- Email: [email protected]
The IMD pathway regulates lysozyme-like proteins (LLPs) in the silkmoth Antheraea mylitta
Accepted Manuscript The IMD pathway regulates lysozyme-like proteins (LLPs) in the silkmoth Antheraea mylitta Valluri V. Satyavathi, Amr A. Mohamed, Swetha Kumari, Dadala M. Mamatha, Bernard Duvic PII: DOI: Reference:
S0022-2011(18)30009-0 https://doi.org/10.1016/j.jip.2018.04.006 YJIPA 7088
To appear in:
Journal of Invertebrate Pathology
Received Date: Revised Date: Accepted Date:
11 January 2018 2 April 2018 16 April 2018
Please cite this article as: Satyavathi, V.V., Mohamed, A.A., Kumari, S., Mamatha, D.M., Duvic, B., The IMD pathway regulates lysozyme-like proteins (LLPs) in the silkmoth Antheraea mylitta, Journal of Invertebrate Pathology (2018), doi: https://doi.org/10.1016/j.jip.2018.04.006
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
The IMD pathway regulates lysozyme-like proteins (LLPs) in the silkmoth Antheraea mylitta
Valluri V. Satyavathi1, Amr A. Mohamed2*, Swetha Kumari1, Dadala M Mamatha3, Bernard Duvic4
1
Centre of Excellence for Genetics and Genomics of Silkmoths, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500 001, India
2
Department of Entomology, Faculty of Science, Cairo University, Giza, PO Box 12613, Egypt
3
Sri Padmavati Mahila Visvavidyalayam (Women’s University), Tirupati 517502 A.P. India
4
DGIMI, INRA, Univ Montpellier, Montpellier, France
*Correspondence author: Amr A. Mohamed, Faculty of Science, Department of Entomology, Cairo University, PO Box 12613 Giza, Egypt. Tel: +2 01069431998; fax: +2 02 35728843; email: [email protected] This article is dedicated to Dr. Javaregowda Nagaraju who inspired sericulture research and team members, VVS and AAM, for years.
1
Abstract
Lysozyme-like proteins (LLPs) are members of the glycoside hydrolase family 22 (CAZY GH22). Unlike conventional c-type lysozymes (EC 3.2.1.17), LLPs lack specific catalytic amino acid residues essential for muramidase activity. Previous reports indicated upregulation of LLPs upon bacterial infection in the wild silkworm, Antheraea mylitta as well as in the domesticated silkworm, Bombyx mori. In the present work, we studied the signaling pathways mediating the production of LLPs using RNA interference-mediated knockdown of Spätzle, Relish and STAT, the key regulators of Toll, IMD (Immune deficiency) and JAK/STAT pathways, respectively. We observed that knockdown of the Relish variant RD1 resulted in reduced expression levels of the ALLP1. We also showed that recombinant LLP has antiviral activity. We infer that LLPs showing both antibacterial and antiviral activity are regulated by the conventional IMD pathway in the silkmoths.
Keywords: Silkmoths; Immunity; lysozyme-like proteins; IMD; antiviral immunity; RNAi
2
1. Introduction
Insects’ immunity mostly relies on efficient innate components for their immune defences (Hoffman et al., 1999; Satyavathi et al., 2014; Hillyer, 2016). These include antimicrobial peptides (AMPs), immune-competent hemocytes equivalent to vertebrate macrophages, prophenoloxidase system (and associated molecules), reactive oxygen and nitrogen species, and hemolymph complement-like thioester-containing proteins. The immune repertoire of silkworms, Antheraea mylitta and Bombyx mori, and other insects were shown to be endowed with a new class of non-catalytic antimicrobial proteins, the lysozyme-like proteins (LLPs) (Gandhe et al., 2007). The LLPs lack the specific catalytic amino acid residues, Glu32 and Asp50 (from B. mori lysozyme sequence), fundamental for muramidase activity of the classic c-type lysozymes (c-type Lys) (Gandhe et al., 2007). Unlike the mechanistic action of the ctype Lys and other cationic AMPs which depend on murein hydrolysis or permeabilization of the inner bacterial membrane, LLPs rely on peptidoglycan (PGN) binding. Upon bacterial infection, LLPs are upregulated and exhibit a wide-ranging antibacterial action. Furthermore, in vivo hemolymph bacterial load was dramatically increased post-siRNA-mediated repression of LLPs in both wild and domesticated silkworm larvae, with apparent changes in their expression dynamics (Gandhe et al., 2007). The mechanisms underlying the regulation of LLPs transcription and expression are not fully understood yet.
Insect immune system is very complex, with pathways implicated in surveillance, signaling, and responsiveness to the occurrence of mutualistic, harmless, and pathogenic species within insect body (Cherry and Silverman, 2006). Homologous to the mammalian Interleukin 1 receptor pathways and Tumor Necrosis Factor-α signaling cascades, insects have two distinct NF-κB pathways, Toll and IMD (Immune deficiency). Both regulate AMPs production by recruiting the NF-κB transcription factors Dorsal/Dif and Relish, respectively (Tanji and Ip, 2005; Marmaras and Lampropoulou, 2009). A large part of our knowledge on these pathways comes from the pioneer studies in Drosophila and little is known in other insects. Toll pathway is implicated in the regulation of genes encoding AMPs against Gram-positive bacteria and fungi. Activation is dependent on a processed form of the cysteine-knot cytokine-like protein, the Toll ligand, Spätzle (Spz). The recognition of the pathogenassociated molecular pattern (PAMP) is initiated by the pattern recognition receptors (PRRs) GNBP1/PGRP-SA or PGRP-SD for Gram positive bacteria containing Lys-type PGNs, and GNBP3 for fungi (Maillet et al., 2008). 3
The IMD pathway is predominantly involved in the regulation of the anti-Gram-negative AMPs coding genes (Tanji and Ip, 2005; Myllymäki et al., 2014). This occurs through activation of the NF-κB transcription factor, Relish. Like the Toll pathway, microbial recognition is the first step initiating the immune responses via the IMD pathway (Kleino and Silverman, 2014). The key players of the IMD pathway include the upstream transmembrane receptor PGRP-LC with the PGRP-LE as a co-receptor, the IMD, the Transforming growth factor beta activated kinase 1 (TAK1), the Drosophila Fas-associated protein with Death Domain (dFADD), the caspase-8 homolog Death-related ced-3/Nedd2-like protein (DREDD), the Drosophila inhibitor of κB kinase (IKK) complex, and the NF-κB transcription factor Relish. The subcellular localization of these components and their regulation upon immune stimuli is not fully understood. PGRP-LC resides at the plasma membrane, but IMD is typically localized in the nucleus and can only be detected at the plasma membrane upon activation (Boyer et al., 2011). Orthologs of intracellular components of both Toll and IMD pathways have been identified in the genome of the silkworm B. mori (Tanaka et al., 2008). However, on the evolutionally context, they were not well conserved between B. mori and D. melanogaster.
Despite the economic value of silkworms, little is known about the pathways regulating their humoral immune responses and production of soluble effector proteins. In this report, we propped the key regulators of the Toll and IMD signaling pathways in the wild tasar silkworm A. mylitta, the spaetzle and relish, respectively mediating the ALLP1 activation and depicting how fat body cells respond to infection of bacteria in an attempt to heighten the controlling regulatory networks of these responses. We also analyzed the expression patterns of ALLP1 and BmLLP1 under microbial challenge and performed a preliminary in vivo functional characterization of the secreted protein (ALLP1).
2. Materials and Methods
2.1. Silkworms and microbes Larvae of wild silkmoth A. mylitta provided by Regional Tasar Research Station, Warangal, have been used for the experiments. Larvae of domesticated silkworm Bombyx mori were provided by Andhra Pradesh State Sericulture Research and Development Institute (APSSRDI), Hindupur. For immune challenge, the following microbes have been used; 4
laboratory-maintained Escherichia coli strain MG1655 and B. mori Nucleopolyhedrosis virus (BmNPV), an isolate that was originated from farmers’ silkworm rearing house, purified, and maintained in the Laboratory of Molecular Genetics, CDFD, Hyderabad (Subbaiah et al., 2013).
2.2. Primer design and gene sequences Sequences of lysozyme-like protein namely, ALLP1 was retrieved from NCBI and multiple sequence alignment was carried out using ClustalW. The sequences LLPs (GenBank: EF517396.1 for Antheraea mylitta and EF517397.1 for Bombyx mori) and those of signaling pathways, Spätzle (Spz)(NM_001114594.1), Relish variant 1 (RD1)(NM_001102465.1) or variant 2 (RD2)(NM_001105234.1), and STAT (Stat)(NM_001163916.1) were retrieved from NCBI. The primers were designed using Primer 3 Tool (Table 1).
2.3. Phylogenetic analysis Phylogenetic analysis was done by comparison of c-type lysozyme and lysozyme-like protein sequences of A. mylitta and B. mori with similar protein sequences of other lepidopteran insects obtained by blastp on NCBI. Phylogenetic tree was constructed with the Maximum Likelihood method (Guindon et al., 2010) using PhyML 3.0, available at: http://www.atgcmontpellier.fr/phyml/versions.php
2.4. Real time PCR A. mylitta and B. mori 5th instar, day 3 larvae were challenged with log phase E. coli according to Gandhe et al. (2007). Sterile saline-injected larvae were used as control. Fat body tissue was collected after 4, 8, 12, 16 and 20 h post bacterial infection and the material collected in liquid nitrogen was stored at -70°C freezer until further use. RNA isolation was done by using Trizol method. Fat body tissues were grinded using mortar and pestle and homogenized with 1.0 mL Trizol. The solution was centrifuged at 13,000 rpm for 10 min at 4°C. The pellet was discarded and to the supernatant 200 µL (per 1 mL of Trizol) of chloroform was added, mixed well and centrifuged at the same speed. The upper aqueous phase is collected and ¼th volume of isopropanol was added and incubated at -20°C for 1 hour. The pellet recovered after centrifugation was washed with 70% ethanol by centrifuging at 12,000 rpm for about 5 min at 4°C and air dried. The dried pellet was dissolved in 20 L of DEPC water and the concentration was checked using NanoDrop (Thermo Scientific Inc).
5
RNA obtained was treated with DNase (Invitrogen) as per the instruction provided in the manual. cDNA was synthesized as described by Satyavathi et al. (2016). 1.5 µg of total RNA was taken for cDNA synthesis. First strand synthesis was made using oligodT primer and MMLV reverse transcriptase enzyme (Invitrogen). Real-time PCR was performed with SYBR green mix (Takara) on RT-7500 system (Applied Biosystems, Foster City, CA USA) with gene specific primers (listed in Table 1), and their amplification efficiencies were determined, under the following conditions: initial denaturation at 50°C for 2 min and at 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec and 60°C for 34 sec. Negative controls comprised no cDNA template (nuclease-free H2O) reaction mixtures which were run parallel with each assay. Each of the reaction was performed three times independently, in triplicates with 5 larvae/pool per treatment per replicate. The reaction specificity was checked by analyzing the final amplified product melting curve. Transcript levels of specific gene were normalized to the housekeeping β-actin for its stability under different infection conditions (Lv et al., 2016) and expressed as a function of the reference condition (unchallenged larvae). Fold changes in gene expression were calculated with RT-7500 (Applied Biosystems) software and plotted by using the standard 2-ΔΔCt method. One-way ANOVA with Tukey's post-hoc test was executed to examine the differences within gene transcript levels across time; data were expressed as mean±SE, p<0.01 was considered significant.
2.5. dsRNA synthesis and injection into larvae In vitro transcription reaction and the sense and antisense RNA strands were generated with T7 and SP6 kits (Ambion) as per manual protocol. cDNA of ALLP1, Spz, Rel (RD1 and RD2), STAT was cloned into pCRII-TOPO vector followed by amplification with M13 forward and reverse primers. This template with flanking T7 and SP6 promoters was used for in vitro transcription reaction. The DNA template was removed from the transcripts by DNase treatment and the RNA products were subsequently purified by using standard Trizol protocol. The complementary single stranded RNAs were dissolved in DEPC treated water, combined in equimolar amounts in Insect Buffer Saline (IBS: 160 mM NaCl2, 10 mM KCl and 4 mM CaCl2, pH 7.2) and annealed by heating to 98°C for 5 min and slow cooling overnight at room temperature. Similarly, dsRNA specific to green fluorescent protein (GFP) was synthesized as a non-specific control. Five 5th instar day 3 larvae of A. mylitta for each batch (n=3) of knockdown were taken. Double stranded RNA for each gene was injected into the hemolymph of the larvae using a 6
sterile syringe at a dose of 100 μg (A. mylitta) in 30 µL of IBS per larva (standardized based on larval weight, following protocols of Mrinal and Nagaraju (2008) and Satyavathi et al. (2016)).
