- Email: [email protected]
The kinase inhibitor Sorafenib impairs the antiviral effect of interferon α on hepatitis C virus replication
European Journal of Cell Biology 92 (2013) 12–20
Contents lists available at SciVerse ScienceDirect
European Journal of Cell Biology journal homepage: www.elsevier.com/locate/ejcb
The kinase inhibitor Sorafenib impairs the antiviral effect of interferon ␣ on hepatitis C virus replication Kiyoshi Himmelsbach, Eberhard Hildt ∗ Paul-Ehrlich-Institute, Division of Virology, Langen, Germany
a r t i c l e
i n f o
Article history: Received 26 June 2012 Received in revised form 8 September 2012 Accepted 14 September 2012 Keywords: Hepatitis C virus Sorafenib Signal transduction Cell biology Interferon ␣
a b s t r a c t Recently, it was shown that the kinase inhibitor Sorafenib efficiently blocks HCV replication by inhibition of c-Raf. However, a longer treatment with higher doses of Sorafenib might be associated with adverse effects. Therefore, it was analysed whether a decreased dose of Sorafenib can be applied in combination with interferon ␣ to obtain additive antiviral, but at the same time decreased adverse effects. However, Sorafenib abolishes the inhibitory effect of interferon ␣ on HCV replication and vice versa. In order to reveal the underlying mechanisms, we observed that on the one hand IFN␣ activates c-Raf and thereby counteracts the inhibitory effect of Sorafenib on HCV replication that is based on the Sorafenib-dependent inhibition of c-Raf. On the other hand we found that the IFN␣-induced PKR-phosphorylation depends on c-Raf. So, Sorafenib as a potent inhibitor of c-Raf prevents the IFN␣-dependent PKR phosphorylation. Moreover, Sorafenib inhibits c-Raf-independent the phosphorylation of STAT1 resulting in an impaired induction of IFN␣-dependent genes. Taken together, these data indicate that a combined application of Sorafenib and interferon ␣ in order to obtain an antiviral effect is not useful since Sorafenib exerts an inhibitory effect on targets that are crucial for the transduction of interferon ␣-dependent antiviral response. © 2012 Elsevier GmbH. All rights reserved.
Introduction Hepatitis C virus (HCV) infection results in chronic hepatitis in more than 70% of infected individuals. At present more than 170 million people are persistently infected with HCV worldwide (Koziel and Peters, 2007). Persistent HCV infection is associated with chronic inflammation of the liver (hepatitis), which can progress to liver fibrosis, cirrhosis, and hepatocellular carcinoma (HCC). The standard treatment of chronic hepatitis C (CHC) is peginterferon alpha (PEG-IFN␣) plus ribavirin (RBV) for 48 weeks in patients infected with genotype 1, and 24 weeks for those infected with genotype 2 or 3 (Torriani et al., 2004; Zeuzem et al., 2008). However, the frequency of adverse effects associated with the use of interferon is significant. Adverse effects include the flu-like syndrome, haematological side effects, psychiatric side effects, etc. (Askarieh et al., 2010). Recent approaches to affect HCV replication are based on the development of HCV-specific protease inhibitors and on kinase
Abbreviations: HCV, hepatitis C virus; HCC, hepatocellular carcinoma; IFN, interferon; tdn, trans dominant negative; RBV, ribavirin; OAS, oligoadenylate synthase; PKR, protein kinase R. ∗ Corresponding author at: Paul-Ehrlich-Institute, Division of Virology, PaulEhrlich-Str. 51-59, D-63225 Langen, Germany. Tel.: +49 6103772140; fax: +49 6103771273. E-mail address: [email protected] (E. Hildt). 0171-9335/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.ejcb.2012.09.001
inhibitors (Soriano et al., 2009). It has been shown by us recently that the kinase inhibitor Sorafenib efficiently impairs HCV replication of infectious HCV particles by inhibition of c-Raf as observed in HCV infected Huh7.5 cells or primary human hepatocytes (Himmelsbach et al., 2009). This promising approach might be limited by the fact that the main target of Sorafenib c-Raf as a central kinase is involved in the control of a variety of intracellular signal transduction cascades: Therefore, in case of Sorafenib treatment over a longer time period, significant adverse effects can be expected as described for RCC or HCC patients treated with this substance (Welker et al., 2010). In light of this it was tempting to speculate whether a combination of lower doses of IFN␣ and of Sorafenib could help to decrease adverse effects, but results in additive antiviral effects. Materials and methods Plasmids Plasmids pJFH1, pJFH1/GND, pFK-lucJFH1/wt and pRafC4 have been described previously (Himmelsbach et al., 2009; Bruder et al., 1992; Carvajal-Yepes et al., 2011; Wakita et al., 2005). The overexpression of the RafC4 mutant was demonstrated by Western blot analysis (data not shown). For analysis of ISRE-dependent gene expression pISREluc (Stratagene, La Jolla, CA, USA) was used as reporter construct.
