites [17]. Deletion of the APP upstream sequences from position - 2 8 3 2 to 96 has no significant effect on reporter gene levels in a variety of cell lines [14]. The region - 9 6 to + 100, considered a fully functional basal promoter [8,11,14], contains two DNase I footprints. The first footprint, centcred around position - 5 3 to - 4 2 , encompasses a putative A P - 1 / A P - 4 site and an adjacent Spl site [7,8,11),11,14]. The second one at - 9 2 to - 8 7 [7,11,14] contains a G-rich sequence which has been labelled APBfl [13]. Either deletion [8,13] or mutagenesis [7] of the APB/3 sequence results in a 6 0 - 7 0 % decrease in transcriptional activity of the human and rodent genes. The sequence that is footprinted at - 5 3 to - 4 2 appears to be important as well: not only does its deletion abolish residual activity of the promoter [7,8,11,13,14], but nuclear factor binding to the larger region ( - 67 to - 4 3 ) is essential to the activity of APBfl [10]. While the sequence of the region - 53 to - 42 contains recognition sequences for transcription factors AP-I and AP-4, neither factor appears to bind to it [14]. The core ( - 4 9 to - 4 4 ) of the footprinted sequence contains an E box (APP-EI), a sequence motif which is usually recog-
305
M. Bourbonnibre, J. Nalbantoglu / Molecular Brain Research 35 (1996) 304-308
nized by DNA binding proteins of the basic helix-loop-helix (bHLH) family. Polypeptides of less than 50 kDa were bound by the E box element in preliminary UV-crosslinking experiments with HeLa nuclear extracts, implicating the bHLH transcription factor USF (43 kDa). In this report we show that USF binds the APP E box and can activate transcription of a reporter gene linked to upstream sequences of the APP gene. To identify proteins which bind APP-E1, a 20 base pair (bp) end-labelled oligonucleotide ( - 56 to - 37) was incubated with HeLa nuclear extracts. Subsequent electrophoretic mobility shift assay (EMSA) showed two major DNA-protein complexes (Fig. 1A). Pre-incubation of nuclear extracts with a 50-fold molar excess of unlabelled APP-E1 oligonucleotide effectively diminished the observed shift(s) (Fig. 1A, lane 4), establishing the specificity of the binding. Formation of the DNA-protein complex could also be abolished by competition (at the same range of concentrations) with a 20 bp oligonucleotide, Ad-USF, containing the E box sequence from the adenovirus major late promoter ( - 6 7 to - 5 8 ) which is recognized by the transcription factor USF [18] (Fig. 1A, lanes 5-7). Con-
versely, the APP-E1 oligonucleotide interfered with the binding of nuclear protein(s) to Ad-USF (Fig. 1A, lanes 9-11), suggesting that APP-E1 and Ad-USF can interact with nuclear proteins in a reciprocal fashion. Formation of the APP-El-protein complex was not affected by the presence of a 1000-fold molar excess of unlabelled AP-1, Spl or the unrelated AP-2 oligonucleotide (Fig. 1B). The APPE1 binding activity was also detected in cell lines of neuronal origin (Fig. 1C). To determine whether the complex contains authentic USF or a USF-related protein, we performed EMSA in the presence of an antiserum against the 43 kDa USF protein [22]. As shown in Fig. 2A, the antibody binds in a concentration dependent manner to the complex formed between Ad-USF and HeLa nuclear proteins, decreasing the electrophoretic migration of the complex ('supershift', Fig. 2A, lanes 6 and 7). A similar change in electrophoretic pattern is observed when the APP-El-protein complex is incubated with anti-USF antibody (Fig. 2A, lanes 2 and 3) but not with an irrelevant antiserum used at the same protein concentration (Fig. 2A, lane 4). The supershift is also observed in EMSA performed with nu-
B
PROBE
APP-E1
[
Ad-USF
]
C
NGI08-15 PC12 SK-N-SH + + +
~,% ~.'3, ~%
COMP.