2.6. Bacterial load assay Six hours post dsRNA injection, A. mylitta larvae were injected with 107 cells of log phase E. coli suspended in IBS. To determine bacterial load, 100 μL of the 10-fold diluted hemolymph samples were plated on LB agar plates. The colony forming units were counted after overnight incubation of the LB plates at 37ºC. The data was scored from three experimental replicates.
2.7. Effect of recombinant ALLP1 on virus proliferation cDNA encoding ALLP1 was cloned into pET-28a (+) E. coli expression vector (Novagen) and the recombinant protein was obtained following the protocol described in Gandhe et al. (2007). To check antiviral activity of the recombinant ALLP1 (recALLP1), its effect on cell lines and cell growth was assayed (concentration of ALLP1 used was 10 mM of the peptide in 1x PBS, pH 6.5; n=3). BmN cell line (ATCC) was cultured at 27°C in TC-100 medium supplemented with 10% foetal bovine serum as per protocol of the manufacturers. BmN cells were infected with BmNPV at a multiplicity of infection (MOI) of 5. After 1 h of incubation, virus-containing culture medium was removed, the cells were washed twice with serum-free TC-100 medium, and fresh serum-free medium with or without recombinant ALLP1 was added. Occlusion bodies (OBs) were counted as described previously (Hong et al., 2000).
3. Results and Discussion
The classical c-type is the principal widely expressed lysozyme type across various taxa (Callewaert and Michiels, 2010). Members are hydrolytic enzymes that depolymerize the bacterial cell wall PGN by cleaving the β-1,4-glycosidic bonds between its alternating units, N-acetylmuramic acid and N-acetylglucosamine. Lysozyme-like proteins (LLPs) are belonging to the Glycoside Hydrolase Family 22 (GH22 family) which primarily constitutes the c-type lysozymes and α-lactalbumins (Zhang et al., 2005; Narmadha and Yenugu, 2016).
However, both Antheraea mylitta and Bombyx mori LLP1 (ALLP1 and BLLP1, respectively) lack one or two of the catalytic amino acid residues glutamic acid 32 (Glu 32, position from B. 7
mori lysozyme) and aspartate 50 (Asp50) of c-type lysozyme required for muramidase activity (Figure 1). Thus far, both ALLP1 and BLLP1 are similar to the c-type lysozymes and conserve the characteristic lysozyme-like super family domain/signature (LYZ1) and the eight cysteines forming four disulfide bridges. The catalytic mechanism of c-type lysozymes involves interaction of the substrate β-1,4 glycosidic bond with the active site residues (Glu and Asp) (Kirby, 2001). The absence of these active site residues is a feature for LLPs (Mandal et al., 2003; Zhang et al., 2005). Nevertheless, like c-type lysozyme, all the LLPs hold the additional substrate binding sites (Narmadha and Yenugu, 2016). Lysozyme-like genes share conserved signature sequences and genomic organization common among lysozyme family members (Irwin et al., 2011). These observations suggest that LLPs could have arisen from single gene and diverged at a later time point (Narmadha and Yenugu, 2016). Phylogenetic analysis of silkmoth c-type lysozymes as well as LLPs along with other lepidopteran LLPs was carried out (Figure 2). The analysis revealed that LLPs form a distinct clade separated from the one containing c-type lysozymes. Furthermore, ALLP1 was found closely related to Spodoptera exigua whereas B. mori LLP1 and LLP3 were closer to Heliconius melpomene and Papilio xuthus, respectively.
In mammals, LLPs have been identified from sperm proteome of mouse and human (Guyonnet et al., 2012; Wang et al., 2013). Their roles extend beyond immunity, in fertilization (Sun et al., 2011) and others are associated with Type-II diabetes (Paasch et al., 2011). Some LLPs possess amyloidogenic domains signifying a putative role in antimicrobial defenses, while quite are amphipathic in nature, such a feature also underlying their antimicrobial nature (Narmadha and Yenugu, 2016). In insects, LLP genes were identified in many lepidopterans and up-regulated after challenge by various microbial elicitors (Crava et al., 2015; He et al., 2015; Meng et al., 2015; Vertyporokh et al., 2015). Although, the role of LLPs in the growth inhibition of E. coli and Micrococcus luteus was reported previously (Gandhe et al., 2007), the signal transduction pathways involved in the upregulation of LLPs have not been demonstrated so far.
Analysis of A. mylitta immune-challenged transcriptome has uncovered one lysozyme-like protein (ALLP1) (Gandhe et al., 2006). Both ALLP1 and BLLP1 were reported to have bacteriostatic activity characterized by PGN binding unlike PGN hydrolysis or membrane permeabilization as observed with lysozymes and most AMPs (Gandhe et al., 2007). The time-course analyses of ALLP1 and BLLP1 expression was studied by real-time PCR 8
analysis. The results, presented in Figure 3A, show that the ALLP1 gene expression was detected initially at very low levels which may indicates that ALLP1 is constitutively present at very low protein concentration in the hemolymph of A. mylitta. In addition, ALLP1 expression was increased by about 6 to 7-fold in the fat body 8 hrs post bacterial infection. Then, ALLP1 was found to be highly expressed at all time points after infection from 8 hpi to 20 hpi. Similar results were obtained for BLL1 expression after bacterial infection except at 20 hpi where a much lower expression was observed compared to that of ALLP1. In mammals, the expression of several LLPs has been reported in tissues like brain, lung, heart, spleen, kidney, ovary and uterus (Zhang et al., 2005), however, their exact roles in such tissues remain unknown. In case of sperm LLP1, functional studies have been restricted to human and mouse (Mandal et al., 2003; Kalra et al., 2016; Narmadha and Yenugu, 2016), their roles in other species are yet to be discovered.
Insect humoral immunity involves induction of antimicrobial peptide (AMP) and proteins expression (Bulet and Stöcklin, 2005). These peptides bind to and disrupt microbial membranes by different mechanisms, thereby promoting microbial clearance. The signaling pathways leading to the production of these peptides have been extensively studied in the dipteran D. melanogaster (for review see Lemaitre and Hoffmann, 2007). The signaling pathways are highly conserved among species and comprise cellular and humoral responses controlled by Toll, IMD and JAK/STAT signaling pathways activated by various stimuli (Hoffman et al., 1999). Nonetheless, in B. mori, comparative genomics revealed that 1:1 orthologous Drosophila PGRPs genes involved in PGNs recognition and subsequent activation of Toll and IMD pathways were not found in the genome of this silkworm, yet twelve B. mori PGRP genes were recognized (Tanaka et al., 2008). The Toll receptor putative ligand Spätzle-1 was also identified from B. mori (BmSpz-1) and it upregulates transcription of AMP genes (Wang et al., 2007). In B. mori, AMP genes expression is under the control of IMD and Toll pathways which are activated by DAP-type and Lys-type PGNs, respectively. In the induced larval fat body, the DAP-type PGN upregulates expression of several AMP genes more strongly than Lys-type PGN (Tanaka et al., 2009b).
RNA interference-mediated knockdown of genes (RNAi) has been frequently implied in genes functionality studies of insects (Terenius et al., 2011). In B. mori, an increase in proliferation of bacteria was observed upon BLLP1 knockdown in the fat body tissue of larvae (Gandhe et al., 2007). To elucidate signaling pathways regulating ALLP1 gene 9
expression, Späztle (Spz), Relish and STAT genes, the key components of the conventional signaling pathways, were identified and amplified. The amplified PCR products of Spz (105 bp), Relish (527 bp) and STAT (125 bp) were further cloned in suitable vector and used for the RNAi-mediated knockdown of the respective genes. Following knockdown, the downstream production of the ALLP1 was studied. Our results showed that knockdown of Relish but not Spz or STAT has resulted in reduced expression of ALLP1 (Figure 4 and Supplementary Fig. S1). Tanaka et al. (2007) reported two Relish variants (designated as RD1 and RD2) which differ in the presence of ankyrin repeats (ANK). As a matter of fact, RD2 variant does not contain these motifs. In our first RNAi experiment on Relish, primers were designed on sequence common to RD1 and RD2 and therefore knockdown was performed on both Relish variants. Therefore, to further identify the function of these 2 Relish variants, RD2 was specifically knockdowned. In this experiment, no reduced expression of ALLP1 was observed (Figure 5A). Thus, we may hypothesis that RD1 relish variant is involved in the regulation of LLP1 expression in A. mylitta. In B. mori, knockdown of the Relish orthologs resulted in failure of the activation of AMP genes upon bacterial infection, suggesting that Relish plays an important role in the expression of AMPs (Tanaka et al., 2007) as in many other insects.
Immune challenge triggers the synthesis and release of AMPs into sites of immune action. So, in vivo functional analysis of ALLP1 was conducted by measuring hemolymph clearance from E. coli (CFU/mL) in ALLP1 knockdown larvae (ALLP1-dsRNA injected) relative to larvae injected with GFP-dsRNA (non-specific dsRNA) preceding to E. coli treatment. The results indicate that E. coli load was 2-3-fold higher in ALLP1 knockdown larvae as compared to the control larvae (Figure 5B). Hereafter, ALLP1 in hemolymph is a secreted protein involved in A. mylitta humoral immunity. Based on our observations that Relish is required for the up regulation of ALLP1, we hypothesize that ALLP1 expression is regulated by IMD signaling pathway and that the production of ALLP1 is independent of Toll and JAK/STAT pathways.
In Drosophila, activation of the IMD pathway in response to bacterial challenge is rapid. Signal transduction up to nuclear translocation of Relish, occurs within minutes and the transcription of target genes peaks within hours (Vodovar et al., 2005). Contrasting, the Toll pathway is activated within hours, and the transcription of target genes occurs for days. Therefore, quickly-responding IMD pathway is possibly more operative against rapidly10
replicating pathogens, like bacteria (Kleino and Silverman, 2014). Ultimately, the NF-κBand Jnk-related proteins induce the biosynthesis of AMPs (Ganesan et al., 2011). In Bombyx, the IMD-mediated transcription of AMP genes is also faster, compared to the Toll pathway. Two mechanisms for this differential activation were anticipated (Tanaka et al., 2009b): iThe greater quantity of IMD pathway effector or BmRelishes over that of Toll pathway effector BmRels; ii-the greater ability of BmRelishes to boost the promoter activity of AMP genes than BmRels. Unlike D. melanogaster, LPS “crude preparations” (a reduced activation was attained by the highly purified LPS [TLRgrade™]), a major PAMP of Gram-negative bacteria (e.g. E. coli, inducer bacterium in this study), activates the IMD or Toll pathway and provokes expression of AMP genes in B. mori larval fat body (Tanaka et al., 2009a). However, the regulatory pathway(s) for transcriptional activation of AMP/other immune proteins genes by LPS has yet to be understood.
In some preliminary experiments, we checked if ALLP1 has any antiviral property. As we performed RNAi mediated knockdown with ALLP1, we observed a decrease in the viral load (data not shown). To further support our data, we performed in vitro cell culture experiments with recombinant ALLP1 protein. BmN cells were infected with BmNPV at a multiplicity of infection (MOI) of 5 with and without recombinant ALLP1 in the medium. We observed the reduction of virus proliferation in the presence of ALLP1 by about 1 million cells (p<0.05), compared to its control (Table 2). Our data show that antiviral activity against BmNPV in B. mori-infected cell line (BMN; ATCC® CRL8910™) is dependent on ALLP1 and possibly mediated upon signaling via the Imd pathway.
In an attempt to check the putative upregulation of LLPs, as represented by BLLP1, in addition to the expression patterns of Spz, Relish, and STAT, post-viral induction (via BmNPV), we tracked the expression of BLLP1 and selected signaling pathways genes in the fat body of BmNPV-resistant B. mori larvae, as assessed with semiqRT-PCR (Fig 6). The BLLP1 and Relish (RD1) were upregulated, compared to uninfected control, and were expressed at all time points post-viral infection. STAT expression was not observed except at 48-96 hpi. While Spz showed up regulation in 72 and 96 hpi.