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
13
Fig. 1. Sorafenib impairs the inhibitory effect of IFN␣ on HCV replication. (a) Western blot analysis of cellular lysates derived from HCV replicating Huh7.5 cells stimulated with the indicated amounts of IFN␣ in the absence or presence of 7.5 M Sorafenib. NS5A was detected using a polyclonal rabbit derived serum (Bruder et al., 1992), actin was detected to control equal loading. (b) Immunofluorescence microscopy of HCV replicating cells using core- (green) or NS5A- (red) specific antisera. Nuclei were stained with DAPI. Untreated HCV-positive cells served as control. Cells were grown in the presence of 100 U/ml IFN for 6 h or 5 M Sorafenib or both reagents were administered simultaneously. (c) Northern blot analysis of total RNA isolated from HCV replicating cells that were incubated with the incubated amounts of IFN␣ for 6 h in the presence or absence of 5 M Sorafenib. Untreated HCV positive cells served as control. For detection of HCV a NS5A-specific probe was used. Detection of 28S and 18S rRNA served as loading control.
14
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
Fig. 2. Sorafenib impairs IFN␣-dependent PKR phosphorylation. (a) Western blot analysis using c-Raf- and anti-active c-Raf (phospho-Raf Ser338)-specific antisera of cellular lysates derived from Huh7.5 cells stimulated with the indicated amounts of IFN␣ for 6 h. (b) Immunocomplex assay for analysis of c-Raf activity using recombinant MEK and ␥32 P-ATP as substrates. Prior precipitation Huh7.5 cells were treated for 6 h with the indicated amounts of IFN␣, Sorafenib or with a combination of both compounds. The factors represent the relative activity referred to the untreated cells that served as control. (c) Western blot analysis using PKR and phospho-PKR-specific (Thr446) antisera of cellular lysates derived from Huh7.5 cells stimulated for 6 h with the indicated amounts of IFN␣ in the absence or presence of 7.5 M Sorafenib. Untreated Huh7.5 cells served as controls. Actin was detected to control equal loading. (d) Western blot analysis using a c-Raf-specific antiserum cellular lysates derived from Huh7.5 cells transfected with the indicated amount of pUC18 or pRafC4. Untransfected Huh7.5 cells served as additional control. Actin was detected to control equal loading. (e) Huh7.5 cells were transfected as indicated with pRafC4 (0.5 g/well of a six well plate) or for the control experiments with the equal amount of pUC18 and stimulated for 6 h as indicated with IFN␣. The cells were lysed and analysed by Western blotting using PKR and phospho-PKR-specific antisera. Actin was detected to control equal loading.
Cell culture, transfection and inhibitors For transfection and infection assays the Huh7-derived cell clone Huh7.5, which is highly permissive for HCV RNA replication, was used. Cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, Deisenhofen, Germany) supplemented with 2 mM l-glutamine, nonessential amino acids, 100 units of penicillin per ml, 100 g of streptomycin per ml, and 10% foetal calf serum (DMEM complete). Transfection experiments were performed using PEI (polyethyleneimine) as
transfection reagent as described (Himmelsbach et al., 2009) using 0.8 g plasmid/well of a six-well-plate. Transfection of an eGFP expression vector was performed for determination of the transfection efficiency that was found to be about 60–75%. Luciferase reporter gene assays were performed as described (Carvajal-Yepes et al., 2011). Sorafenib was purchased from (LC Laboratories Woburn, MA, USA), dissolved in DMSO and applied as described recently (Himmelsbach et al., 2009). Interferon ␣ was purchased from Pepro Tech (Rocky Hill NJ, USA).