O w -
-
Fig. 1. APP-E1 binding activity in nuclear extracts of HeLa cells and neuronal cell lines. A: End-labelled APP-E1 (lanes 1-7) or Ad-USF (lanes 8-11) oligonucleotides were incubated with HeLa nuclear extracts (Promega, Madison, WI) in absence (lanes 1, 8) or presence of increasing amounts of unlabelled APP-E1 competitor (lanes 2, 9, 10-fold;lanes 3, 10, 25-fold; lanes 4, 11, 50-fold molar excess) or Ad-USF competitor (lane 5, 10-fold;lane 6, 25-fold; lane 7, 50-fold molar excess). B: End-labelled APP-E1 oligonucleotidewas incubated with HeLa nuclear extracts in absence (lane 1) or presence of a 1000-foldmolar excess of unlabelled oligonucleotidescontaining the recognition sequence of AP-1 (lane 2), AP-2 (lane 3) and Spl (lane 4). C: EMSA was performed with nuclear extracts prepared according to Dignam et al. [4] from NG108-15 cells (lanes 1 and 2), PCI2 cells (lanes 3 and 4), SK-N-SH cells (lanes 5 and 6) in the absence (lanes 1, 3, and 5) or in the presence (lanes 2, 4, and 6) of an anti-USF antiserum [22]. Bar: specific DNA-protein complexes; Comp.: competitor oligonucleotide; NS: non-specific complexes; F: position of free probe. The coding strand of the double-stranded oligonucleotides which were used is represented by: APP-E1, 5'GCCGGATCAGCTGACTCGCC3';Ad-USF, 5'TGTAGGCCACGTGACCGGGT3'; AP-1, 5'CC,-CTI'GATGAGTI'CAGCCGGAA3';AP-2, 5'GATCGAACTGACCGCCCGCGGCCCGT3';Spl, 5'ATrCGATCGGGGCCW_W_~CGAGC3'. EMSA was performed as detailed previously [2]. Unlabelled specific competitor was added 5 rain before the labelled probe. Incubationwith antiserum was as described in Fig. 2.
306
M. Bourbonnibre, J. Nalbantoglu / Molecular Brain Research 35 t 1996) 304-308
A +
APP-EI PROBE
APP-E1
I
I
Ad-USF
]
Ad-USF USF anti-USF
~ 2
3
4
5
6
7
+
+ + +
+
8
-
_
I
2
+ +
3
4 5
..? m l
I
I
Fig. 2. Authentic USF forms a complex with APP-EI. A: End-labelled APP-EI (lanes 1-4) or Ad-USF (lanes 5 - 8 ) oligonucleotides were incubated with HeLa nuclear extracts and DNA-protein complexes were allowed to 12~rm for 20 min prior to the addition of a rabbit polyclonal anti-USF antiserum [22] and further incubation for 30 min. Lanes 1 and 5. without antiserum; lanes 2 and 6, in the presence of a I/5(X) dilution; and lanes 3 and 7. a 1/1000 dilution of the antiserum; lanes 4 and 7, in the presence of a 1/500 dilution of an unrelated rabbit antiserum. B: EMSA was performed with labelled oligonucleotides APP-EI (lanes 2 and 4) and Ad-USF (lane 3) using in vitro synthesized USF as a source of proteins. The TNT'" Coupled Reticulocytc Lysate System (Promega) was used as recommended by the manufacturer to synthesize in vitro the 43 kDa USF protein from 2 Ng of plasmid pAi2 [6]; 2 /zl of the total TNT'" reaction was used in binding assays. In lane 1. the binding occurred in presence of a reaction wherc T7 polymerase was omitted. No USF binding activity was detected. Arrowhead: supershift observed in presence of anti-USF antiserum; Bar: specific DNA-protein complexes: F: frec probe.
pCXUSF OP.1!lr ~-~~
~
.
~
r'--
+
IAdUS~IAausvl ITKI
r-'I i
0
•
i
"
1
!
2
"
i
i
3
4
RELATIVE CAT ACTIVITY
Fig. 3. Transactivation of human APP promoter by USF. Co-transfection of the cDNA for USF (pCXUSF) (15 p,g) or of carrier plasmid (15 /.tg), and a human APP promoter/CAT reporter gene construct (pKCXB) (15 tzg) or the control plasmid p2XAdMI,TF/TKCAT (15/zg) was carried out in presence of 30 /zg of Lipofectin (Gibco/BRL). Transfections were performed in triplicate using two independent plasmid preparations. CAT assays were carried out as de~ribed previously [2] and were quantitated on a Molecular Dynamics phosphorimager using Image Quant software. Percentage of acetylation (10-40%) was normalized to protein concentrations. CAT activity is expressed relative to the control transfections. The error bars indicate the standard error of the mean (n = 6).