Insects antiviral responses can be categorized into two groups; the first one involves viral genome degradation by the RNAi machinery (siRNA pathway) that is initially triggered by the presence of double-stranded RNA (dsRNA) (Wang et al., 2006) and gene regulation via 11
Dicer-2 (Deddouche et al., 2008). The second group involves the Jak/STAT pathway (Dostert et al., 2005) and potentially, the Imd and Toll pathways (Avadhanula et al., 2009; Costa et al., 2009).
Two basic indications suggest that the upregulation of the IMD pathway represent a secondary response to viral infection, as exemplified in Drosophila: (i) shortfalls in the IMD pathway have enhanced viral replication, while activation of the transcription factor Relish resulted in suppression of viral RNA replication (Avadhanula et al., 2009) and (ii) loss-offunction mutations in several IMD pathway genes exhibited augmented sensitivity to viral infection and elevated viral loads (Costa et al., 2009). Nevertheless, in silkworms, Lü et al. (2018) stated that there are no available evidences that IMD pathway was regulated post-viral infection by any type of viruses. However, here we provide an evidence for the indirect involvement of IMD pathway in regulation of antiviral activity of ALLP1 against virus in the tasar silkworm, A. mylitta.
4. Conclusion
LLPs may function as both recognition and antimicrobial proteins. Many immune-related proteins act in various cellular processes, for example, a dual role of hemolin has been indicated in development as well as in immunity (Liu et al., 2017) and hence other functions of these proteins cannot be ruled out. The functional annotation as well as elucidation of LLPs signaling pathways will provide clues for the analysis of their homologues in other organisms.
Conflict of interest All the authors declare no competing interests.
Ethical approval Not required
Acknowledgements We acknowledge Directors of Regional Tasar Research Station and APSSRDI, Hindupur, India for material. We thank Ms Deepa Narra and Reena Kumari for assistance in setting up PCRs. 12
Funding This work was supported by the DBT India to the Centre of Excellence for Genetics and Genomics of Silkmoths to CDFD and BioCare DBT funding to VVS, and a collaborative fund to AAM and DMM from Faculty of Science, Cairo University, Egypt and Sri Padmavati Mahila Visvavidyalayam (Women’s University), Tirupati, India.
13
Figure Legends Figure 1. Alignment of LYZ1 domains of LysC and LLP from Antherea mylitta with those of LysC and LLPs from Bombyx mori. ALysC, Antheraea mylitta lysozyme [Q7SID7]; ALLP1, Antheraea mylitta LLP1 [ABP52098]; BLysC, Bombyx mori lysozyme [1GD6_A]; BLLP1, Bombyx mori LLP1 [NP_001093293]; BLLP2, Bombyx mori LLP2 [XP_012551806] and BLLP3, Bombyx mori LLP3 [from Tanaka et al., 2007]. The characteristic catalytic amino acid residues of lysozymes, Glu32 and Asp50, are in red. Note that ALLP2 contains the Glu and Asp residues and therefore should be considered as a lysozyme. Conserved Cysteines are in green and highly conserved amino acids are grey boxed.
Figure 2. Phylogenetic analysis. 30 amino acid sequences of mature lysozymes and LLPs from Lepidopteran were aligned by Muscle (Edgar, 2004) and phylogenetic inference was obtained by the Maximum Likelyhood method using PhyML 3.0 (Guindon et al., 2010). Only bootstrap values higher than 50% are indicated for each root. Dermacentor andersoni lysozyme was used as the out-group. LLP from A. mylitta (ALLP1) is written in bold face letters. * from Chapelle et al. (2009), ** from Tanaka et al. (2008), and *** from http://metazoa.ensembl.org/. Figure 3. Expression of LLP1 in fat body tissue of 5th instar day-3 larvae of A. mylitta and B. mori. ALLP1 expression was assayed by real-time PCR analysis (panel A) across different time points post-bacterial infection. (B) BLLP1 expression. Control is unchallenged larvae. Real-time PCR results were determined by calculating relative arbitrary units using 2 -ΔΔCt analysis and normalizing to β-actin (NM_001126254.1) which was used as an internal control. The data are represented as mean of three different biological experimental replicates.
Fig 4. Gene expression analysis by semi-quantitative RT-PCR of ALLP1 in fat body tissue of 5th instar day-3 larvae of A. mylitta following gene specific knockdowns. Larvae after dsRNA treatment were infected with bacteria and the expression of ALLP1 was assayed by semiquantitative RT-PCR. dsRNA of the genes involved in signaling pathway namely, Spätzle (dsSpz), Relish (dsRD) and STAT (dsSTAT) were used for RNAi-mediated knockdown. dsGFP was used as non-specific gene control and β-actin was used as an internal control. The
14
numbers represent three different biological experimental replicates. A graphical representation of results is given in Supplementary Fig. S2.
Fig 5. Role of Relish gene RD1 and ALLP1 in the control of bacterial infection. A) Gene expression analysis by semi-quantitative RT-PCR of ALLP1 in fat body tissue of 5th instar, day-3 larvae of A. mylitta following Relish gene knockdowns. Larvae after dsRNA of Relish1 (dsRD1) and Relish2 (dsRD2) treatment were infected with bacteria and the expression of ALLP1 is assayed by semi-quantitative RT-PCR. dsGFP was used as non-specific gene control and β-actin was used as an internal control. B) Bacterial load in hemolymph as determined by the colony-forming assay. Larvae after treatment with dsRNA of GFP (GFPdsRNA) and ALLP1 (ALLP1-dsRNA) were infected with bacteria and the bacterial load (CFU E. coli /ml) was determined as described in M&M), * p<0.05 (Student's t-Test).
Fig 6. Gene expression analysis by semi-quantitative RT-PCR of BLLP1 and signaling pathways genes expressed at different time intervals in the fat body of BmNPV-resistant SBNP1 strain of B. mori larvae infected with BmNPV (M-100bp marker; ui, uninfected; 2496 hpi, hours post infection). The viral dosage is 20,000 OBs per larvae. The used primers are given in Supplementary Table 1.
15
References Avadhanula, V., Weasner, B.P., Hardy, G.G., Kumar, J.P., Hardy, R.W., 2009. A novel system for the launch of alphavirus RNA synthesis reveals a role for the Imd pathway in
arthropod
antiviral
response.
PLoS
Pathog.
5,
e1000582.
doi:
10.1371/journal.ppat.1000582 Boyer, L., Magoc L., Dejardin, S., Cappillino M., Paquette, N., Hinault, C., Charriere, G.M., Ip, W.K., Fracchia, S., Hennessy, E., Erturk-Hasdemir, D., Reichhart, J.M., Silverman, N., Lacy-Hulbert, A., Stuart, L.M., 2011. Pathogen-derived effectors trigger protective immunity via activation of the Rac2 enzyme and the IMD or Rip kinase signaling pathway. Immunity 35, 536–549. doi: 10.1016/j.immuni.2011.08.015 Bulet, P., Stöcklin, R., 2005. Insect antimicrobial peptides: structures, properties and gene regulation. Protein Pept. Lett. 12, 3–11. doi: 10.2174/0929866053406011 Callewaert, L., Michiels, C.W., 2010. Lysozymes in the animal kingdom. J. Biosci. 35, 127– 160. doi:10.1007/s12038-010-0015-5 Chapelle, M., Girard, P.A., Cousserans, F., Volkoff, N.A., Duvic, B., 2009. Lysozymes and lysozyme-like proteins from the fall armyworm, Spodoptera frugiperda. Mol. Immunol. 47, 261–269. doi: 10.1016/j.molimm.2009.09.028 Cherry, S., Silverman N., 2006. Host-pathogen interactions in drosophila: new tricks from an old friend. Nat. Immunol. 7, 911–917. doi: 10.1038/ni1388 Costa, A., Jan, E., Sarnow, P., Schneider, D., 2009. The Imd pathway is involved in antiviral immune
responses
in
Drosophila.
PLoS
One
4,
e7436.
doi:
10.1371/journal.pone.0007436 Crava, C.M., Jakubowska, A.K., Escriche, B., Herrero, S., Bel, Y., 2015. Dissimilar regulation of antimicrobial proteins in the midgut of Spodoptera exigua larvae challenged with Bacillus thuringiensis toxins or baculovirus. PLoS One 10, e0125991. doi: 10.1371/journal.pone.0125991 Deddouche, S., Matt, N., Budd, A., Mueller, S., Kemp, C., Galiana-Arnoux, D., Dostert, C., Antoniewski, C., Hoffmann, J. A. and Imler, J. L., 2008. The DExD/ H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nat. Immunol. 9, 1425–1432. doi: 10.1038/ni.1664 Dostert, C., Jouanguy, E., Irving, P., Troxler, L., Galiana-Arnoux, D., Hetru, C., Hoffmann, J.A., Imler, J.L., 2005. The Jak-STAT signaling pathway is required but not sufficient for the antiviral response of drosophila. Nat. Immunol. 6, 946–953. doi: 10.1038/ni1237 16
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. doi: 10.1093/nar/gkh340 Gandhe, A.S., Arunkumar, K.P., John, S.H., Nagaraju, J., 2006. Analysis of bacteriachallenged wild silkmoth, Antheraea mylitta (Lepidoptera) transcriptome reveals potential immune genes. BMC Genomics 7, 184. doi: 10.1186/1471-2164-7-184 Gandhe, A.S., Janardhan, G., Nagaraju, J., 2007. Immune upregulation of novel antibacterial proteins from silkmoths (Lepidoptera) that resemble lysozymes but lack muramidase activity. Insect Biochem Mol. Biol. 37, 655–666. doi: 10.1016/j.ibmb.2007.03.013 Ganesan, S., Aggarwal, K., Paquette, N., Silverman, N., 2011. NF-κB/Rel proteins and the humoral immune responses of Drosophila melanogaster. Curr. Top. Microbiol. Immunol. 349, 25–60. doi: 10.1007/82_2010_107 Guyonnet, B., Moghaddam, M.Z., SanFrancisco, S., Cornwall, G.A., 2012. Isolation and proteomics characterization of the mouse sperm acrosomal matrix. Mol. Cell. Proteomics 11, 758–774. doi: 10.1074/mcp.M112.020339 Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate Maximum-Likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. doi: 10.1093/sysbio/syq010 He, Y., Cao, X., Li, K., Hu, Y., Chen, Y.R., Blissard, G., Kanost, M.R., Jiang, H., 2015. A genome-wide analysis of antimicrobial effector genes and their transcription patterns in
Manduca
sexta.
Insect
Biochem.
Mol.
Biol.
62,
23–37.
doi:
10.1016/j.ibmb.2015.01.015 Hillyer, J.F., 2016. Insect immunology and hematopoiesis. Dev. Comp. Immunol. 58, 102– 118. doi: 10.1016/j.dci.2015.12.006 Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A., 1999. Phylogenetic perspectives
in
innate
immunity.
Science
284,
1313–1318.
doi:
10.1126/science.284.5418.1313 Hong, H.K., Woo, S.D., Choi, J.Y., Lee, H.K., Kim, M.H., Je, Y.H., Kang, S.K., 2000. Characterization of four isolates of Bombyx mori nucleopolyhedrovirus. Arch. Virol. 145, 2351–2361. doi: 10.1007/s007050070025 Irwin, D.M., Biegel, J.M., Stewart, C.B., 2011. Evolution of the mammalian lysozyme gene family. BMC Evol. Biol. 11, 1–16. doi: 10.1186/1471-2148-11-166 Kalra, S., Pradeep, M.A., Mohanty, A.K., Kaushik, J.K., 2016. Structural, functional and phylogenetic analysis of sperm lysozyme-Like Proteins. PLoS One 11, e0166321.
17
Kirby, A.J., 2001. The lysozyme mechanism sorted after 50 years. Nat. Struct. Biol. 8, 737– 739. doi: 10.1038/nsb0901-737 Kleino, A., Silverman, N., 2014. The Drosophila IMD pathway in the activation of the humoral
immune
response.
Dev.
Comp.
Immunol.
