- Email: [email protected]
The human Hsp70B gene at the HSPA7 locus of chromosome 1 is transcribed but non-functional
Biochimica et Biophysica Acta 1494 (2000) 201^205
www.elsevier.com/locate/bba
Short sequence-paper
The human Hsp70B gene at the HSPA7 locus of chromosome 1 is transcribed but non-functional Azemat J. Parsian a , Jamie E. Sheren a , Ting Y. Tao a , Prabhat C. Goswami a , Robert Malyapa a , Richard Van Rheeden b , Michael S. Watson b , Clayton R. Hunt a
a;
*
Department of Radiation Oncology, Division of Medical Genetics, Washington University School of Medicine, St. Louis, MO 63108, USA b Department of Pediatrics, Division of Medical Genetics, Washington University School of Medicine, St. Louis, MO 63108, USA Received 14 June 2000 ; received in revised form 4 August 2000; accepted 8 August 2000
Abstract The human heat-inducible Hsp70B and Hsp70BP genes were co-localized to 1q23.1 by in situ hybridization. However, though transcripts from Hsp70B could be detected in heat-shocked cells, DNA sequence analyses of both the gene and cDNA copies of the mRNA indicate the gene is non-functional. Moreover, mouse homologues of Hsp70B/BP were not detected by Southern blot analysis, suggesting Hsp70B/BP arose from either Hsp70-1or Hsp70-2 after the divergence of mice and humans. ß 2000 Elsevier Science B.V. All rights reserved. Keywords : Hsp70; Hsp70B ; Heat shock; Gene expression; Chromosome 1
The mammalian heat shock response is a highly conserved mechanism that contributes to protection from heat-induced cell killing. Characteristic of the response is the rapid induced synthesis of speci¢c heat shock proteins (HSP), the most prominent of which is the 70 000 kDa protein (HSP70). In humans four heat-inducible Hsp70 genes are known to exist. Two of these genes, Hsp70-1 (HSPA1A locus) and Hsp70-2 (HSPA1B locus), are found as a nearly identical tandem pair, along with the Hsp70related Hsc70t gene, in the major histocompatibility complex at 6p21.3 [1]. This tandem gene structure is highly conserved, as it is also present in the corresponding histocompatibility regions of mice, goats and other mammals [2^4]. The human Hsp70B clone (HSPA7 locus) was initially isolated as a gene fragment truncated in the 5P region [5] that promoter fusion studies established as heat inducible [6]. Subsequent studies have utilized the Hsp70B promoter to identify drugs that inhibit Hsp70 expression [7], to demonstrate repression of Hsp70 expression by MAPK induced phosphorylation of HSF-1 [8], and to determine the e¡ect of non-steroidal anti-in£ammatory drugs on Hsp70B expression [9]. A second full-length Hsp70 gene, Hsp70BP (HSPA6 locus), was subsequently isolated that
* Corresponding author. Fax: +1-314-362-9790; E-mail : [email protected]
had high homology to the Hsp70B gene fragment (94% amino acid) and less homology (77%) with the Hsp70-1 and Hsp70-2 genes [10,11]. These results established that Hsp70B and Hsp70BP were more closely related to each other than to the Hsp70-1 and Hsp70-2 pair and led to the suggestion they would also form a tandem functional pair. In order to establish more clearly the relationship between Hsp70B/BP and the Hsp70-1/-2 genes we isolated the human Hsp70B gene (HSPA7), characterized it then mapped the chromosomal location of both HSPA6 and HSPA7. Unexpectedly these experiments indicated that while Hsp70B mRNA is expressed in response to heat shock it does not encode a full length functional protein. A P1 human genomic library (Genome Systems, St. Louis, MO) was polymerase chain reaction (PCR) screened with two oligonucleotides whose sequences were derived from the published Hsp70B and Hsp70BP gene promoter sequences [10]. From this screening clone P434 was isolated and the Hsp70 homologous fragments, identi¢ed by Southern blot analysis, completely sequenced (data shown below). The location of the Hsp70B gene along with the Hsp70BP gene was determined by £uorescent in situ hybridization. The Hsp70B gene probe, P434 DNA, was labeled with digoxigenin-11-dUTP by nick translation, denatured then hybridized to chromosomes prepared from healthy donor lymphocytes. In addition, either biotin-labeled chromosome 1-speci¢c K-satellite repetitive DNA (Oncor) or a biotin-labeled lambda phage
0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 0 ) 0 0 2 0 3 - 7
BBAEXP 91467 31-10-00
Cyaan Magenta Geel Zwart
202
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
Fig. 1. Chromosomal localization of the human Hsp70B and Hsp70BP genes to 1q21.3 by in situ hybridization. P434 DNA containing the Hsp70B gene was labeled with digoxigenin-11-dUTP by nick translation and co-hybridized along with biotin-labeled chromosome 1-speci¢c Ksatellite repetitive DNA to human lymphocyte chromosome spreads. (A) Hsp70B probe (red) and chromosome 1 K-satellite-repetitive probe (green). (B) Simultaneous hybridization of Hsp70B (digoxigenin-labeled P434 DNA; red) and Hsp70BP (biotin labeled V20 DNA; green) probes to human chromosome 1.