M. Bourbonnibre, J. Nalbantoglu / Molecular Brain Research 35 (1996) 304-308
clear extracts from the neuronal cell lines PC12, NG108-15 and SK-N-SH (Fig. 1C, lanes 2, 4, 6). The complete shift of the APP-El-protein complex by the anti-USF antibody strongly suggests that a protein which is antigenically related to USF is the major protein interacting with APPEl. We confirmed that USF itself could bind directly to APP-E1 by performing EMSA with USF protein synthesized in a coupled in vitro transcription/translation system. Both APP-E1 and Ad-USF were bound by the in vitro translated USF (Fig. 2B, lanes 2 and 3) in a complex that was recognized by the anti-USF antibody (Fig. 2B, lane 4). Furthermore, polypeptides of similar molecular weight were bound during UV-crosslinking of APP-E1 and AdUSF to nuclear extracts, suggesting again direct interaction of USF which is present in HeLa nuclear extracts [22] with APP-E1 (data not shown). Co-transfection experiments in NG108-15 cells using a human APP promoter-CAT construct ( - 2 0 0 to + 100) and the plasmid pCXUSF which contains the USF cDNA under the control of the CMV promoter [5] resulted in a 70% increase of the CAT activity directed by the APP promoter (Fig. 3). Transactivation by USF is dependent on the number of E box elements [12] as demonstrated in Fig. 3 with the plasmid p2XAdMLTF/TKCAT, which contains two copies of the USF binding site of the adenovirus major late promoter ( - 6 9 to - 4 9 ) inserted upstream of the minimal promoter of the HSV TK gene [20]. These results indicate that USF can interact in vivo with the APP basal promoter to modulate APP gene transcription. USF, as a member of the bHLH family of transcription factors, binds DNA in vivo as a homo- or heterodimer of USF-1 (43 kDa) and USF-2 (44 kDa). These proteins, encoded by two different genes, are expressed ubiquitously at ratios that appear to be constant in all tissues examined [21]. In concordance with the almost ubiquitous expression of the APP gene, USF DNA binding activity has also been found in all cell lines so far tested [21]. To date, there is no information on the developmental expression of USF. Our results suggest that USF can contribute to the expression of the APP gene since an APP promoter-CAT reporter construct was transactivated by co-expression of USF cDNA. It remains to be seen how USF interacts with other transcription factors to modulate endogenous APP expression. Besides activating the adenovirus major late promoter by binding to an E box [18], USF has been shown to regulate a variety of cellular genes through interactions with upstream E boxes (as summarized in Sirito et al. [22]). The stimulatory effect of USF may be mediated through direct protein-protein interaction between USF and the transcriptional apparatus [15]. Binding of USF to its recognition sequences may also lead to formation of a nucleosome-free region over the promoter, increasing the accessibility of the region surrounding its binding site to basal initiation factors [24]. Involvement of USF in chromatin dynamics is further supported by the
307
report that USF binds with high affinity to an E box in the DNase I-hypersensitive site HS2 in the /3-globin locus control region [3]. There is also a DNase I-hypersensitive site in the proximity of the USF binding site of the human APP gene [9].
Acknowledgements We thank Drs. R.G. Roeder, M. Sawadogo, and H.C. Towle for providing plasmids and antibodies. We gratefully acknowledge Dr. G.J. Matlashewski for supplying the reagents for the in vitro transcription/translation system and Hugues Charest for performing these experiments. This work was supported by the Medical Research Council of Canada (MA-10407). M.B. was supported by the Alzheimer Society of Canada, J.N. is a Research Scholar of the Fonds de la recherche en sant6 du Qu6bec.