42,
25–35.
doi:
10.1016/j.dci.2013.05.014 Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. doi: 10.1146/annurev.immunol.25.022106.141615 Liu, X, Li, J., Wang, Q, Xia, H, Chen, K., 2017. Functional analysis of hemolin gene from silkworm, Bombyx mori - immune and development. Invertebrate Surviv. J. 14, 330– 339. Lü, P., Pan, Y., Yang, Y., Zhu, F., Li, C., Yao, Q., Chen K., 2018. Discovery of anti-viral molecules and their vital functions in Bombyx mori. J. Invertebr. Pathol. pii: S00222011(17)30537-2. doi: 10.1016/j.jip.2018.02.012 Lv, M., Mohamed, A.A., Zhang, L., Zhang, P., Zhang, L., 2016. A family of CSαβ defensins and defensin-like peptides from the Migratory locust, Locusta migratoria, and their expression dynamics during mycosis and nosemosis. PLoS One 11, e0161585. doi: 10.1371/journal.pone.0161585 Maillet, F., Bischoff, V., Vignal, C., Hoffmann, J., Royet, J., 2008. The Drosophila peptidoglycan recognition protein PGRP-LF blocks PGRP-LC and IMD/JNK pathway activation. Cell Host Microbe 3, 293–303. doi: 10.1016/j.chom.2008.04.002 Mandal, A., Klotz, K.L., Shetty, J., Jayes, F.L., Wolkowicz, M.J., Bolling, L.C., Coonrod, S.A., Black, M.B., Diekman, A.B., Haystead, T.A., Flickinger, C.J., Herr, J.C., 2003. SLLP1, a unique, intra-acrosomal, non-bacteriolytic, c lysozyme-like protein of human
spermatozoa.
Biol.
Reprod.
68,
1525–1537.
doi:
10.1095/biolreprod.102.010108 Marmaras, V.J., Lampropoulou, M., 2009. Regulators and signalling in insect haemocyte immunity. Cell. Signal. 21:186-195. doi: 10.1016/j.cellsig.2008.08.014 Meng, Q., Yu, H.Y., Zhang, H., Zhu, W., Wang, M.L., Zhang, J.H., Zhou, G.L., Li, X., Qin, Q.L., Hu, S.N., Zou, Z., 2015. Transcriptomic insight into the immune defenses in the ghost moth, Hepialus xiaojinensis, during an Ophiocordyceps sinensis fungal infection. Insect Biochem Mol Biol. 64, 1–15. doi: 10.1016/j.ibmb.2015.06.014 Mrinal, N., Nagaraju, J., 2008. Intron loss is associated with gain of function in the evolution of the gloverin family of antibacterial genes in Bombyx mori. J. Biol. Chem. 283, 23376–23387. doi: 10.1074/jbc.M801080200 18
Myllymäki, H., Valanne, S., Rämet, M., 2014. The Drosophila Imd signaling pathway J. Immunol. 192, 3455–3462. doi: 10.4049/jimmunol.1303309 Narmadha, G., Yenugu, S., 2016. In silico and biochemical characterization of lysozyme-like proteins in the rat. PLoS One 11(9): e0161909. doi: 10.1371/journal.pone.0161909 Paasch, U., Heidenreich, F., Pursche, T., Kuhlisch, E., Kettner, K., Grunewald, S., Kratzsch, J., Dittmar, G., Glander, H.J., Hoflack, B., Kriegel, T.M., 2011. Identification of increased amounts of eppin protein complex components in sperm cells of diabetic and obese individuals by difference gel electrophoresis. Mol. Cell Proteomics 10, 1– 14. doi: 10.1074/mcp.M110.007187 Satyavathi, V.V., Minz, A., Nagaraju, J., 2014. Nodulation: an unexplored cellular defense mechanism in insects. Cell. Signal. 26, 1753–1763. doi: 10.1016/j.cellsig.2014.02.024 Satyavathi, V.V., Narra, D., Nagaraju, J., 2016. Noduler an immune protein augments infection-induced cell proliferation through cross-talking with p38 MAPK. Immunobiology 221, 387–397. doi: 10.1016/j.imbio.2015.09.018 Subbaiah, E.V., Royer, C., Kanginakudru, S., Satyavathi, V.V., Babu, A.S., Sivaprasad, V., Chavancy, G., Darocha, M., Jalabert, A., Mauchamp, B., Basha, I., Couble, P., Nagaraju, J., 2013. Engineering silkworms for resistance to baculovirus through multigene RNA interference. Genetics 193, 63-75. doi: 10.1534/genetics.112.144402. Sun, R., Shen, R., Li, J., Xu, G., Chi, J., Li, L., Ren, J., Wang, Z., Fei, J., 2011. Lyzl4, a novel mouse sperm-related protein, is involved in fertilization. Acta Biochim. Biophys. Sin. (Shanghai) 3, 1–8. doi: 10.1093/abbs/gmr017 Tanaka, H, Matsuki, H, Furukawa, S, Sagisaka, A, Kotani, E, Mori, H, Yamakawa, M., 2007. Identification and functional analysis of Relish homologs in the silkworm, Bombyx mori. Biochim. Biophys. Acta 769, 559–568. doi: 10.1016/j.bbaexp.2007.07.001 Tanaka, H., Ishibashi, J., Fujita, K., Nakajima, Y., Sagisaka, A., Tomimoto, K., Suzuki, N., Yoshiyama, M., Kaneko, Y., Iwasaki, T., Sunagawa T., Yamaji K., Asaoka A., Mita K., Yamakawa M., 2008. A genome-wide analysis of genes and gene families involved in innate immunity of Bombyx mori. Insect Biochem. Mol. Biol. 38, 1087– 1110. doi: 10.1016/j.ibmb.2008.09.001 Tanaka, H., Sagisaka, A., Fujita, K., Kaneko, Y., Imanishi, S., Yamakawa, M., 2009a. Lipopolysaccharide elicits expression of immune-related genes in the silkworm, Bombyx mori. Insect Mol. Biol. 18,71-75. doi: 10.1111/j.1365-2583.2009.00851.x Tanaka, H., Sagisaka, A., Nakajima, Y., Fujita, K., Imanishi, S., Yamakawa, M., 2009b. Correlation of differential expression of silkworm antimicrobial peptide genes with 19
different amounts of rel family proteins and their gene transcriptional activity. Biosci. Biotechnol. Biochem. 73, 599–606. doi: 10.1271/bbb.80685 Tanji, T., Ip, Y.T. 2005. Regulators of the Toll and Imd pathways in the Drosophila innate immune response. Trends Immunol. 26, 193–198. doi: 10.1016/j.it.2005.02.006 Terenius, O., Papanicolaou, A., Garbutt, J.S., Eleftherianos, I., Huvenne, H., Kanginakudru, S., Albrechtsen, M., An, C., Aymeric, J.L., Barthel, A., Bebas, P., Bitra, K., Bravo, A., Chevalier, F., Collinge, D.P., Crava, C.M., de Maagd, R.A., Duvic, B., Erlandson, M., Faye, I., Felföldi, G., Fujiwara, H., Futahashi, R., Gandhe, A.S., Gatehouse, H.S., Gatehouse, L.N., Giebultowicz, J.M., Gómez, I., Grimmelikhuijzen, C.J., Groot, A.T., Hauser, F., Heckel, D.G., Hegedus, D.D., Hrycaj, S., Huang, L., Hull, J.J., Iatrou, K., Iga, M., Kanost, M.R., Kotwica, J., Li, C., Li, J., Liu, J., Lundmark, M., Matsumoto, S., Meyering-Vos, M., Millichap, P.J., Monteiro, A., Mrinal, N., Niimi, T., Nowara, D., Ohnishi, A., Oostra, V., Ozaki, K., Papakonstantinou, M., Popadic, A., Rajam, M.V., Saenko, S., Simpson, R.M., Soberón, M., Strand, M.R., Tomita, S., Toprak, U., Wang, P., Wee, C.W., Whyard, S., Zhang, W., Nagaraju, J., Ffrench-Constant, R.H., Herrero, S., Gordon, K., Swevers, L., Smagghe, G. (2011) RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental
design.
J.
Insect
Physiol.
57,
231–245.
doi:
10.1016/j.jinsphys.2010.11.006 Vertyporokh, L., Taszłow, P., Samorek-Pieróg, M., Wojda, I., 2015. Short-term heat shock affects the course of immune response in Galleria mellonella naturally infected with the entomopathogenic fungus Beauveria bassiana. J. Invertebr. Pathol. 130, 42–51. doi: 10.1016/j.jip.2015.07.001 Vodovar, N., Vinals, M., Liehl, P., Basset, A., Degrouard, J., Spellman, P., Boccard, F., Lemaitre, B., 2005. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proc. Natl. Acad. Sci. USA 102, 11414– 11419. doi: 10.1073/pnas.0502240102 Wang, G., Guo, Y., Zhou, T., Shi, X., Yu, J., Yang, Y., Wu, Y., Wang, J., Liu, M., Chen, X., Tu, W., Zeng, Y., Jiang, M., Li, S., Zhang, P., Zhou, Q., Zheng, B., Yu, C., Zhou, Z., Guo, X., Sha, J., 2013. In-depth proteomic analysis of the human sperm reveals complex
protein
compositions.
J.
Proteomics
79,
114–122.
doi:
10.1016/j.jprot.2012.12.008 Wang, Y., Cheng, T., Rayaprolu, S., Zou, Z., Xia, Q., Xiang, Z., Jiang, H., 2007. Proteolytic activation of pro-spätzle is required for the induced transcription of antimicrobial 20
peptide genes in lepidopteran insects. Dev. Comp. Immunol. 31, 1002–1012. doi: 10.1016/j.dci.2007.01.001 Wang, X.H., Aliyari, R., Li, W.X., Li, H.W., Kim, K., Carthew, R., Atkinson, P., Ding, S.W., 2006. RNA interference directs innate immunity against viruses in adult Drosophila. Science 312, 452–454. doi: 10.1126/science.1125694 Zhang, K., Gao, R., Zhang, H., Cai, X., Shen, C., Wu, C., Zhao, S., Yu, L., 2005. Molecular cloning and characterization of three novel lysozyme-like genes, predominantly expressed in the male reproductive system of humans, belonging to the C-type lysozyme/alpha-lactalbumin
family.
doi:10.1095/biolreprod.105.041889
21
Biol.
Reprod.
73,
1064–1071.
22
23
24
25
26
27
Table 1: List of primers used in this study Primer Name ALLP1 F ALLP1 R
Sequence (5’ – 3’)
Amplicon (bp)
BLLP1 F
AGGGCGGAAATTGCAACAT
BLLP1 R
TTAGATGCGCAAAACGGGTAT
Spätzle FP Spätzle RP
AACCGAATCGCATGAGTGA AGCATCCCGAACTGAAAATG
105
Relish FP Relish RP
TTCGGTGGAATGGGTATCAT TTGTGCGTTTGAAGTTCAGC
165
STAT FP STAT RP
GAGCGTTATGGACGAGAAGC CATAGTCCACGGCAACCAGG
125
Actin F Actin R RNAi primers RD1FP RD1RP
GGCATGGGACAGAAGGACT CGAACACGGAATCGTCACTA
97
RD2FP
CAATAACAATTTCAACGATG
RD2RP
GACATATTTACCATAGTGTACATATTA
CGATGGAAATTGTGCTCTAAAGG AATGGGTGGCCAGATGCA
74 81
Amplicon (bp)
Sequence (5’ – 3’) GAACAGCCACAGGACTACTT AGTGCTGCTTCGAACGATCT
28
527 117
Table 2: Effect of recombinant protein (ALLP1) on the proliferation of NPV. Treatments
Mean infectivity
Mean no. of OBs/mL (x 106)
BmN cells + BmNPV
82.74 ± 5.23a*
4.19 ± 0.73a
BmN cells + BmNPV + recALLP1
83.85 ± 1.35a
3.11 ± 0.24b
BmN cells + BmNPV + Buffer
79.51 ± 3.68a
4.38 ± 0.76a
Data was analysed with Student’s t test and presented as mean±SE (n=3). *Different letters indicate statistically significant difference, (p<0.05).
29
Gram¯ bacteria & Virus (current work)
Gram+
bacteria, Fungi, Yeasts
Viruses e.g. BmNPV
Virus ingestion with food or direct injection
Imd
Toll
Jak-STAT
X (?)
X E. coli injection into hemocoel
Dorsal/Dif
Relish
STAT
Immune-competent cells e.g. fat body
Silkworm
LLPs expression
INFECTION RESISTANCE
Role of Relish in upregulation of LLPs upon infection in silkworms
Highlights
Lysozyme-like proteins (LLPs) are glycoside hydrolases (GH22).
ALLP1 and BLLP1 are induced after bacterial challenge and involved in control of bacteria.
Knockdown (KD) of Relish variant 1 (RD1) abolished the induction of this protein, where KD larvae show a higher bacterial load compare to control larvae.
ALLP1 is under the control of the IMD pathway but not Toll or JAK/STAT pathways.
LLPs have an antiviral activity.