DNA clone containing the Hsp70BP gene (kind gift of Dr L. Leung, University of Singapore) was added to the hybridization mixture. The Hsp70B locus (HSPA7) comapped along with the K-satellite marker to human chromosome 1 and could be further localized to 1q23.1 (Fig. 1). Similarly, the Hsp70BP signal (HSPA6) overlapped the Hsp70B signal at 1q23.1, indicating the two genes were both located within a limited region of 5-10 MB. Sequence analysis of the Hsp70B 3P untranslated region (UTR) and comparison to the published Hsp70BP UTR sequence [10] identi¢ed four di¡erences, two of which were single nucleotide changes and the third a transposed CT dinucleotide (Fig. 2). The fourth nucleotide di¡erence rep-
resented a 13 bp insert in Hsp70B relative to Hsp70BP (nucleotides 2241^2253). This di¡erence was utilized to simultaneously analyze Hsp70B and -BP mRNA transcripts in control and heat shocked cells by reverse transcriptase coupled PCR (25 cycles under conditions described previously [14]) with the primer pair 2125 CCCCATCATTGAGGAGGTTG2144 and 2341 GAAGCAGAAGAGGATGAACC2322 (Fig. 3A). Neither Hsp70B nor Hsp70BP transcripts were detected in WI38 or HeLa cells prior to heat shock. After a 15-min heat shock at 45³C followed by recovery at 37³C for 1 h, a prominent 204 nucleotide (nt) reverse transcriptase (RT)^ PCR product from the Hsp70BP mRNA was detected in both cell lines. The 217 nt product from Hsp70B mRNA was detected at low levels in WI38 cells and possibly in HeLa cells following heat shock. Similar analysis by RT^ PCR readily detected expression of Hsp70-1 (primers 2297 CCCCATCATCAGCGGACTG2311 and 2541 GGCAAGTTCAGTACTTCACC2522 ) and low-level Hsp70-2 expression (primers 2297 CCCCATCATCAGCGGACTG2311 and 2630 AACACCCTTACAGTATCAAC2611 ) in nonstressed cells that increased substantially following heat shock (Fig. 3B). Thus, expression of Hsp70B in these two cell lines occurs only after heat shock and at levels signi¢cantly lower than for Hsp70BP, Hsp70-1 or Hsp70-2. A complete DNA sequence analysis of the Hsp70B gene was carried out (GenBank accession AF093759) and the results are shown in Fig. 2 along with a comparison to the Hsp70BP sequence. The promoter sequence of Hsp70B corresponds to the published sequence of the 5P fragment [5] except for an AG dinucleotide insert at 101^102, an A insert at 121, a G inserted at 178 and an A inserted at 183. These changes all result in greater identity with the Hsp70BP promoter sequence suggesting they may correct minor errors. The distinguishing feature of the Hsp70B promoter, both here and in the previously published sequence, is the deletion of 20 nucleotides between nucleotides 51 and 52 that contain additional heat shock elements present in Hsp70BP. There are 20 single nucleotide changes within the Hsp70B coding region that result in 18 amino acid di¡erences and 2 CG di¡erences that alter two amino acids. In addition, an in-frame six-nucleotide deletion in Hsp70B occurs at nucleotide 1735 that removes two amino acids present in Hsp70BP. The nucleotide identity within the coding region is 98%. The Hsp70B/BP amino acid identity would be 96.5% if not for an extra adenine nucleotide inserted at position 1242 in Hsp70B relative to Hsp70BP. C
Fig. 2. Complete DNA sequence of the human Hsp70B gene and comparison with the Hsp70BP sequence. The Hsp70B nucleotide sequence (GenBank accession number AF093759) is indicated in uppercase letters and numbered to the right. The corresponding amino acid sequence is given in lowercase single-letter code above the nucleotide sequence and numbered to the left. Dots below the nucleotide sequence represent identical nucleotides between Hsp70B and Hsp70BP while dashes are gaps introduced during alignment. Nucleotide di¡erences in the Hsp70BP sequence are shown and when amino acid di¡erences result the Hsp70B amino acid is underlined. Numbering of the nucleotide sequences includes the inserted A at 1242 (double underline) but the amino acid sequence numbering excludes it. The ¢rst in-frame termination codon with the insertion is underlined at nucleotide 1324. Also underlined is the methionine initiation site at 233 and poly-adenylation signals at 2343 and 2464.