References [1] Beyreuther, K., Pollwein, P., Multhaup, G., Monning, U., Konig, G., Dyrks, T., Schubert, W. and Masters, C.L, Regulation and expression of the Alzheimer's f l / A 4 amyloid protein in health, disease and Down's syndrome, Ann. NYAcad. Sci., 695 (1993) 91-102• [2] Bourbonni~re, M. and Nalbantoglu, J., Expression of amyloid precursor protein in a neuronal cell line: functional activity of proximal regulatory elements, Mol. Brain Res., 19 (1993) 246-250. [3] Bresnick, E.H. and Felsenfeld, G., Evidence that the transcription factor USF is a component of the human fl-globin locus control region heteromeric protein complex, J. Biol. Chem., 268 (1993) 18824-18834. [4] Dignam, J.D., Lebovitz, R.M. and Roeder, R.G., Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei, Nucleic Acids Re.~., 11 (1983) 14751489. [5] Du, H., Roy, A.L. and Roeder, R.G., Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the Ad-ML promoters, EMBOJ., 12 (1993) 501-511• [6] Gregor, P.D., Sawadogo, M. and Roeder, R.G., The adenovirus major late transcription factor USF is a member of the helix-loophelix group of regulatory proteins and binds to DNA as a dimer, Genes Det.,., 4 (1990) 1730-1740. [7] Hoffman, P.W. and Chernak, J.M., The rat amyloid precursor protein promoter contains two DNA regulatory elements which influence high level gene expression, Biochem. Biophys. Res. Commun., 201 (1994) 610-617. [8] Izumi, R., Yamada, T., Yoshikai, S-I., Sasaki, H., Hattori, M. and Sakaki, Y., Positive and negative regulatory elements for the expression of the Alzheimer's disease amyloid precursor-encoding gene in mouse, Gene, 112 (1992) 189-195• [9] Lukiw, W.J., Rogaev, E.I., Wong, L., Vaula, G., McLachlan, D.R.C. and St George Hyslop, P., Protein-DNA interactions in the promoter region of the amyloid precursor protein (APP) gene in human neocortex, MoL Brain Res., 22 (1994) 121-131. [10] Pollwein, P., Overlapping binding sites of two different transcription factors in the promoter of the human gene for the Alzheimer amyloid precursor protein, Biochem. Biophys. Res. Commun., 190 (1993) 637-647. [11] Pollwein, P., Masters, C.L. and Beyreuther, K., The expression of
3118
[12]
[13]
[14]
[15]
[16]
[17]
[18]
M. Bourbonnii're, ,I. Nalbantoglu / Molecular Brain Research 35 (1996) 304-308
the amyloid precursor protein (APP) is rcgulated by two (i(-clcmcnts in the promoter, Nucleic Acids" Rex., 20 (1992) 63-68. Potter, J.J., Chcneval, D., Dang, C.V., Resar, L.M.S., Mczey. I-. and Wang, V.W., The upstream stimulatory factor binds It, and activates the promoter of the rat class I alcohol dehydrogenase gone. J. Biol. Chem., 266 ( 1991 ) 15457-15463. Ouitschkc, W.W.. Two nuclear factor binding domains activate expression from the human amyloid /3-protein precursor promotcr, .I. BioL (;hem., 269 (1994) 21229-21233. Ouitschke. W.W. and Goldgaber. D., The amyloid /3-protein precursor promoter. A region essential liar transcriptional activity contains, a nuclear factor binding domain, .I. Biol. ('hem., 267 (1992) 17362 17368. Roy. A.L., Meisterernst, M., Pognonec, P. and Rocdcr, R.(i.. (Aa~perativc interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature, 354 (19911 245-248. Salbaum, J.M. and Ruddle. I:.H., Embryonic expression pattern ot amyloid protein precursor suggests a role in diffcrcntiation of specific subsets of neurons, J. Exp. Zool.. 269 (1994) 111"~-127. Salbaum, J.M.. Weidemann, A., i.cmairc, II.-G.. Mastcrs, C.I,. and Beyreuther, K., The promoter of Alzheimcr's disease amvloid A4 prccursor gone, FMBO .1.. 7 (1988) 2807-2813. Sawadogo. M. and Rocdcr, R.G., Interaction o! a gone-specific
transcription factor with the adenovirus major late promoter upstream of the TATA box region, Cell, 43 (1985) 165-175. [19] Sclkoe, D.J., Normal and abnormal biology of the /3-amyloid precursor protcin, Annu. Ret. Neuroxci., 17 (1994) 489-517. [211] Shih, H.-M. and Towle, H.C., Definition of the carbohydrate rcsponse element of the rat S14 gene, J. Biol. Chem., 269 (1994) 9381)-9387. [21] Sirito, M., Lin, Q., Malty, T. and Sawadogo, M., Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells, Nucleic Acids Res., 22 (1994) 427-433. [22] Sirito. M , Walker, S., Lin, Q., Kozlowski. M.T., Klcin. W.ti. and Sawadogo, M., Members of the USF family of helix-kx~p-helix proteins bind DNA as homo- as well as hetcrodimers, Gene Expr., 2 (1992) 231-2411. 123] Tanzi. R.E., Gusella, J.F., Watkins, P.C., Bruns, G.A.P,, St. George-ltyslop, P., van Keuren, M.L., Patterson, D., Pagan, S., Kurnit, DM. and Neve, R.L., Amyloid /3 protein gene: eDNA. mRNA distribution and genetic linkage near the Alzheimer locus. Science, 235 (1987) 881)-883. [24] Workman, J.k., Rtveder, RG. and Kingston, R.E., An upstrcam transcription factor, USF (MLTF), facilitates the formation of preinitiation complexes during in vitro chromatin assembly, EMBO J., 9 ( 19911} 1299-13118.