30
S0022-2011(18)30009-0 https://doi.org/10.1016/j.jip.2018.04.006 YJIPA 7088
To appear in:
Journal of Invertebrate Pathology
Received Date: Revised Date: Accepted Date:
11 January 2018 2 April 2018 16 April 2018
Please cite this article as: Satyavathi, V.V., Mohamed, A.A., Kumari, S., Mamatha, D.M., Duvic, B., The IMD pathway regulates lysozyme-like proteins (LLPs) in the silkmoth Antheraea mylitta, Journal of Invertebrate Pathology (2018), doi: https://doi.org/10.1016/j.jip.2018.04.006
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
The IMD pathway regulates lysozyme-like proteins (LLPs) in the silkmoth Antheraea mylitta
Valluri V. Satyavathi1, Amr A. Mohamed2*, Swetha Kumari1, Dadala M Mamatha3, Bernard Duvic4
1
Centre of Excellence for Genetics and Genomics of Silkmoths, Centre for DNA Fingerprinting and Diagnostics, Hyderabad 500 001, India
2
Department of Entomology, Faculty of Science, Cairo University, Giza, PO Box 12613, Egypt
3
Sri Padmavati Mahila Visvavidyalayam (Women’s University), Tirupati 517502 A.P. India
4
DGIMI, INRA, Univ Montpellier, Montpellier, France
*Correspondence author: Amr A. Mohamed, Faculty of Science, Department of Entomology, Cairo University, PO Box 12613 Giza, Egypt. Tel: +2 01069431998; fax: +2 02 35728843; email: [email protected] This article is dedicated to Dr. Javaregowda Nagaraju who inspired sericulture research and team members, VVS and AAM, for years.
1
Abstract
Lysozyme-like proteins (LLPs) are members of the glycoside hydrolase family 22 (CAZY GH22). Unlike conventional c-type lysozymes (EC 3.2.1.17), LLPs lack specific catalytic amino acid residues essential for muramidase activity. Previous reports indicated upregulation of LLPs upon bacterial infection in the wild silkworm, Antheraea mylitta as well as in the domesticated silkworm, Bombyx mori. In the present work, we studied the signaling pathways mediating the production of LLPs using RNA interference-mediated knockdown of Spätzle, Relish and STAT, the key regulators of Toll, IMD (Immune deficiency) and JAK/STAT pathways, respectively. We observed that knockdown of the Relish variant RD1 resulted in reduced expression levels of the ALLP1. We also showed that recombinant LLP has antiviral activity. We infer that LLPs showing both antibacterial and antiviral activity are regulated by the conventional IMD pathway in the silkmoths.
Keywords: Silkmoths; Immunity; lysozyme-like proteins; IMD; antiviral immunity; RNAi
2
1. Introduction
Insects’ immunity mostly relies on efficient innate components for their immune defences (Hoffman et al., 1999; Satyavathi et al., 2014; Hillyer, 2016). These include antimicrobial peptides (AMPs), immune-competent hemocytes equivalent to vertebrate macrophages, prophenoloxidase system (and associated molecules), reactive oxygen and nitrogen species, and hemolymph complement-like thioester-containing proteins. The immune repertoire of silkworms, Antheraea mylitta and Bombyx mori, and other insects were shown to be endowed with a new class of non-catalytic antimicrobial proteins, the lysozyme-like proteins (LLPs) (Gandhe et al., 2007). The LLPs lack the specific catalytic amino acid residues, Glu32 and Asp50 (from B. mori lysozyme sequence), fundamental for muramidase activity of the classic c-type lysozymes (c-type Lys) (Gandhe et al., 2007). Unlike the mechanistic action of the ctype Lys and other cationic AMPs which depend on murein hydrolysis or permeabilization of the inner bacterial membrane, LLPs rely on peptidoglycan (PGN) binding. Upon bacterial infection, LLPs are upregulated and exhibit a wide-ranging antibacterial action. Furthermore, in vivo hemolymph bacterial load was dramatically increased post-siRNA-mediated repression of LLPs in both wild and domesticated silkworm larvae, with apparent changes in their expression dynamics (Gandhe et al., 2007). The mechanisms underlying the regulation of LLPs transcription and expression are not fully understood yet.
Insect immune system is very complex, with pathways implicated in surveillance, signaling, and responsiveness to the occurrence of mutualistic, harmless, and pathogenic species within insect body (Cherry and Silverman, 2006). Homologous to the mammalian Interleukin 1 receptor pathways and Tumor Necrosis Factor-α signaling cascades, insects have two distinct NF-κB pathways, Toll and IMD (Immune deficiency). Both regulate AMPs production by recruiting the NF-κB transcription factors Dorsal/Dif and Relish, respectively (Tanji and Ip, 2005; Marmaras and Lampropoulou, 2009). A large part of our knowledge on these pathways comes from the pioneer studies in Drosophila and little is known in other insects. Toll pathway is implicated in the regulation of genes encoding AMPs against Gram-positive bacteria and fungi. Activation is dependent on a processed form of the cysteine-knot cytokine-like protein, the Toll ligand, Spätzle (Spz). The recognition of the pathogenassociated molecular pattern (PAMP) is initiated by the pattern recognition receptors (PRRs) GNBP1/PGRP-SA or PGRP-SD for Gram positive bacteria containing Lys-type PGNs, and GNBP3 for fungi (Maillet et al., 2008). 3
The IMD pathway is predominantly involved in the regulation of the anti-Gram-negative AMPs coding genes (Tanji and Ip, 2005; Myllymäki et al., 2014). This occurs through activation of the NF-κB transcription factor, Relish. Like the Toll pathway, microbial recognition is the first step initiating the immune responses via the IMD pathway (Kleino and Silverman, 2014). The key players of the IMD pathway include the upstream transmembrane receptor PGRP-LC with the PGRP-LE as a co-receptor, the IMD, the Transforming growth factor beta activated kinase 1 (TAK1), the Drosophila Fas-associated protein with Death Domain (dFADD), the caspase-8 homolog Death-related ced-3/Nedd2-like protein (DREDD), the Drosophila inhibitor of κB kinase (IKK) complex, and the NF-κB transcription factor Relish. The subcellular localization of these components and their regulation upon immune stimuli is not fully understood. PGRP-LC resides at the plasma membrane, but IMD is typically localized in the nucleus and can only be detected at the plasma membrane upon activation (Boyer et al., 2011). Orthologs of intracellular components of both Toll and IMD pathways have been identified in the genome of the silkworm B. mori (Tanaka et al., 2008). However, on the evolutionally context, they were not well conserved between B. mori and D. melanogaster.
Despite the economic value of silkworms, little is known about the pathways regulating their humoral immune responses and production of soluble effector proteins. In this report, we propped the key regulators of the Toll and IMD signaling pathways in the wild tasar silkworm A. mylitta, the spaetzle and relish, respectively mediating the ALLP1 activation and depicting how fat body cells respond to infection of bacteria in an attempt to heighten the controlling regulatory networks of these responses. We also analyzed the expression patterns of ALLP1 and BmLLP1 under microbial challenge and performed a preliminary in vivo functional characterization of the secreted protein (ALLP1).
2. Materials and Methods
2.1. Silkworms and microbes Larvae of wild silkmoth A. mylitta provided by Regional Tasar Research Station, Warangal, have been used for the experiments. Larvae of domesticated silkworm Bombyx mori were provided by Andhra Pradesh State Sericulture Research and Development Institute (APSSRDI), Hindupur. For immune challenge, the following microbes have been used; 4
laboratory-maintained Escherichia coli strain MG1655 and B. mori Nucleopolyhedrosis virus (BmNPV), an isolate that was originated from farmers’ silkworm rearing house, purified, and maintained in the Laboratory of Molecular Genetics, CDFD, Hyderabad (Subbaiah et al., 2013).
2.2. Primer design and gene sequences Sequences of lysozyme-like protein namely, ALLP1 was retrieved from NCBI and multiple sequence alignment was carried out using ClustalW. The sequences LLPs (GenBank: EF517396.1 for Antheraea mylitta and EF517397.1 for Bombyx mori) and those of signaling pathways, Spätzle (Spz)(NM_001114594.1), Relish variant 1 (RD1)(NM_001102465.1) or variant 2 (RD2)(NM_001105234.1), and STAT (Stat)(NM_001163916.1) were retrieved from NCBI. The primers were designed using Primer 3 Tool (Table 1).
2.3. Phylogenetic analysis Phylogenetic analysis was done by comparison of c-type lysozyme and lysozyme-like protein sequences of A. mylitta and B. mori with similar protein sequences of other lepidopteran insects obtained by blastp on NCBI. Phylogenetic tree was constructed with the Maximum Likelihood method (Guindon et al., 2010) using PhyML 3.0, available at: http://www.atgcmontpellier.fr/phyml/versions.php
2.4. Real time PCR A. mylitta and B. mori 5th instar, day 3 larvae were challenged with log phase E. coli according to Gandhe et al. (2007). Sterile saline-injected larvae were used as control. Fat body tissue was collected after 4, 8, 12, 16 and 20 h post bacterial infection and the material collected in liquid nitrogen was stored at -70°C freezer until further use. RNA isolation was done by using Trizol method. Fat body tissues were grinded using mortar and pestle and homogenized with 1.0 mL Trizol. The solution was centrifuged at 13,000 rpm for 10 min at 4°C. The pellet was discarded and to the supernatant 200 µL (per 1 mL of Trizol) of chloroform was added, mixed well and centrifuged at the same speed. The upper aqueous phase is collected and ¼th volume of isopropanol was added and incubated at -20°C for 1 hour. The pellet recovered after centrifugation was washed with 70% ethanol by centrifuging at 12,000 rpm for about 5 min at 4°C and air dried. The dried pellet was dissolved in 20 L of DEPC water and the concentration was checked using NanoDrop (Thermo Scientific Inc).
5
RNA obtained was treated with DNase (Invitrogen) as per the instruction provided in the manual. cDNA was synthesized as described by Satyavathi et al. (2016). 1.5 µg of total RNA was taken for cDNA synthesis. First strand synthesis was made using oligodT primer and MMLV reverse transcriptase enzyme (Invitrogen). Real-time PCR was performed with SYBR green mix (Takara) on RT-7500 system (Applied Biosystems, Foster City, CA USA) with gene specific primers (listed in Table 1), and their amplification efficiencies were determined, under the following conditions: initial denaturation at 50°C for 2 min and at 95°C for 30 sec followed by 40 cycles at 95°C for 5 sec and 60°C for 34 sec. Negative controls comprised no cDNA template (nuclease-free H2O) reaction mixtures which were run parallel with each assay. Each of the reaction was performed three times independently, in triplicates with 5 larvae/pool per treatment per replicate. The reaction specificity was checked by analyzing the final amplified product melting curve. Transcript levels of specific gene were normalized to the housekeeping β-actin for its stability under different infection conditions (Lv et al., 2016) and expressed as a function of the reference condition (unchallenged larvae). Fold changes in gene expression were calculated with RT-7500 (Applied Biosystems) software and plotted by using the standard 2-ΔΔCt method. One-way ANOVA with Tukey's post-hoc test was executed to examine the differences within gene transcript levels across time; data were expressed as mean±SE, p<0.01 was considered significant.
2.5. dsRNA synthesis and injection into larvae In vitro transcription reaction and the sense and antisense RNA strands were generated with T7 and SP6 kits (Ambion) as per manual protocol. cDNA of ALLP1, Spz, Rel (RD1 and RD2), STAT was cloned into pCRII-TOPO vector followed by amplification with M13 forward and reverse primers. This template with flanking T7 and SP6 promoters was used for in vitro transcription reaction. The DNA template was removed from the transcripts by DNase treatment and the RNA products were subsequently purified by using standard Trizol protocol. The complementary single stranded RNAs were dissolved in DEPC treated water, combined in equimolar amounts in Insect Buffer Saline (IBS: 160 mM NaCl2, 10 mM KCl and 4 mM CaCl2, pH 7.2) and annealed by heating to 98°C for 5 min and slow cooling overnight at room temperature. Similarly, dsRNA specific to green fluorescent protein (GFP) was synthesized as a non-specific control. Five 5th instar day 3 larvae of A. mylitta for each batch (n=3) of knockdown were taken. Double stranded RNA for each gene was injected into the hemolymph of the larvae using a 6
sterile syringe at a dose of 100 μg (A. mylitta) in 30 µL of IBS per larva (standardized based on larval weight, following protocols of Mrinal and Nagaraju (2008) and Satyavathi et al. (2016)).