BBAEXP 91467 31-10-00
Cyaan Magenta Geel Zwart
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
BBAEXP 91467 31-10-00
Cyaan Magenta Geel Zwart
203
204
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
Fig. 3. Analysis of Hsp70B and Hsp70BP expression in control and heat shocked human cells by RT^PCR. Total cellular RNA was isolated from control (C) and heat-shocked (H) WI38 and HeLa cells then subjected to RT^PCR utilizing Hsp70 gene-speci¢c oligonucleotide primers and the products analyzed on 10% polyacrylamide gels. (A) Analysis of Hsp70B and Hsp70BP mRNA levels before and after heat shock using the Hsp70B/BP 3P UTR-speci¢c primers (upper panel) and identical analysis with GAPD-speci¢c primers (lower panel). (B) RT^PCR analysis of Hsp70-1 and Hsp70-2 mRNA levels before and after heat shock using identical 5P oligonucleotide primers paired with separate, speci¢c 3P primers. Lanes 1,2,5,6, Hsp70-1-speci¢c 3P primer ; lanes 3,4,7,8, Hsp702-speci¢c 3P primer.
This A nucleotide insertion in Hsp70B shifts translation in frame with a TGA termination codon at nucleotide 1324 indicating Hsp70B does not encode a full-length HSP70 protein. Two additional experiments support the presence of the A insert. First, the extra nucleotide was detected in P434 DNA by direct sequencing, indicating it did not arise as a result of mutation during subcloning (data not shown). Secondly, RNA prepared from heat shocked WI38 cells was subjected to RT^PCR with oligonucleotide primers £anking A1242 and the products cloned for sequence analysis. Six independent clones were sequenced of which two contained and four lacked the A insert (data not shown), re£ecting the presence of both of Hsp70B and Hsp70BP mRNA in WI38 cells following heat shock (Fig. 3). The A insertion accounts for the low level of Hsp70B mRNA observed in heat-shocked cells, as premature termination of translation is known to cause mRNA destabilization [12]. Similarly, the more robust expression of the truncated Hsp70B promoter in gene fusion studies [13] is likely due to removal of the coding region that contains the termination site. The ¢nding that Hsp70B is a non-functional gene raises some concerns about conclusions drawn from studies utilizing the promoter [7^9]. While it seems unlikely, if the results are speci¢c to the Hsp70B promoter then their biological signi¢cance is questionable. Mouse genomic or cDNA clones corresponding to the human Hsp70B or Hsp70BP genes have not been identi-
BBAEXP 91467 31-10-00
¢ed. The high degree of cross-species homology between individual Hsp70 genes suggests that an Hsp70B probe would detect homologous mouse DNA fragments during genomic Southern blot analysis. The region spanning amino acids 528 to 626 of the Hsp70B gene was synthesized by PCR ampli¢cation, radiolabeled and hybridized to a Southern blot containing HindIII and BglII restricted mouse and human genomic DNAs (Fig. 4). After hybridization the blots were washed with 0.4USSC/1% SDS at 65³C. Under these moderately stringent wash conditions, no signal was detected in either the HindIII or BglII restricted mouse DNA while two fragments and one fragment, respectively, were detected in the corresponding human genomic DNAs. These DNA fragments could be assigned to speci¢c Hsp70B and Hsp70BP genes based upon the previous gene characterization. To test the validity of the experimental approach, the nearly identical region from the human Hsp70-1 gene was ampli¢ed (amino acids 529^630), radiolabeled and hybridized to the same Southern blot without removing the initial probe. In this case the mouse homologues of the human Hsp701/Hsp70-2 genes, Hsp70-3 and Hsp70-1 respectively, were easily detected and could be assigned to speci¢c DNA fragments based upon fragment size. While not de¢nitive, these results suggest the Hsp70B/BP genes are the ¢rst members of the human Hsp70 gene family without homologues in the mouse genome. The Hsp70BP gene, therefore, was probably derived initially from either Hsp70-1 or Hsp70-2, in an event that may have occurred early after the divergence of mice from humans, and subsequently duplicated to give rise to Hsp70B. Why Hsp70B as op-
Fig. 4. Genome southern blot analysis to detect mouse homologues of the human Hsp70B/BP genes. Ten Wg of mouse (Mu) and human (Hu) genome DNA was restricted with BglII (G) or HindIII (H) and analyzed by Southern blotting. Left panel, hybridization with human Hsp70B/BP probe; right panel, same membrane hybridized with human Hsp70-1/-2 probe. Hybridizing DNA fragments corresponding to the known human or mouse Hsp70 genes are identi¢ed.