Molecular Brain Research 35 (1~;96) 3114-30g
Short communication
The helix-loop-helix transcription factor USF interacts with the basal promoter of human amyloid precursor protein Martin Bourbonni~re, Josephine Nalbantoglu Department of Neurology and Neuro~urgery, and McGill ("entre ]or Studie~ in Aging, McGill University, 3801 Unit ersi(v Street, Montreal, Que. H3A 2B4, ( "ana~hl Accepted lt~ August 1995
Abstract
Nuclear factors from HeLa, PC12, NGI08-15 and SK-N-SH cell lines recognized an oligonucleotide ( - 5 6 to - 3 7 : APP-EI containing an E box (CANNTG) which had previously been characterized as a DNase i-protected sequence in the basal promoter of the human amyloid precursor protein (APP) gene. Binding to APP-EI was competed with an oligonucleotide encompassing the recognition site of the transcription factor USF. Antibodies directed against USF interacted with the APP-El-protein complex and in vitro synthesized USF could bind APP-EI. Co-expression of USF eDNA transactivated a human APP-reporter gene construct. These results suggest that USF may play a role in the expression of the APP gcnc. K¢Tword.s: Am.',loid precursor protein; Promoter; E box: USF
Amyloid precursor protein (APP) represents a family of extensively processed protcins which are produced through the alternative splicing of a single copy gene on chromosome 21 (reviewed by Selkoc [19]). One of the proteolytic products of APP, a 3 9 - 4 2 amino acid pcptide labelled /3-amyloid, accumulates in insoluble deposits in cerebral tissue in Alzheimer's disease and Down's syndromc and, to a lesser extent, in normal aging [19]. Both altered processing of APP and altered metabolism of soluble /3-amyloid have been postulated to play a role in thc neuropathological changes [19]. It is not clear if APP transcription is increased in the brain of Alzheimcr paticnts at any point during the disease process, but the early appearance of brain amyloid deposits in Down's syndrome may be a consequence of the overexpression of APP duc to trisomy of chromosome 21 [1]. Although there is both developmental and ccll-typc specific regulation of the APP gene [16], APP expression in the adult is almost ubiquitous [23]. Accordingly, the promoter of the APP gene resembles that of housekeeping
• Corresponding author. Fax: (l) {514) 398-7371. 0169-328X/915/$15.(}0 :c lt~ge, Elsevier Science B.V. All rights reserved
SSDI 0 1 6 9 - 3 2 g X ( 9 5 ) 1 ) 0 2 1 ) ~ - I
gcnes with no CAAT or TATA boxes but with several GC boxes and multiple transcriptional start sites [17]. Deletion of the APP upstream sequences from position - 2 8 3 2 to 96 has no significant effect on reporter gene levels in a variety of cell lines [14]. The region - 9 6 to + 100, considered a fully functional basal promoter [8,11,14], contains two DNase I footprints. The first footprint, centcred around position - 5 3 to - 4 2 , encompasses a putative A P - 1 / A P - 4 site and an adjacent Spl site [7,8,11),11,14]. The second one at - 9 2 to - 8 7 [7,11,14] contains a G-rich sequence which has been labelled APBfl [13]. Either deletion [8,13] or mutagenesis [7] of the APB/3 sequence results in a 6 0 - 7 0 % decrease in transcriptional activity of the human and rodent genes. The sequence that is footprinted at - 5 3 to - 4 2 appears to be important as well: not only does its deletion abolish residual activity of the promoter [7,8,11,13,14], but nuclear factor binding to the larger region ( - 67 to - 4 3 ) is essential to the activity of APBfl [10]. While the sequence of the region - 53 to - 42 contains recognition sequences for transcription factors AP-I and AP-4, neither factor appears to bind to it [14]. The core ( - 4 9 to - 4 4 ) of the footprinted sequence contains an E box (APP-EI), a sequence motif which is usually recog-
305
M. Bourbonnibre, J. Nalbantoglu / Molecular Brain Research 35 (1996) 304-308
nized by DNA binding proteins of the basic helix-loop-helix (bHLH) family. Polypeptides of less than 50 kDa were bound by the E box element in preliminary UV-crosslinking experiments with HeLa nuclear extracts, implicating the bHLH transcription factor USF (43 kDa). In this report we show that USF binds the APP E box and can activate transcription of a reporter gene linked to upstream sequences of the APP gene. To identify proteins which bind APP-E1, a 20 base pair (bp) end-labelled oligonucleotide ( - 56 to - 37) was incubated with HeLa nuclear extracts. Subsequent electrophoretic mobility shift assay (EMSA) showed two major DNA-protein complexes (Fig. 1A). Pre-incubation of nuclear extracts with a 50-fold molar excess of unlabelled APP-E1 oligonucleotide effectively diminished the observed shift(s) (Fig. 1A, lane 4), establishing the specificity of the binding. Formation of the DNA-protein complex could also be abolished by competition (at the same range of concentrations) with a 20 bp oligonucleotide, Ad-USF, containing the E box sequence from the adenovirus major late promoter ( - 6 7 to - 5 8 ) which is recognized by the transcription factor USF [18] (Fig. 1A, lanes 5-7). Con-
versely, the APP-E1 oligonucleotide interfered with the binding of nuclear protein(s) to Ad-USF (Fig. 1A, lanes 9-11), suggesting that APP-E1 and Ad-USF can interact with nuclear proteins in a reciprocal fashion. Formation of the APP-El-protein complex was not affected by the presence of a 1000-fold molar excess of unlabelled AP-1, Spl or the unrelated AP-2 oligonucleotide (Fig. 1B). The APPE1 binding activity was also detected in cell lines of neuronal origin (Fig. 1C). To determine whether the complex contains authentic USF or a USF-related protein, we performed EMSA in the presence of an antiserum against the 43 kDa USF protein [22]. As shown in Fig. 2A, the antibody binds in a concentration dependent manner to the complex formed between Ad-USF and HeLa nuclear proteins, decreasing the electrophoretic migration of the complex ('supershift', Fig. 2A, lanes 6 and 7). A similar change in electrophoretic pattern is observed when the APP-El-protein complex is incubated with anti-USF antibody (Fig. 2A, lanes 2 and 3) but not with an irrelevant antiserum used at the same protein concentration (Fig. 2A, lane 4). The supershift is also observed in EMSA performed with nu-
B
PROBE
APP-E1
[
Ad-USF
]
C
NGI08-15 PC12 SK-N-SH + + +
~,% ~.'3, ~%
COMP.