2.6. Bacterial load assay Six hours post dsRNA injection, A. mylitta larvae were injected with 107 cells of log phase E. coli suspended in IBS. To determine bacterial load, 100 μL of the 10-fold diluted hemolymph samples were plated on LB agar plates. The colony forming units were counted after overnight incubation of the LB plates at 37ºC. The data was scored from three experimental replicates.
2.7. Effect of recombinant ALLP1 on virus proliferation cDNA encoding ALLP1 was cloned into pET-28a (+) E. coli expression vector (Novagen) and the recombinant protein was obtained following the protocol described in Gandhe et al. (2007). To check antiviral activity of the recombinant ALLP1 (recALLP1), its effect on cell lines and cell growth was assayed (concentration of ALLP1 used was 10 mM of the peptide in 1x PBS, pH 6.5; n=3). BmN cell line (ATCC) was cultured at 27°C in TC-100 medium supplemented with 10% foetal bovine serum as per protocol of the manufacturers. BmN cells were infected with BmNPV at a multiplicity of infection (MOI) of 5. After 1 h of incubation, virus-containing culture medium was removed, the cells were washed twice with serum-free TC-100 medium, and fresh serum-free medium with or without recombinant ALLP1 was added. Occlusion bodies (OBs) were counted as described previously (Hong et al., 2000).
3. Results and Discussion
The classical c-type is the principal widely expressed lysozyme type across various taxa (Callewaert and Michiels, 2010). Members are hydrolytic enzymes that depolymerize the bacterial cell wall PGN by cleaving the β-1,4-glycosidic bonds between its alternating units, N-acetylmuramic acid and N-acetylglucosamine. Lysozyme-like proteins (LLPs) are belonging to the Glycoside Hydrolase Family 22 (GH22 family) which primarily constitutes the c-type lysozymes and α-lactalbumins (Zhang et al., 2005; Narmadha and Yenugu, 2016).
However, both Antheraea mylitta and Bombyx mori LLP1 (ALLP1 and BLLP1, respectively) lack one or two of the catalytic amino acid residues glutamic acid 32 (Glu 32, position from B. 7
mori lysozyme) and aspartate 50 (Asp50) of c-type lysozyme required for muramidase activity (Figure 1). Thus far, both ALLP1 and BLLP1 are similar to the c-type lysozymes and conserve the characteristic lysozyme-like super family domain/signature (LYZ1) and the eight cysteines forming four disulfide bridges. The catalytic mechanism of c-type lysozymes involves interaction of the substrate β-1,4 glycosidic bond with the active site residues (Glu and Asp) (Kirby, 2001). The absence of these active site residues is a feature for LLPs (Mandal et al., 2003; Zhang et al., 2005). Nevertheless, like c-type lysozyme, all the LLPs hold the additional substrate binding sites (Narmadha and Yenugu, 2016). Lysozyme-like genes share conserved signature sequences and genomic organization common among lysozyme family members (Irwin et al., 2011). These observations suggest that LLPs could have arisen from single gene and diverged at a later time point (Narmadha and Yenugu, 2016). Phylogenetic analysis of silkmoth c-type lysozymes as well as LLPs along with other lepidopteran LLPs was carried out (Figure 2). The analysis revealed that LLPs form a distinct clade separated from the one containing c-type lysozymes. Furthermore, ALLP1 was found closely related to Spodoptera exigua whereas B. mori LLP1 and LLP3 were closer to Heliconius melpomene and Papilio xuthus, respectively.
In mammals, LLPs have been identified from sperm proteome of mouse and human (Guyonnet et al., 2012; Wang et al., 2013). Their roles extend beyond immunity, in fertilization (Sun et al., 2011) and others are associated with Type-II diabetes (Paasch et al., 2011). Some LLPs possess amyloidogenic domains signifying a putative role in antimicrobial defenses, while quite are amphipathic in nature, such a feature also underlying their antimicrobial nature (Narmadha and Yenugu, 2016). In insects, LLP genes were identified in many lepidopterans and up-regulated after challenge by various microbial elicitors (Crava et al., 2015; He et al., 2015; Meng et al., 2015; Vertyporokh et al., 2015). Although, the role of LLPs in the growth inhibition of E. coli and Micrococcus luteus was reported previously (Gandhe et al., 2007), the signal transduction pathways involved in the upregulation of LLPs have not been demonstrated so far.
Analysis of A. mylitta immune-challenged transcriptome has uncovered one lysozyme-like protein (ALLP1) (Gandhe et al., 2006). Both ALLP1 and BLLP1 were reported to have bacteriostatic activity characterized by PGN binding unlike PGN hydrolysis or membrane permeabilization as observed with lysozymes and most AMPs (Gandhe et al., 2007). The time-course analyses of ALLP1 and BLLP1 expression was studied by real-time PCR 8
analysis. The results, presented in Figure 3A, show that the ALLP1 gene expression was detected initially at very low levels which may indicates that ALLP1 is constitutively present at very low protein concentration in the hemolymph of A. mylitta. In addition, ALLP1 expression was increased by about 6 to 7-fold in the fat body 8 hrs post bacterial infection. Then, ALLP1 was found to be highly expressed at all time points after infection from 8 hpi to 20 hpi. Similar results were obtained for BLL1 expression after bacterial infection except at 20 hpi where a much lower expression was observed compared to that of ALLP1. In mammals, the expression of several LLPs has been reported in tissues like brain, lung, heart, spleen, kidney, ovary and uterus (Zhang et al., 2005), however, their exact roles in such tissues remain unknown. In case of sperm LLP1, functional studies have been restricted to human and mouse (Mandal et al., 2003; Kalra et al., 2016; Narmadha and Yenugu, 2016), their roles in other species are yet to be discovered.
Insect humoral immunity involves induction of antimicrobial peptide (AMP) and proteins expression (Bulet and Stöcklin, 2005). These peptides bind to and disrupt microbial membranes by different mechanisms, thereby promoting microbial clearance. The signaling pathways leading to the production of these peptides have been extensively studied in the dipteran D. melanogaster (for review see Lemaitre and Hoffmann, 2007). The signaling pathways are highly conserved among species and comprise cellular and humoral responses controlled by Toll, IMD and JAK/STAT signaling pathways activated by various stimuli (Hoffman et al., 1999). Nonetheless, in B. mori, comparative genomics revealed that 1:1 orthologous Drosophila PGRPs genes involved in PGNs recognition and subsequent activation of Toll and IMD pathways were not found in the genome of this silkworm, yet twelve B. mori PGRP genes were recognized (Tanaka et al., 2008). The Toll receptor putative ligand Spätzle-1 was also identified from B. mori (BmSpz-1) and it upregulates transcription of AMP genes (Wang et al., 2007). In B. mori, AMP genes expression is under the control of IMD and Toll pathways which are activated by DAP-type and Lys-type PGNs, respectively. In the induced larval fat body, the DAP-type PGN upregulates expression of several AMP genes more strongly than Lys-type PGN (Tanaka et al., 2009b).
RNA interference-mediated knockdown of genes (RNAi) has been frequently implied in genes functionality studies of insects (Terenius et al., 2011). In B. mori, an increase in proliferation of bacteria was observed upon BLLP1 knockdown in the fat body tissue of larvae (Gandhe et al., 2007). To elucidate signaling pathways regulating ALLP1 gene 9
expression, Späztle (Spz), Relish and STAT genes, the key components of the conventional signaling pathways, were identified and amplified. The amplified PCR products of Spz (105 bp), Relish (527 bp) and STAT (125 bp) were further cloned in suitable vector and used for the RNAi-mediated knockdown of the respective genes. Following knockdown, the downstream production of the ALLP1 was studied. Our results showed that knockdown of Relish but not Spz or STAT has resulted in reduced expression of ALLP1 (Figure 4 and Supplementary Fig. S1). Tanaka et al. (2007) reported two Relish variants (designated as RD1 and RD2) which differ in the presence of ankyrin repeats (ANK). As a matter of fact, RD2 variant does not contain these motifs. In our first RNAi experiment on Relish, primers were designed on sequence common to RD1 and RD2 and therefore knockdown was performed on both Relish variants. Therefore, to further identify the function of these 2 Relish variants, RD2 was specifically knockdowned. In this experiment, no reduced expression of ALLP1 was observed (Figure 5A). Thus, we may hypothesis that RD1 relish variant is involved in the regulation of LLP1 expression in A. mylitta. In B. mori, knockdown of the Relish orthologs resulted in failure of the activation of AMP genes upon bacterial infection, suggesting that Relish plays an important role in the expression of AMPs (Tanaka et al., 2007) as in many other insects.
Immune challenge triggers the synthesis and release of AMPs into sites of immune action. So, in vivo functional analysis of ALLP1 was conducted by measuring hemolymph clearance from E. coli (CFU/mL) in ALLP1 knockdown larvae (ALLP1-dsRNA injected) relative to larvae injected with GFP-dsRNA (non-specific dsRNA) preceding to E. coli treatment. The results indicate that E. coli load was 2-3-fold higher in ALLP1 knockdown larvae as compared to the control larvae (Figure 5B). Hereafter, ALLP1 in hemolymph is a secreted protein involved in A. mylitta humoral immunity. Based on our observations that Relish is required for the up regulation of ALLP1, we hypothesize that ALLP1 expression is regulated by IMD signaling pathway and that the production of ALLP1 is independent of Toll and JAK/STAT pathways.
In Drosophila, activation of the IMD pathway in response to bacterial challenge is rapid. Signal transduction up to nuclear translocation of Relish, occurs within minutes and the transcription of target genes peaks within hours (Vodovar et al., 2005). Contrasting, the Toll pathway is activated within hours, and the transcription of target genes occurs for days. Therefore, quickly-responding IMD pathway is possibly more operative against rapidly10
replicating pathogens, like bacteria (Kleino and Silverman, 2014). Ultimately, the NF-κBand Jnk-related proteins induce the biosynthesis of AMPs (Ganesan et al., 2011). In Bombyx, the IMD-mediated transcription of AMP genes is also faster, compared to the Toll pathway. Two mechanisms for this differential activation were anticipated (Tanaka et al., 2009b): iThe greater quantity of IMD pathway effector or BmRelishes over that of Toll pathway effector BmRels; ii-the greater ability of BmRelishes to boost the promoter activity of AMP genes than BmRels. Unlike D. melanogaster, LPS “crude preparations” (a reduced activation was attained by the highly purified LPS [TLRgrade™]), a major PAMP of Gram-negative bacteria (e.g. E. coli, inducer bacterium in this study), activates the IMD or Toll pathway and provokes expression of AMP genes in B. mori larval fat body (Tanaka et al., 2009a). However, the regulatory pathway(s) for transcriptional activation of AMP/other immune proteins genes by LPS has yet to be understood.
In some preliminary experiments, we checked if ALLP1 has any antiviral property. As we performed RNAi mediated knockdown with ALLP1, we observed a decrease in the viral load (data not shown). To further support our data, we performed in vitro cell culture experiments with recombinant ALLP1 protein. BmN cells were infected with BmNPV at a multiplicity of infection (MOI) of 5 with and without recombinant ALLP1 in the medium. We observed the reduction of virus proliferation in the presence of ALLP1 by about 1 million cells (p<0.05), compared to its control (Table 2). Our data show that antiviral activity against BmNPV in B. mori-infected cell line (BMN; ATCC® CRL8910™) is dependent on ALLP1 and possibly mediated upon signaling via the Imd pathway.
In an attempt to check the putative upregulation of LLPs, as represented by BLLP1, in addition to the expression patterns of Spz, Relish, and STAT, post-viral induction (via BmNPV), we tracked the expression of BLLP1 and selected signaling pathways genes in the fat body of BmNPV-resistant B. mori larvae, as assessed with semiqRT-PCR (Fig 6). The BLLP1 and Relish (RD1) were upregulated, compared to uninfected control, and were expressed at all time points post-viral infection. STAT expression was not observed except at 48-96 hpi. While Spz showed up regulation in 72 and 96 hpi.
Insects antiviral responses can be categorized into two groups; the first one involves viral genome degradation by the RNAi machinery (siRNA pathway) that is initially triggered by the presence of double-stranded RNA (dsRNA) (Wang et al., 2006) and gene regulation via 11
Dicer-2 (Deddouche et al., 2008). The second group involves the Jak/STAT pathway (Dostert et al., 2005) and potentially, the Imd and Toll pathways (Avadhanula et al., 2009; Costa et al., 2009).