Cyaan Magenta Geel Zwart
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
posed to Hsp70BP began to accumulate mutations is an interesting question that may be related to chromosome position.
[7]
This work was supported by NCI Grants CA60757 (C.R.H.) and CA69593 (P.C.G.).
[8]
References
[9]
[1] C.M. Milner, R.D. Campbell, Structure and expression of the three MHC-linked HSP70 genes, Immunogenetics 32 (1990) 242^251. [2] C.R. Hunt, D.L. Gasser, D.D. Chaplin, J.C. Pierce, C.A. Kozak, Chromosomal localization of ¢ve murine HSP70 gene family members: Hsp70-1, Hsp70-2, Hsp70-3, Hsc70t, and Grp78, Genomics 16 (1993) 193^198. [3] M. Snoek, M. Jansen, J.G. Olavesen, R.D. Campbell, C. Teuscher, H. van Vugt, Three Hsp70 genes are located in the C4-H-2D region: possible candidates for the Orch-1 locus, Genomics 15 (1993) 350^ 356. [4] P.U. Cameron, H.A. Tabarias, B. Pulendran, W. Robinson, R.L. Dawkins, Conservation of the central MHC genome: PFGE mapping and RFLP analysis of complement, HSP70, and TNF genes in the goat, Immunogenetics 31 (1990) 253^264. [5] R. Voellmy, A. Ahmed, P. Schiller, P. Bromley, D. Rungger, Isolation and functional analysis of a human 70,000 dalton heat shock protein gene segment, Proc. Natl. Acad. Sci. USA 82 (1985) 4949^ 4953. [6] P. Schiller, J. Amin, J. Ananthan, M.E. Brown, W.A. Scott, R.
BBAEXP 91467 31-10-00
[10]
[11]
[12]
[13]
[14]
205
Voellmy, Cis-acting elements involved in the regulated expression of a human HSP70 gene, J. Mol. Biol. 203 (1988) 97^105. H. Akagawa, Y. Takano, A. Ishii, S. Mizuno, R. Izui, T. Sameshima, N. Kawamura, K. Dobashi, T. Yoshioka, B. Stresgenin, inhibitor of heat-induced heat shock protein gene expression, produced by Streptomyces sp. AS-9, J. Antibiot. 52 (1999) 960^970. B. Chu, F. Soncin, B.D. Price, M.A. Stevenson, S.K. Calderwood, Sequential phosphorylation by mitogen-activated protein kinase and glycogen synthase kinase 3 represses transcriptional activation by heat shock factor-1, J. Biol. Chem. 271 (1996) 30847^30857. J.N. Housby, C.M. Cahill, B. Chu, R. Prevelige, K. Bickford, M.A. Stevenson, S.K. Calderwood, Non-steroidal anti-in£ammatory drugs inhibit the expression of cytokines and induce Hsp70 in human monocytes, Cytokine 11 (1998) 347^358. T.K.C. Leung, M.Y. Rajendran, C. Monfries, C. Hall, L. Lim, The human heat-shock protein family : Expression of a novel heat-inducible HSP70 (HSP70BP) and isolation of its cDNA and genomic DNA, Biochem. J. 267 (1980) 125^132. T.K.C. Leung, C. Hall, M. Rajendran, N.K. Spurr, L. Lim, The human heat-shock genes HSPA6 and HSPA7 are both expressed and localize to chromosome 1, Genomics 12 (1992) 74^79. L.E. Maquat, Defects in RNA splicing and the consequence of shortened translational reading frames, Am. J. Hum. Genet. 59 (1996) 279^286. M. Dreano, J. Brochot, A. Myers, C. Cheng-Meyer, D. Rungger, R. Voellmy, P. Bromley, High-level, heat-regulated synthesis of proteins in eukaryotic cells, Gene 49 (1986) 1^8. P.C. Goswami, L.D. Albee, D.R. Spitz, L.A. Ridnour, A polymerase chain reaction assay for simultaneous detection and quantitation of proto-oncogene and GAPD mRNAs in di¡erent cell growth rates, Cell. Prolif. 30 (1997) 271^282.