O w -
-
Fig. 1. APP-E1 binding activity in nuclear extracts of HeLa cells and neuronal cell lines. A: End-labelled APP-E1 (lanes 1-7) or Ad-USF (lanes 8-11) oligonucleotides were incubated with HeLa nuclear extracts (Promega, Madison, WI) in absence (lanes 1, 8) or presence of increasing amounts of unlabelled APP-E1 competitor (lanes 2, 9, 10-fold;lanes 3, 10, 25-fold; lanes 4, 11, 50-fold molar excess) or Ad-USF competitor (lane 5, 10-fold;lane 6, 25-fold; lane 7, 50-fold molar excess). B: End-labelled APP-E1 oligonucleotidewas incubated with HeLa nuclear extracts in absence (lane 1) or presence of a 1000-foldmolar excess of unlabelled oligonucleotidescontaining the recognition sequence of AP-1 (lane 2), AP-2 (lane 3) and Spl (lane 4). C: EMSA was performed with nuclear extracts prepared according to Dignam et al. [4] from NG108-15 cells (lanes 1 and 2), PCI2 cells (lanes 3 and 4), SK-N-SH cells (lanes 5 and 6) in the absence (lanes 1, 3, and 5) or in the presence (lanes 2, 4, and 6) of an anti-USF antiserum [22]. Bar: specific DNA-protein complexes; Comp.: competitor oligonucleotide; NS: non-specific complexes; F: position of free probe. The coding strand of the double-stranded oligonucleotides which were used is represented by: APP-E1, 5'GCCGGATCAGCTGACTCGCC3';Ad-USF, 5'TGTAGGCCACGTGACCGGGT3'; AP-1, 5'CC,-CTI'GATGAGTI'CAGCCGGAA3';AP-2, 5'GATCGAACTGACCGCCCGCGGCCCGT3';Spl, 5'ATrCGATCGGGGCCW_W_~CGAGC3'. EMSA was performed as detailed previously [2]. Unlabelled specific competitor was added 5 rain before the labelled probe. Incubationwith antiserum was as described in Fig. 2.
306
M. Bourbonnibre, J. Nalbantoglu / Molecular Brain Research 35 t 1996) 304-308
A +
APP-EI PROBE
APP-E1
I
I
Ad-USF
]
Ad-USF USF anti-USF
~ 2
3
4
5
6
7
+
+ + +
+
8
-
_
I
2
+ +
3
4 5
..? m l
I
I
Fig. 2. Authentic USF forms a complex with APP-EI. A: End-labelled APP-EI (lanes 1-4) or Ad-USF (lanes 5 - 8 ) oligonucleotides were incubated with HeLa nuclear extracts and DNA-protein complexes were allowed to 12~rm for 20 min prior to the addition of a rabbit polyclonal anti-USF antiserum [22] and further incubation for 30 min. Lanes 1 and 5. without antiserum; lanes 2 and 6, in the presence of a I/5(X) dilution; and lanes 3 and 7. a 1/1000 dilution of the antiserum; lanes 4 and 7, in the presence of a 1/500 dilution of an unrelated rabbit antiserum. B: EMSA was performed with labelled oligonucleotides APP-EI (lanes 2 and 4) and Ad-USF (lane 3) using in vitro synthesized USF as a source of proteins. The TNT'" Coupled Reticulocytc Lysate System (Promega) was used as recommended by the manufacturer to synthesize in vitro the 43 kDa USF protein from 2 Ng of plasmid pAi2 [6]; 2 /zl of the total TNT'" reaction was used in binding assays. In lane 1. the binding occurred in presence of a reaction wherc T7 polymerase was omitted. No USF binding activity was detected. Arrowhead: supershift observed in presence of anti-USF antiserum; Bar: specific DNA-protein complexes: F: frec probe.
pCXUSF OP.1!lr ~-~~
~
.
~
r'--
+
IAdUS~IAausvl ITKI
r-'I i
0
•
i
"
1
!
2
"
i
i
3
4
RELATIVE CAT ACTIVITY
Fig. 3. Transactivation of human APP promoter by USF. Co-transfection of the cDNA for USF (pCXUSF) (15 p,g) or of carrier plasmid (15 /.tg), and a human APP promoter/CAT reporter gene construct (pKCXB) (15 tzg) or the control plasmid p2XAdMI,TF/TKCAT (15/zg) was carried out in presence of 30 /zg of Lipofectin (Gibco/BRL). Transfections were performed in triplicate using two independent plasmid preparations. CAT assays were carried out as de~ribed previously [2] and were quantitated on a Molecular Dynamics phosphorimager using Image Quant software. Percentage of acetylation (10-40%) was normalized to protein concentrations. CAT activity is expressed relative to the control transfections. The error bars indicate the standard error of the mean (n = 6).