Two basic indications suggest that the upregulation of the IMD pathway represent a secondary response to viral infection, as exemplified in Drosophila: (i) shortfalls in the IMD pathway have enhanced viral replication, while activation of the transcription factor Relish resulted in suppression of viral RNA replication (Avadhanula et al., 2009) and (ii) loss-offunction mutations in several IMD pathway genes exhibited augmented sensitivity to viral infection and elevated viral loads (Costa et al., 2009). Nevertheless, in silkworms, Lü et al. (2018) stated that there are no available evidences that IMD pathway was regulated post-viral infection by any type of viruses. However, here we provide an evidence for the indirect involvement of IMD pathway in regulation of antiviral activity of ALLP1 against virus in the tasar silkworm, A. mylitta.
4. Conclusion
LLPs may function as both recognition and antimicrobial proteins. Many immune-related proteins act in various cellular processes, for example, a dual role of hemolin has been indicated in development as well as in immunity (Liu et al., 2017) and hence other functions of these proteins cannot be ruled out. The functional annotation as well as elucidation of LLPs signaling pathways will provide clues for the analysis of their homologues in other organisms.
Conflict of interest All the authors declare no competing interests.
Ethical approval Not required
Acknowledgements We acknowledge Directors of Regional Tasar Research Station and APSSRDI, Hindupur, India for material. We thank Ms Deepa Narra and Reena Kumari for assistance in setting up PCRs. 12
Funding This work was supported by the DBT India to the Centre of Excellence for Genetics and Genomics of Silkmoths to CDFD and BioCare DBT funding to VVS, and a collaborative fund to AAM and DMM from Faculty of Science, Cairo University, Egypt and Sri Padmavati Mahila Visvavidyalayam (Women’s University), Tirupati, India.
13
Figure Legends Figure 1. Alignment of LYZ1 domains of LysC and LLP from Antherea mylitta with those of LysC and LLPs from Bombyx mori. ALysC, Antheraea mylitta lysozyme [Q7SID7]; ALLP1, Antheraea mylitta LLP1 [ABP52098]; BLysC, Bombyx mori lysozyme [1GD6_A]; BLLP1, Bombyx mori LLP1 [NP_001093293]; BLLP2, Bombyx mori LLP2 [XP_012551806] and BLLP3, Bombyx mori LLP3 [from Tanaka et al., 2007]. The characteristic catalytic amino acid residues of lysozymes, Glu32 and Asp50, are in red. Note that ALLP2 contains the Glu and Asp residues and therefore should be considered as a lysozyme. Conserved Cysteines are in green and highly conserved amino acids are grey boxed.
Figure 2. Phylogenetic analysis. 30 amino acid sequences of mature lysozymes and LLPs from Lepidopteran were aligned by Muscle (Edgar, 2004) and phylogenetic inference was obtained by the Maximum Likelyhood method using PhyML 3.0 (Guindon et al., 2010). Only bootstrap values higher than 50% are indicated for each root. Dermacentor andersoni lysozyme was used as the out-group. LLP from A. mylitta (ALLP1) is written in bold face letters. * from Chapelle et al. (2009), ** from Tanaka et al. (2008), and *** from http://metazoa.ensembl.org/. Figure 3. Expression of LLP1 in fat body tissue of 5th instar day-3 larvae of A. mylitta and B. mori. ALLP1 expression was assayed by real-time PCR analysis (panel A) across different time points post-bacterial infection. (B) BLLP1 expression. Control is unchallenged larvae. Real-time PCR results were determined by calculating relative arbitrary units using 2 -ΔΔCt analysis and normalizing to β-actin (NM_001126254.1) which was used as an internal control. The data are represented as mean of three different biological experimental replicates.
Fig 4. Gene expression analysis by semi-quantitative RT-PCR of ALLP1 in fat body tissue of 5th instar day-3 larvae of A. mylitta following gene specific knockdowns. Larvae after dsRNA treatment were infected with bacteria and the expression of ALLP1 was assayed by semiquantitative RT-PCR. dsRNA of the genes involved in signaling pathway namely, Spätzle (dsSpz), Relish (dsRD) and STAT (dsSTAT) were used for RNAi-mediated knockdown. dsGFP was used as non-specific gene control and β-actin was used as an internal control. The
14
numbers represent three different biological experimental replicates. A graphical representation of results is given in Supplementary Fig. S2.
Fig 5. Role of Relish gene RD1 and ALLP1 in the control of bacterial infection. A) Gene expression analysis by semi-quantitative RT-PCR of ALLP1 in fat body tissue of 5th instar, day-3 larvae of A. mylitta following Relish gene knockdowns. Larvae after dsRNA of Relish1 (dsRD1) and Relish2 (dsRD2) treatment were infected with bacteria and the expression of ALLP1 is assayed by semi-quantitative RT-PCR. dsGFP was used as non-specific gene control and β-actin was used as an internal control. B) Bacterial load in hemolymph as determined by the colony-forming assay. Larvae after treatment with dsRNA of GFP (GFPdsRNA) and ALLP1 (ALLP1-dsRNA) were infected with bacteria and the bacterial load (CFU E. coli /ml) was determined as described in M&M), * p<0.05 (Student's t-Test).
Fig 6. Gene expression analysis by semi-quantitative RT-PCR of BLLP1 and signaling pathways genes expressed at different time intervals in the fat body of BmNPV-resistant SBNP1 strain of B. mori larvae infected with BmNPV (M-100bp marker; ui, uninfected; 2496 hpi, hours post infection). The viral dosage is 20,000 OBs per larvae. The used primers are given in Supplementary Table 1.
15
References Avadhanula, V., Weasner, B.P., Hardy, G.G., Kumar, J.P., Hardy, R.W., 2009. A novel system for the launch of alphavirus RNA synthesis reveals a role for the Imd pathway in
arthropod
antiviral
response.
PLoS
Pathog.
5,
e1000582.
doi:
10.1371/journal.ppat.1000582 Boyer, L., Magoc L., Dejardin, S., Cappillino M., Paquette, N., Hinault, C., Charriere, G.M., Ip, W.K., Fracchia, S., Hennessy, E., Erturk-Hasdemir, D., Reichhart, J.M., Silverman, N., Lacy-Hulbert, A., Stuart, L.M., 2011. Pathogen-derived effectors trigger protective immunity via activation of the Rac2 enzyme and the IMD or Rip kinase signaling pathway. Immunity 35, 536–549. doi: 10.1016/j.immuni.2011.08.015 Bulet, P., Stöcklin, R., 2005. Insect antimicrobial peptides: structures, properties and gene regulation. Protein Pept. Lett. 12, 3–11. doi: 10.2174/0929866053406011 Callewaert, L., Michiels, C.W., 2010. Lysozymes in the animal kingdom. J. Biosci. 35, 127– 160. doi:10.1007/s12038-010-0015-5 Chapelle, M., Girard, P.A., Cousserans, F., Volkoff, N.A., Duvic, B., 2009. Lysozymes and lysozyme-like proteins from the fall armyworm, Spodoptera frugiperda. Mol. Immunol. 47, 261–269. doi: 10.1016/j.molimm.2009.09.028 Cherry, S., Silverman N., 2006. Host-pathogen interactions in drosophila: new tricks from an old friend. Nat. Immunol. 7, 911–917. doi: 10.1038/ni1388 Costa, A., Jan, E., Sarnow, P., Schneider, D., 2009. The Imd pathway is involved in antiviral immune
responses
in
Drosophila.
PLoS
One
4,
e7436.
doi:
10.1371/journal.pone.0007436 Crava, C.M., Jakubowska, A.K., Escriche, B., Herrero, S., Bel, Y., 2015. Dissimilar regulation of antimicrobial proteins in the midgut of Spodoptera exigua larvae challenged with Bacillus thuringiensis toxins or baculovirus. PLoS One 10, e0125991. doi: 10.1371/journal.pone.0125991 Deddouche, S., Matt, N., Budd, A., Mueller, S., Kemp, C., Galiana-Arnoux, D., Dostert, C., Antoniewski, C., Hoffmann, J. A. and Imler, J. L., 2008. The DExD/ H-box helicase Dicer-2 mediates the induction of antiviral activity in drosophila. Nat. Immunol. 9, 1425–1432. doi: 10.1038/ni.1664 Dostert, C., Jouanguy, E., Irving, P., Troxler, L., Galiana-Arnoux, D., Hetru, C., Hoffmann, J.A., Imler, J.L., 2005. The Jak-STAT signaling pathway is required but not sufficient for the antiviral response of drosophila. Nat. Immunol. 6, 946–953. doi: 10.1038/ni1237 16
Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797. doi: 10.1093/nar/gkh340 Gandhe, A.S., Arunkumar, K.P., John, S.H., Nagaraju, J., 2006. Analysis of bacteriachallenged wild silkmoth, Antheraea mylitta (Lepidoptera) transcriptome reveals potential immune genes. BMC Genomics 7, 184. doi: 10.1186/1471-2164-7-184 Gandhe, A.S., Janardhan, G., Nagaraju, J., 2007. Immune upregulation of novel antibacterial proteins from silkmoths (Lepidoptera) that resemble lysozymes but lack muramidase activity. Insect Biochem Mol. Biol. 37, 655–666. doi: 10.1016/j.ibmb.2007.03.013 Ganesan, S., Aggarwal, K., Paquette, N., Silverman, N., 2011. NF-κB/Rel proteins and the humoral immune responses of Drosophila melanogaster. Curr. Top. Microbiol. Immunol. 349, 25–60. doi: 10.1007/82_2010_107 Guyonnet, B., Moghaddam, M.Z., SanFrancisco, S., Cornwall, G.A., 2012. Isolation and proteomics characterization of the mouse sperm acrosomal matrix. Mol. Cell. Proteomics 11, 758–774. doi: 10.1074/mcp.M112.020339 Guindon, S., Dufayard, J.F., Lefort, V., Anisimova, M., Hordijk, W., Gascuel, O., 2010. New algorithms and methods to estimate Maximum-Likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321. doi: 10.1093/sysbio/syq010 He, Y., Cao, X., Li, K., Hu, Y., Chen, Y.R., Blissard, G., Kanost, M.R., Jiang, H., 2015. A genome-wide analysis of antimicrobial effector genes and their transcription patterns in
Manduca
sexta.
Insect
Biochem.
Mol.
Biol.
62,
23–37.
doi:
10.1016/j.ibmb.2015.01.015 Hillyer, J.F., 2016. Insect immunology and hematopoiesis. Dev. Comp. Immunol. 58, 102– 118. doi: 10.1016/j.dci.2015.12.006 Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A., 1999. Phylogenetic perspectives
in
innate
immunity.
Science
284,
1313–1318.
doi:
10.1126/science.284.5418.1313 Hong, H.K., Woo, S.D., Choi, J.Y., Lee, H.K., Kim, M.H., Je, Y.H., Kang, S.K., 2000. Characterization of four isolates of Bombyx mori nucleopolyhedrovirus. Arch. Virol. 145, 2351–2361. doi: 10.1007/s007050070025 Irwin, D.M., Biegel, J.M., Stewart, C.B., 2011. Evolution of the mammalian lysozyme gene family. BMC Evol. Biol. 11, 1–16. doi: 10.1186/1471-2148-11-166 Kalra, S., Pradeep, M.A., Mohanty, A.K., Kaushik, J.K., 2016. Structural, functional and phylogenetic analysis of sperm lysozyme-Like Proteins. PLoS One 11, e0166321.
17
Kirby, A.J., 2001. The lysozyme mechanism sorted after 50 years. Nat. Struct. Biol. 8, 737– 739. doi: 10.1038/nsb0901-737 Kleino, A., Silverman, N., 2014. The Drosophila IMD pathway in the activation of the humoral
immune
response.
Dev.
Comp.
Immunol.