Cyaan Magenta Geel Zwart
www.elsevier.com/locate/bba
Short sequence-paper
The human Hsp70B gene at the HSPA7 locus of chromosome 1 is transcribed but non-functional Azemat J. Parsian a , Jamie E. Sheren a , Ting Y. Tao a , Prabhat C. Goswami a , Robert Malyapa a , Richard Van Rheeden b , Michael S. Watson b , Clayton R. Hunt a
a;
*
Department of Radiation Oncology, Division of Medical Genetics, Washington University School of Medicine, St. Louis, MO 63108, USA b Department of Pediatrics, Division of Medical Genetics, Washington University School of Medicine, St. Louis, MO 63108, USA Received 14 June 2000 ; received in revised form 4 August 2000; accepted 8 August 2000
Abstract The human heat-inducible Hsp70B and Hsp70BP genes were co-localized to 1q23.1 by in situ hybridization. However, though transcripts from Hsp70B could be detected in heat-shocked cells, DNA sequence analyses of both the gene and cDNA copies of the mRNA indicate the gene is non-functional. Moreover, mouse homologues of Hsp70B/BP were not detected by Southern blot analysis, suggesting Hsp70B/BP arose from either Hsp70-1or Hsp70-2 after the divergence of mice and humans. ß 2000 Elsevier Science B.V. All rights reserved. Keywords : Hsp70; Hsp70B ; Heat shock; Gene expression; Chromosome 1
The mammalian heat shock response is a highly conserved mechanism that contributes to protection from heat-induced cell killing. Characteristic of the response is the rapid induced synthesis of speci¢c heat shock proteins (HSP), the most prominent of which is the 70 000 kDa protein (HSP70). In humans four heat-inducible Hsp70 genes are known to exist. Two of these genes, Hsp70-1 (HSPA1A locus) and Hsp70-2 (HSPA1B locus), are found as a nearly identical tandem pair, along with the Hsp70related Hsc70t gene, in the major histocompatibility complex at 6p21.3 [1]. This tandem gene structure is highly conserved, as it is also present in the corresponding histocompatibility regions of mice, goats and other mammals [2^4]. The human Hsp70B clone (HSPA7 locus) was initially isolated as a gene fragment truncated in the 5P region [5] that promoter fusion studies established as heat inducible [6]. Subsequent studies have utilized the Hsp70B promoter to identify drugs that inhibit Hsp70 expression [7], to demonstrate repression of Hsp70 expression by MAPK induced phosphorylation of HSF-1 [8], and to determine the e¡ect of non-steroidal anti-in£ammatory drugs on Hsp70B expression [9]. A second full-length Hsp70 gene, Hsp70BP (HSPA6 locus), was subsequently isolated that
* Corresponding author. Fax: +1-314-362-9790; E-mail : [email protected]
had high homology to the Hsp70B gene fragment (94% amino acid) and less homology (77%) with the Hsp70-1 and Hsp70-2 genes [10,11]. These results established that Hsp70B and Hsp70BP were more closely related to each other than to the Hsp70-1 and Hsp70-2 pair and led to the suggestion they would also form a tandem functional pair. In order to establish more clearly the relationship between Hsp70B/BP and the Hsp70-1/-2 genes we isolated the human Hsp70B gene (HSPA7), characterized it then mapped the chromosomal location of both HSPA6 and HSPA7. Unexpectedly these experiments indicated that while Hsp70B mRNA is expressed in response to heat shock it does not encode a full length functional protein. A P1 human genomic library (Genome Systems, St. Louis, MO) was polymerase chain reaction (PCR) screened with two oligonucleotides whose sequences were derived from the published Hsp70B and Hsp70BP gene promoter sequences [10]. From this screening clone P434 was isolated and the Hsp70 homologous fragments, identi¢ed by Southern blot analysis, completely sequenced (data shown below). The location of the Hsp70B gene along with the Hsp70BP gene was determined by £uorescent in situ hybridization. The Hsp70B gene probe, P434 DNA, was labeled with digoxigenin-11-dUTP by nick translation, denatured then hybridized to chromosomes prepared from healthy donor lymphocytes. In addition, either biotin-labeled chromosome 1-speci¢c K-satellite repetitive DNA (Oncor) or a biotin-labeled lambda phage
0167-4781 / 00 / $ ^ see front matter ß 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 7 - 4 7 8 1 ( 0 0 ) 0 0 2 0 3 - 7
BBAEXP 91467 31-10-00
Cyaan Magenta Geel Zwart
202
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
Fig. 1. Chromosomal localization of the human Hsp70B and Hsp70BP genes to 1q21.3 by in situ hybridization. P434 DNA containing the Hsp70B gene was labeled with digoxigenin-11-dUTP by nick translation and co-hybridized along with biotin-labeled chromosome 1-speci¢c Ksatellite repetitive DNA to human lymphocyte chromosome spreads. (A) Hsp70B probe (red) and chromosome 1 K-satellite-repetitive probe (green). (B) Simultaneous hybridization of Hsp70B (digoxigenin-labeled P434 DNA; red) and Hsp70BP (biotin labeled V20 DNA; green) probes to human chromosome 1.