M. Bourbonnibre, J. Nalbantoglu / Molecular Brain Research 35 (1996) 304-308
clear extracts from the neuronal cell lines PC12, NG108-15 and SK-N-SH (Fig. 1C, lanes 2, 4, 6). The complete shift of the APP-El-protein complex by the anti-USF antibody strongly suggests that a protein which is antigenically related to USF is the major protein interacting with APPEl. We confirmed that USF itself could bind directly to APP-E1 by performing EMSA with USF protein synthesized in a coupled in vitro transcription/translation system. Both APP-E1 and Ad-USF were bound by the in vitro translated USF (Fig. 2B, lanes 2 and 3) in a complex that was recognized by the anti-USF antibody (Fig. 2B, lane 4). Furthermore, polypeptides of similar molecular weight were bound during UV-crosslinking of APP-E1 and AdUSF to nuclear extracts, suggesting again direct interaction of USF which is present in HeLa nuclear extracts [22] with APP-E1 (data not shown). Co-transfection experiments in NG108-15 cells using a human APP promoter-CAT construct ( - 2 0 0 to + 100) and the plasmid pCXUSF which contains the USF cDNA under the control of the CMV promoter [5] resulted in a 70% increase of the CAT activity directed by the APP promoter (Fig. 3). Transactivation by USF is dependent on the number of E box elements [12] as demonstrated in Fig. 3 with the plasmid p2XAdMLTF/TKCAT, which contains two copies of the USF binding site of the adenovirus major late promoter ( - 6 9 to - 4 9 ) inserted upstream of the minimal promoter of the HSV TK gene [20]. These results indicate that USF can interact in vivo with the APP basal promoter to modulate APP gene transcription. USF, as a member of the bHLH family of transcription factors, binds DNA in vivo as a homo- or heterodimer of USF-1 (43 kDa) and USF-2 (44 kDa). These proteins, encoded by two different genes, are expressed ubiquitously at ratios that appear to be constant in all tissues examined [21]. In concordance with the almost ubiquitous expression of the APP gene, USF DNA binding activity has also been found in all cell lines so far tested [21]. To date, there is no information on the developmental expression of USF. Our results suggest that USF can contribute to the expression of the APP gene since an APP promoter-CAT reporter construct was transactivated by co-expression of USF cDNA. It remains to be seen how USF interacts with other transcription factors to modulate endogenous APP expression. Besides activating the adenovirus major late promoter by binding to an E box [18], USF has been shown to regulate a variety of cellular genes through interactions with upstream E boxes (as summarized in Sirito et al. [22]). The stimulatory effect of USF may be mediated through direct protein-protein interaction between USF and the transcriptional apparatus [15]. Binding of USF to its recognition sequences may also lead to formation of a nucleosome-free region over the promoter, increasing the accessibility of the region surrounding its binding site to basal initiation factors [24]. Involvement of USF in chromatin dynamics is further supported by the
307
report that USF binds with high affinity to an E box in the DNase I-hypersensitive site HS2 in the /3-globin locus control region [3]. There is also a DNase I-hypersensitive site in the proximity of the USF binding site of the human APP gene [9].
Acknowledgements We thank Drs. R.G. Roeder, M. Sawadogo, and H.C. Towle for providing plasmids and antibodies. We gratefully acknowledge Dr. G.J. Matlashewski for supplying the reagents for the in vitro transcription/translation system and Hugues Charest for performing these experiments. This work was supported by the Medical Research Council of Canada (MA-10407). M.B. was supported by the Alzheimer Society of Canada, J.N. is a Research Scholar of the Fonds de la recherche en sant6 du Qu6bec.