42,
25–35.
doi:
10.1016/j.dci.2013.05.014 Lemaitre, B., Hoffmann, J., 2007. The host defense of Drosophila melanogaster. Annu. Rev. Immunol. 25, 697–743. doi: 10.1146/annurev.immunol.25.022106.141615 Liu, X, Li, J., Wang, Q, Xia, H, Chen, K., 2017. Functional analysis of hemolin gene from silkworm, Bombyx mori - immune and development. Invertebrate Surviv. J. 14, 330– 339. Lü, P., Pan, Y., Yang, Y., Zhu, F., Li, C., Yao, Q., Chen K., 2018. Discovery of anti-viral molecules and their vital functions in Bombyx mori. J. Invertebr. Pathol. pii: S00222011(17)30537-2. doi: 10.1016/j.jip.2018.02.012 Lv, M., Mohamed, A.A., Zhang, L., Zhang, P., Zhang, L., 2016. A family of CSαβ defensins and defensin-like peptides from the Migratory locust, Locusta migratoria, and their expression dynamics during mycosis and nosemosis. PLoS One 11, e0161585. doi: 10.1371/journal.pone.0161585 Maillet, F., Bischoff, V., Vignal, C., Hoffmann, J., Royet, J., 2008. The Drosophila peptidoglycan recognition protein PGRP-LF blocks PGRP-LC and IMD/JNK pathway activation. Cell Host Microbe 3, 293–303. doi: 10.1016/j.chom.2008.04.002 Mandal, A., Klotz, K.L., Shetty, J., Jayes, F.L., Wolkowicz, M.J., Bolling, L.C., Coonrod, S.A., Black, M.B., Diekman, A.B., Haystead, T.A., Flickinger, C.J., Herr, J.C., 2003. SLLP1, a unique, intra-acrosomal, non-bacteriolytic, c lysozyme-like protein of human
spermatozoa.
Biol.
Reprod.
68,
1525–1537.
doi:
10.1095/biolreprod.102.010108 Marmaras, V.J., Lampropoulou, M., 2009. Regulators and signalling in insect haemocyte immunity. Cell. Signal. 21:186-195. doi: 10.1016/j.cellsig.2008.08.014 Meng, Q., Yu, H.Y., Zhang, H., Zhu, W., Wang, M.L., Zhang, J.H., Zhou, G.L., Li, X., Qin, Q.L., Hu, S.N., Zou, Z., 2015. Transcriptomic insight into the immune defenses in the ghost moth, Hepialus xiaojinensis, during an Ophiocordyceps sinensis fungal infection. Insect Biochem Mol Biol. 64, 1–15. doi: 10.1016/j.ibmb.2015.06.014 Mrinal, N., Nagaraju, J., 2008. Intron loss is associated with gain of function in the evolution of the gloverin family of antibacterial genes in Bombyx mori. J. Biol. Chem. 283, 23376–23387. doi: 10.1074/jbc.M801080200 18
Myllymäki, H., Valanne, S., Rämet, M., 2014. The Drosophila Imd signaling pathway J. Immunol. 192, 3455–3462. doi: 10.4049/jimmunol.1303309 Narmadha, G., Yenugu, S., 2016. In silico and biochemical characterization of lysozyme-like proteins in the rat. PLoS One 11(9): e0161909. doi: 10.1371/journal.pone.0161909 Paasch, U., Heidenreich, F., Pursche, T., Kuhlisch, E., Kettner, K., Grunewald, S., Kratzsch, J., Dittmar, G., Glander, H.J., Hoflack, B., Kriegel, T.M., 2011. Identification of increased amounts of eppin protein complex components in sperm cells of diabetic and obese individuals by difference gel electrophoresis. Mol. Cell Proteomics 10, 1– 14. doi: 10.1074/mcp.M110.007187 Satyavathi, V.V., Minz, A., Nagaraju, J., 2014. Nodulation: an unexplored cellular defense mechanism in insects. Cell. Signal. 26, 1753–1763. doi: 10.1016/j.cellsig.2014.02.024 Satyavathi, V.V., Narra, D., Nagaraju, J., 2016. Noduler an immune protein augments infection-induced cell proliferation through cross-talking with p38 MAPK. Immunobiology 221, 387–397. doi: 10.1016/j.imbio.2015.09.018 Subbaiah, E.V., Royer, C., Kanginakudru, S., Satyavathi, V.V., Babu, A.S., Sivaprasad, V., Chavancy, G., Darocha, M., Jalabert, A., Mauchamp, B., Basha, I., Couble, P., Nagaraju, J., 2013. Engineering silkworms for resistance to baculovirus through multigene RNA interference. Genetics 193, 63-75. doi: 10.1534/genetics.112.144402. Sun, R., Shen, R., Li, J., Xu, G., Chi, J., Li, L., Ren, J., Wang, Z., Fei, J., 2011. Lyzl4, a novel mouse sperm-related protein, is involved in fertilization. Acta Biochim. Biophys. Sin. (Shanghai) 3, 1–8. doi: 10.1093/abbs/gmr017 Tanaka, H, Matsuki, H, Furukawa, S, Sagisaka, A, Kotani, E, Mori, H, Yamakawa, M., 2007. Identification and functional analysis of Relish homologs in the silkworm, Bombyx mori. Biochim. Biophys. Acta 769, 559–568. doi: 10.1016/j.bbaexp.2007.07.001 Tanaka, H., Ishibashi, J., Fujita, K., Nakajima, Y., Sagisaka, A., Tomimoto, K., Suzuki, N., Yoshiyama, M., Kaneko, Y., Iwasaki, T., Sunagawa T., Yamaji K., Asaoka A., Mita K., Yamakawa M., 2008. A genome-wide analysis of genes and gene families involved in innate immunity of Bombyx mori. Insect Biochem. Mol. Biol. 38, 1087– 1110. doi: 10.1016/j.ibmb.2008.09.001 Tanaka, H., Sagisaka, A., Fujita, K., Kaneko, Y., Imanishi, S., Yamakawa, M., 2009a. Lipopolysaccharide elicits expression of immune-related genes in the silkworm, Bombyx mori. Insect Mol. Biol. 18,71-75. doi: 10.1111/j.1365-2583.2009.00851.x Tanaka, H., Sagisaka, A., Nakajima, Y., Fujita, K., Imanishi, S., Yamakawa, M., 2009b. Correlation of differential expression of silkworm antimicrobial peptide genes with 19
different amounts of rel family proteins and their gene transcriptional activity. Biosci. Biotechnol. Biochem. 73, 599–606. doi: 10.1271/bbb.80685 Tanji, T., Ip, Y.T. 2005. Regulators of the Toll and Imd pathways in the Drosophila innate immune response. Trends Immunol. 26, 193–198. doi: 10.1016/j.it.2005.02.006 Terenius, O., Papanicolaou, A., Garbutt, J.S., Eleftherianos, I., Huvenne, H., Kanginakudru, S., Albrechtsen, M., An, C., Aymeric, J.L., Barthel, A., Bebas, P., Bitra, K., Bravo, A., Chevalier, F., Collinge, D.P., Crava, C.M., de Maagd, R.A., Duvic, B., Erlandson, M., Faye, I., Felföldi, G., Fujiwara, H., Futahashi, R., Gandhe, A.S., Gatehouse, H.S., Gatehouse, L.N., Giebultowicz, J.M., Gómez, I., Grimmelikhuijzen, C.J., Groot, A.T., Hauser, F., Heckel, D.G., Hegedus, D.D., Hrycaj, S., Huang, L., Hull, J.J., Iatrou, K., Iga, M., Kanost, M.R., Kotwica, J., Li, C., Li, J., Liu, J., Lundmark, M., Matsumoto, S., Meyering-Vos, M., Millichap, P.J., Monteiro, A., Mrinal, N., Niimi, T., Nowara, D., Ohnishi, A., Oostra, V., Ozaki, K., Papakonstantinou, M., Popadic, A., Rajam, M.V., Saenko, S., Simpson, R.M., Soberón, M., Strand, M.R., Tomita, S., Toprak, U., Wang, P., Wee, C.W., Whyard, S., Zhang, W., Nagaraju, J., Ffrench-Constant, R.H., Herrero, S., Gordon, K., Swevers, L., Smagghe, G. (2011) RNA interference in Lepidoptera: an overview of successful and unsuccessful studies and implications for experimental
design.
J.
Insect
Physiol.
57,
231–245.
doi:
10.1016/j.jinsphys.2010.11.006 Vertyporokh, L., Taszłow, P., Samorek-Pieróg, M., Wojda, I., 2015. Short-term heat shock affects the course of immune response in Galleria mellonella naturally infected with the entomopathogenic fungus Beauveria bassiana. J. Invertebr. Pathol. 130, 42–51. doi: 10.1016/j.jip.2015.07.001 Vodovar, N., Vinals, M., Liehl, P., Basset, A., Degrouard, J., Spellman, P., Boccard, F., Lemaitre, B., 2005. Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species. Proc. Natl. Acad. Sci. USA 102, 11414– 11419. doi: 10.1073/pnas.0502240102 Wang, G., Guo, Y., Zhou, T., Shi, X., Yu, J., Yang, Y., Wu, Y., Wang, J., Liu, M., Chen, X., Tu, W., Zeng, Y., Jiang, M., Li, S., Zhang, P., Zhou, Q., Zheng, B., Yu, C., Zhou, Z., Guo, X., Sha, J., 2013. In-depth proteomic analysis of the human sperm reveals complex
protein
compositions.
J.
Proteomics
79,
114–122.
doi:
10.1016/j.jprot.2012.12.008 Wang, Y., Cheng, T., Rayaprolu, S., Zou, Z., Xia, Q., Xiang, Z., Jiang, H., 2007. Proteolytic activation of pro-spätzle is required for the induced transcription of antimicrobial 20
peptide genes in lepidopteran insects. Dev. Comp. Immunol. 31, 1002–1012. doi: 10.1016/j.dci.2007.01.001 Wang, X.H., Aliyari, R., Li, W.X., Li, H.W., Kim, K., Carthew, R., Atkinson, P., Ding, S.W., 2006. RNA interference directs innate immunity against viruses in adult Drosophila. Science 312, 452–454. doi: 10.1126/science.1125694 Zhang, K., Gao, R., Zhang, H., Cai, X., Shen, C., Wu, C., Zhao, S., Yu, L., 2005. Molecular cloning and characterization of three novel lysozyme-like genes, predominantly expressed in the male reproductive system of humans, belonging to the C-type lysozyme/alpha-lactalbumin
family.
doi:10.1095/biolreprod.105.041889
21
Biol.
Reprod.
73,
1064–1071.
22
23
24
25
26
27
Table 1: List of primers used in this study Primer Name ALLP1 F ALLP1 R
Sequence (5’ – 3’)
Amplicon (bp)
BLLP1 F
AGGGCGGAAATTGCAACAT
BLLP1 R
TTAGATGCGCAAAACGGGTAT
Spätzle FP Spätzle RP
AACCGAATCGCATGAGTGA AGCATCCCGAACTGAAAATG
105
Relish FP Relish RP
TTCGGTGGAATGGGTATCAT TTGTGCGTTTGAAGTTCAGC
165
STAT FP STAT RP
GAGCGTTATGGACGAGAAGC CATAGTCCACGGCAACCAGG
125
Actin F Actin R RNAi primers RD1FP RD1RP
GGCATGGGACAGAAGGACT CGAACACGGAATCGTCACTA
97
RD2FP
CAATAACAATTTCAACGATG
RD2RP
GACATATTTACCATAGTGTACATATTA
CGATGGAAATTGTGCTCTAAAGG AATGGGTGGCCAGATGCA
74 81
Amplicon (bp)
Sequence (5’ – 3’) GAACAGCCACAGGACTACTT AGTGCTGCTTCGAACGATCT
28
527 117
Table 2: Effect of recombinant protein (ALLP1) on the proliferation of NPV. Treatments
Mean infectivity
Mean no. of OBs/mL (x 106)
BmN cells + BmNPV
82.74 ± 5.23a*
4.19 ± 0.73a
BmN cells + BmNPV + recALLP1
83.85 ± 1.35a
3.11 ± 0.24b
BmN cells + BmNPV + Buffer
79.51 ± 3.68a
4.38 ± 0.76a
Data was analysed with Student’s t test and presented as mean±SE (n=3). *Different letters indicate statistically significant difference, (p<0.05).
29
Gram¯ bacteria & Virus (current work)
Gram+
bacteria, Fungi, Yeasts
Viruses e.g. BmNPV
Virus ingestion with food or direct injection
Imd
Toll
Jak-STAT
X (?)
X E. coli injection into hemocoel
Dorsal/Dif
Relish
STAT
Immune-competent cells e.g. fat body
Silkworm
LLPs expression
INFECTION RESISTANCE
Role of Relish in upregulation of LLPs upon infection in silkworms
Highlights
Lysozyme-like proteins (LLPs) are glycoside hydrolases (GH22).
ALLP1 and BLLP1 are induced after bacterial challenge and involved in control of bacteria.
Knockdown (KD) of Relish variant 1 (RD1) abolished the induction of this protein, where KD larvae show a higher bacterial load compare to control larvae.
ALLP1 is under the control of the IMD pathway but not Toll or JAK/STAT pathways.
LLPs have an antiviral activity.
30