DNA clone containing the Hsp70BP gene (kind gift of Dr L. Leung, University of Singapore) was added to the hybridization mixture. The Hsp70B locus (HSPA7) comapped along with the K-satellite marker to human chromosome 1 and could be further localized to 1q23.1 (Fig. 1). Similarly, the Hsp70BP signal (HSPA6) overlapped the Hsp70B signal at 1q23.1, indicating the two genes were both located within a limited region of 5-10 MB. Sequence analysis of the Hsp70B 3P untranslated region (UTR) and comparison to the published Hsp70BP UTR sequence [10] identi¢ed four di¡erences, two of which were single nucleotide changes and the third a transposed CT dinucleotide (Fig. 2). The fourth nucleotide di¡erence rep-
resented a 13 bp insert in Hsp70B relative to Hsp70BP (nucleotides 2241^2253). This di¡erence was utilized to simultaneously analyze Hsp70B and -BP mRNA transcripts in control and heat shocked cells by reverse transcriptase coupled PCR (25 cycles under conditions described previously [14]) with the primer pair 2125 CCCCATCATTGAGGAGGTTG2144 and 2341 GAAGCAGAAGAGGATGAACC2322 (Fig. 3A). Neither Hsp70B nor Hsp70BP transcripts were detected in WI38 or HeLa cells prior to heat shock. After a 15-min heat shock at 45³C followed by recovery at 37³C for 1 h, a prominent 204 nucleotide (nt) reverse transcriptase (RT)^ PCR product from the Hsp70BP mRNA was detected in both cell lines. The 217 nt product from Hsp70B mRNA was detected at low levels in WI38 cells and possibly in HeLa cells following heat shock. Similar analysis by RT^ PCR readily detected expression of Hsp70-1 (primers 2297 CCCCATCATCAGCGGACTG2311 and 2541 GGCAAGTTCAGTACTTCACC2522 ) and low-level Hsp70-2 expression (primers 2297 CCCCATCATCAGCGGACTG2311 and 2630 AACACCCTTACAGTATCAAC2611 ) in nonstressed cells that increased substantially following heat shock (Fig. 3B). Thus, expression of Hsp70B in these two cell lines occurs only after heat shock and at levels signi¢cantly lower than for Hsp70BP, Hsp70-1 or Hsp70-2. A complete DNA sequence analysis of the Hsp70B gene was carried out (GenBank accession AF093759) and the results are shown in Fig. 2 along with a comparison to the Hsp70BP sequence. The promoter sequence of Hsp70B corresponds to the published sequence of the 5P fragment [5] except for an AG dinucleotide insert at 101^102, an A insert at 121, a G inserted at 178 and an A inserted at 183. These changes all result in greater identity with the Hsp70BP promoter sequence suggesting they may correct minor errors. The distinguishing feature of the Hsp70B promoter, both here and in the previously published sequence, is the deletion of 20 nucleotides between nucleotides 51 and 52 that contain additional heat shock elements present in Hsp70BP. There are 20 single nucleotide changes within the Hsp70B coding region that result in 18 amino acid di¡erences and 2 CG di¡erences that alter two amino acids. In addition, an in-frame six-nucleotide deletion in Hsp70B occurs at nucleotide 1735 that removes two amino acids present in Hsp70BP. The nucleotide identity within the coding region is 98%. The Hsp70B/BP amino acid identity would be 96.5% if not for an extra adenine nucleotide inserted at position 1242 in Hsp70B relative to Hsp70BP. C
Fig. 2. Complete DNA sequence of the human Hsp70B gene and comparison with the Hsp70BP sequence. The Hsp70B nucleotide sequence (GenBank accession number AF093759) is indicated in uppercase letters and numbered to the right. The corresponding amino acid sequence is given in lowercase single-letter code above the nucleotide sequence and numbered to the left. Dots below the nucleotide sequence represent identical nucleotides between Hsp70B and Hsp70BP while dashes are gaps introduced during alignment. Nucleotide di¡erences in the Hsp70BP sequence are shown and when amino acid di¡erences result the Hsp70B amino acid is underlined. Numbering of the nucleotide sequences includes the inserted A at 1242 (double underline) but the amino acid sequence numbering excludes it. The ¢rst in-frame termination codon with the insertion is underlined at nucleotide 1324. Also underlined is the methionine initiation site at 233 and poly-adenylation signals at 2343 and 2464.