References [1] Beyreuther, K., Pollwein, P., Multhaup, G., Monning, U., Konig, G., Dyrks, T., Schubert, W. and Masters, C.L, Regulation and expression of the Alzheimer's f l / A 4 amyloid protein in health, disease and Down's syndrome, Ann. NYAcad. Sci., 695 (1993) 91-102• [2] Bourbonni~re, M. and Nalbantoglu, J., Expression of amyloid precursor protein in a neuronal cell line: functional activity of proximal regulatory elements, Mol. Brain Res., 19 (1993) 246-250. [3] Bresnick, E.H. and Felsenfeld, G., Evidence that the transcription factor USF is a component of the human fl-globin locus control region heteromeric protein complex, J. Biol. Chem., 268 (1993) 18824-18834. [4] Dignam, J.D., Lebovitz, R.M. and Roeder, R.G., Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei, Nucleic Acids Re.~., 11 (1983) 14751489. [5] Du, H., Roy, A.L. and Roeder, R.G., Human transcription factor USF stimulates transcription through the initiator elements of the HIV-1 and the Ad-ML promoters, EMBOJ., 12 (1993) 501-511• [6] Gregor, P.D., Sawadogo, M. and Roeder, R.G., The adenovirus major late transcription factor USF is a member of the helix-loophelix group of regulatory proteins and binds to DNA as a dimer, Genes Det.,., 4 (1990) 1730-1740. [7] Hoffman, P.W. and Chernak, J.M., The rat amyloid precursor protein promoter contains two DNA regulatory elements which influence high level gene expression, Biochem. Biophys. Res. Commun., 201 (1994) 610-617. [8] Izumi, R., Yamada, T., Yoshikai, S-I., Sasaki, H., Hattori, M. and Sakaki, Y., Positive and negative regulatory elements for the expression of the Alzheimer's disease amyloid precursor-encoding gene in mouse, Gene, 112 (1992) 189-195• [9] Lukiw, W.J., Rogaev, E.I., Wong, L., Vaula, G., McLachlan, D.R.C. and St George Hyslop, P., Protein-DNA interactions in the promoter region of the amyloid precursor protein (APP) gene in human neocortex, MoL Brain Res., 22 (1994) 121-131. [10] Pollwein, P., Overlapping binding sites of two different transcription factors in the promoter of the human gene for the Alzheimer amyloid precursor protein, Biochem. Biophys. Res. Commun., 190 (1993) 637-647. [11] Pollwein, P., Masters, C.L. and Beyreuther, K., The expression of
3118
[12]
[13]
[14]
[15]
[16]
[17]
[18]
M. Bourbonnii're, ,I. Nalbantoglu / Molecular Brain Research 35 (1996) 304-308
the amyloid precursor protein (APP) is rcgulated by two (i(-clcmcnts in the promoter, Nucleic Acids" Rex., 20 (1992) 63-68. Potter, J.J., Chcneval, D., Dang, C.V., Resar, L.M.S., Mczey. I-. and Wang, V.W., The upstream stimulatory factor binds It, and activates the promoter of the rat class I alcohol dehydrogenase gone. J. Biol. Chem., 266 ( 1991 ) 15457-15463. Ouitschkc, W.W.. Two nuclear factor binding domains activate expression from the human amyloid /3-protein precursor promotcr, .I. BioL (;hem., 269 (1994) 21229-21233. Ouitschke. W.W. and Goldgaber. D., The amyloid /3-protein precursor promoter. A region essential liar transcriptional activity contains, a nuclear factor binding domain, .I. Biol. ('hem., 267 (1992) 17362 17368. Roy. A.L., Meisterernst, M., Pognonec, P. and Rocdcr, R.(i.. (Aa~perativc interaction of an initiator-binding transcription initiation factor and the helix-loop-helix activator USF. Nature, 354 (19911 245-248. Salbaum, J.M. and Ruddle. I:.H., Embryonic expression pattern ot amyloid protein precursor suggests a role in diffcrcntiation of specific subsets of neurons, J. Exp. Zool.. 269 (1994) 111"~-127. Salbaum, J.M.. Weidemann, A., i.cmairc, II.-G.. Mastcrs, C.I,. and Beyreuther, K., The promoter of Alzheimcr's disease amvloid A4 prccursor gone, FMBO .1.. 7 (1988) 2807-2813. Sawadogo. M. and Rocdcr, R.G., Interaction o! a gone-specific
transcription factor with the adenovirus major late promoter upstream of the TATA box region, Cell, 43 (1985) 165-175. [19] Sclkoe, D.J., Normal and abnormal biology of the /3-amyloid precursor protcin, Annu. Ret. Neuroxci., 17 (1994) 489-517. [211] Shih, H.-M. and Towle, H.C., Definition of the carbohydrate rcsponse element of the rat S14 gene, J. Biol. Chem., 269 (1994) 9381)-9387. [21] Sirito, M., Lin, Q., Malty, T. and Sawadogo, M., Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells, Nucleic Acids Res., 22 (1994) 427-433. [22] Sirito. M , Walker, S., Lin, Q., Kozlowski. M.T., Klcin. W.ti. and Sawadogo, M., Members of the USF family of helix-kx~p-helix proteins bind DNA as homo- as well as hetcrodimers, Gene Expr., 2 (1992) 231-2411. 123] Tanzi. R.E., Gusella, J.F., Watkins, P.C., Bruns, G.A.P,, St. George-ltyslop, P., van Keuren, M.L., Patterson, D., Pagan, S., Kurnit, DM. and Neve, R.L., Amyloid /3 protein gene: eDNA. mRNA distribution and genetic linkage near the Alzheimer locus. Science, 235 (1987) 881)-883. [24] Workman, J.k., Rtveder, RG. and Kingston, R.E., An upstrcam transcription factor, USF (MLTF), facilitates the formation of preinitiation complexes during in vitro chromatin assembly, EMBO J., 9 ( 19911} 1299-13118.