BBAEXP 91467 31-10-00
Cyaan Magenta Geel Zwart
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
BBAEXP 91467 31-10-00
Cyaan Magenta Geel Zwart
203
204
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
Fig. 3. Analysis of Hsp70B and Hsp70BP expression in control and heat shocked human cells by RT^PCR. Total cellular RNA was isolated from control (C) and heat-shocked (H) WI38 and HeLa cells then subjected to RT^PCR utilizing Hsp70 gene-speci¢c oligonucleotide primers and the products analyzed on 10% polyacrylamide gels. (A) Analysis of Hsp70B and Hsp70BP mRNA levels before and after heat shock using the Hsp70B/BP 3P UTR-speci¢c primers (upper panel) and identical analysis with GAPD-speci¢c primers (lower panel). (B) RT^PCR analysis of Hsp70-1 and Hsp70-2 mRNA levels before and after heat shock using identical 5P oligonucleotide primers paired with separate, speci¢c 3P primers. Lanes 1,2,5,6, Hsp70-1-speci¢c 3P primer ; lanes 3,4,7,8, Hsp702-speci¢c 3P primer.
This A nucleotide insertion in Hsp70B shifts translation in frame with a TGA termination codon at nucleotide 1324 indicating Hsp70B does not encode a full-length HSP70 protein. Two additional experiments support the presence of the A insert. First, the extra nucleotide was detected in P434 DNA by direct sequencing, indicating it did not arise as a result of mutation during subcloning (data not shown). Secondly, RNA prepared from heat shocked WI38 cells was subjected to RT^PCR with oligonucleotide primers £anking A1242 and the products cloned for sequence analysis. Six independent clones were sequenced of which two contained and four lacked the A insert (data not shown), re£ecting the presence of both of Hsp70B and Hsp70BP mRNA in WI38 cells following heat shock (Fig. 3). The A insertion accounts for the low level of Hsp70B mRNA observed in heat-shocked cells, as premature termination of translation is known to cause mRNA destabilization [12]. Similarly, the more robust expression of the truncated Hsp70B promoter in gene fusion studies [13] is likely due to removal of the coding region that contains the termination site. The ¢nding that Hsp70B is a non-functional gene raises some concerns about conclusions drawn from studies utilizing the promoter [7^9]. While it seems unlikely, if the results are speci¢c to the Hsp70B promoter then their biological signi¢cance is questionable. Mouse genomic or cDNA clones corresponding to the human Hsp70B or Hsp70BP genes have not been identi-
BBAEXP 91467 31-10-00
¢ed. The high degree of cross-species homology between individual Hsp70 genes suggests that an Hsp70B probe would detect homologous mouse DNA fragments during genomic Southern blot analysis. The region spanning amino acids 528 to 626 of the Hsp70B gene was synthesized by PCR ampli¢cation, radiolabeled and hybridized to a Southern blot containing HindIII and BglII restricted mouse and human genomic DNAs (Fig. 4). After hybridization the blots were washed with 0.4USSC/1% SDS at 65³C. Under these moderately stringent wash conditions, no signal was detected in either the HindIII or BglII restricted mouse DNA while two fragments and one fragment, respectively, were detected in the corresponding human genomic DNAs. These DNA fragments could be assigned to speci¢c Hsp70B and Hsp70BP genes based upon the previous gene characterization. To test the validity of the experimental approach, the nearly identical region from the human Hsp70-1 gene was ampli¢ed (amino acids 529^630), radiolabeled and hybridized to the same Southern blot without removing the initial probe. In this case the mouse homologues of the human Hsp701/Hsp70-2 genes, Hsp70-3 and Hsp70-1 respectively, were easily detected and could be assigned to speci¢c DNA fragments based upon fragment size. While not de¢nitive, these results suggest the Hsp70B/BP genes are the ¢rst members of the human Hsp70 gene family without homologues in the mouse genome. The Hsp70BP gene, therefore, was probably derived initially from either Hsp70-1 or Hsp70-2, in an event that may have occurred early after the divergence of mice from humans, and subsequently duplicated to give rise to Hsp70B. Why Hsp70B as op-
Fig. 4. Genome southern blot analysis to detect mouse homologues of the human Hsp70B/BP genes. Ten Wg of mouse (Mu) and human (Hu) genome DNA was restricted with BglII (G) or HindIII (H) and analyzed by Southern blotting. Left panel, hybridization with human Hsp70B/BP probe; right panel, same membrane hybridized with human Hsp70-1/-2 probe. Hybridizing DNA fragments corresponding to the known human or mouse Hsp70 genes are identi¢ed.
Cyaan Magenta Geel Zwart
A.J. Parsian et al. / Biochimica et Biophysica Acta 1494 (2000) 201^205
posed to Hsp70BP began to accumulate mutations is an interesting question that may be related to chromosome position.
[7]
This work was supported by NCI Grants CA60757 (C.R.H.) and CA69593 (P.C.G.).
[8]
References
[9]
[1] C.M. Milner, R.D. Campbell, Structure and expression of the three MHC-linked HSP70 genes, Immunogenetics 32 (1990) 242^251. [2] C.R. Hunt, D.L. Gasser, D.D. Chaplin, J.C. Pierce, C.A. Kozak, Chromosomal localization of ¢ve murine HSP70 gene family members: Hsp70-1, Hsp70-2, Hsp70-3, Hsc70t, and Grp78, Genomics 16 (1993) 193^198. [3] M. Snoek, M. Jansen, J.G. Olavesen, R.D. Campbell, C. Teuscher, H. van Vugt, Three Hsp70 genes are located in the C4-H-2D region: possible candidates for the Orch-1 locus, Genomics 15 (1993) 350^ 356. [4] P.U. Cameron, H.A. Tabarias, B. Pulendran, W. Robinson, R.L. Dawkins, Conservation of the central MHC genome: PFGE mapping and RFLP analysis of complement, HSP70, and TNF genes in the goat, Immunogenetics 31 (1990) 253^264. [5] R. Voellmy, A. Ahmed, P. Schiller, P. Bromley, D. Rungger, Isolation and functional analysis of a human 70,000 dalton heat shock protein gene segment, Proc. Natl. Acad. Sci. USA 82 (1985) 4949^ 4953. [6] P. Schiller, J. Amin, J. Ananthan, M.E. Brown, W.A. Scott, R.
BBAEXP 91467 31-10-00
[10]
[11]
[12]
[13]
[14]
205
Voellmy, Cis-acting elements involved in the regulated expression of a human HSP70 gene, J. Mol. Biol. 203 (1988) 97^105. H. Akagawa, Y. Takano, A. Ishii, S. Mizuno, R. Izui, T. Sameshima, N. Kawamura, K. Dobashi, T. Yoshioka, B. Stresgenin, inhibitor of heat-induced heat shock protein gene expression, produced by Streptomyces sp. AS-9, J. Antibiot. 52 (1999) 960^970. B. Chu, F. Soncin, B.D. Price, M.A. Stevenson, S.K. Calderwood, Sequential phosphorylation by mitogen-activated protein kinase and glycogen synthase kinase 3 represses transcriptional activation by heat shock factor-1, J. Biol. Chem. 271 (1996) 30847^30857. J.N. Housby, C.M. Cahill, B. Chu, R. Prevelige, K. Bickford, M.A. Stevenson, S.K. Calderwood, Non-steroidal anti-in£ammatory drugs inhibit the expression of cytokines and induce Hsp70 in human monocytes, Cytokine 11 (1998) 347^358. T.K.C. Leung, M.Y. Rajendran, C. Monfries, C. Hall, L. Lim, The human heat-shock protein family : Expression of a novel heat-inducible HSP70 (HSP70BP) and isolation of its cDNA and genomic DNA, Biochem. J. 267 (1980) 125^132. T.K.C. Leung, C. Hall, M. Rajendran, N.K. Spurr, L. Lim, The human heat-shock genes HSPA6 and HSPA7 are both expressed and localize to chromosome 1, Genomics 12 (1992) 74^79. L.E. Maquat, Defects in RNA splicing and the consequence of shortened translational reading frames, Am. J. Hum. Genet. 59 (1996) 279^286. M. Dreano, J. Brochot, A. Myers, C. Cheng-Meyer, D. Rungger, R. Voellmy, P. Bromley, High-level, heat-regulated synthesis of proteins in eukaryotic cells, Gene 49 (1986) 1^8. P.C. Goswami, L.D. Albee, D.R. Spitz, L.A. Ridnour, A polymerase chain reaction assay for simultaneous detection and quantitation of proto-oncogene and GAPD mRNAs in di¡erent cell growth rates, Cell. Prolif. 30 (1997) 271^282.
Cyaan Magenta Geel Zwart