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
15
Fig. 3. Sorafenib prevents the induction of IFN␣-dependent genes. (a) Real time PCR analysis of total RNA isolated from Huh7.5 cells that were incubated with the indicated amounts of IFN for 6 h in the presence or absence of 7.5 M Sorafenib. Primer for the amplification of OAS1, MxA and PKR-specific fragments were used. Amplification of an actin-specific fragment served as internal control. All experiments were done in triplicate. The figure shows the mean values. The bars represent the standard deviation. (b) Western blot analysis using OAS1- and MxA-specific antisera of cellular lysates derived from Huh7.5 cells that were stimulated with 100 U IFN␣ for 6 h in the presence or absence of 7.5 M Sorafenib. Unstimulated Huh7.5 cells served as control. Actin was detected to control equal loading. (c) Huh7.5 cells were transfected with an expression vector encoding for the tdn Raf mutant RafC4 or with the equivalent amount of pcDNA3.1 as control. Cells were stimulated with interferon ␣ at the indicated concentrations. RT-PCR analysis was performed as described above. All experiments were done in triplicate. The figure shows the mean values. The bars represent the standard deviation. (d) Western blot analysis using OAS1- and MxA-specific antisera of cellular lysates derived from Huh7.5 cells that were transfected with pRafC4 or with the equivalent amount of pUC18 as control. Cells were stimulated with 100 U IFN␣. Unstimulated Huh7.5 cells served as control. Actin was detected to control equal loading.
In vitro transcription and RNA transfection In vitro transcription and electroporation of HCV RNAs were performed as described (Carvajal-Yepes et al., 2011; Burckstummer et al., 2006; Sauter et al., 2009). All experiments were done at least in triplicate. RT-PCR, real time PCR and Northern blotting RNA isolation was performed using Trizol (Invitrogen, Karlsruhe, Germany), according to the instructions of the manufacturer. For cDNA synthesis, 2–4 g of total RNA were treated with DNase I. First-strand synthesis was carried out using SupercriptII reverse transcriptase (Invitrogen). Northern blotting was performed as described (Himmelsbach et al., 2009). Real time PCR for quantification of HCV RNA was performed using a commercial assay kit (Maxima SYBR Green, Fermentas) according to the instructions of the manufacturer. The following primer were used for RT-PCR: HCVfwd: atgaccacaaggcctttcg, HCVrev: cgggagccatagtgg; OAS1fwd: ggtagctcctacctgtgtg, OAS1rev: gaggggcagggatgaatggc; OAS2fwd: ctgaagttctgtctgttcacg. OAS2rev: ccaagatggt-gcaggtaactc; PKRfwd: ctgaaggtgacttctcagcag, PKrev: cccttactccttgttcgctttcc; GAPDHfwd: gacccttcattgacctcaac, and GAPDHrev: tggactgtggtcatgagtcc Western blot analysis and immunofluorescence microscopy Western blotting was performed as described (Carvajal-Yepes et al., 2011). For detection of the NS5A protein, a rabbit-derived polyclonal serum (Burckstummer et al., 2006) was used. For detection of c-Raf, a commercial mouse monoclonal antibody was
used (Transduction Laboratories, San Jose, USA). The antibody for detection of phospho-c-Raf (Ser338) was purchased from Upstate (Billerica,USA). For detection of core and NS3, commercial sera purchased from Affinity BioReagents (Omaha, USA), and ViroStat (Portland, USA), respectively, were instrumental. The anti STAT1 alpha-specific antibody was purchased from Millipore (AB16951), the phospho-STAT1 specific from Santa Cruz (SCBT, Santa Cruz, USA) the PKR-specific from Cell Signaling (Danvers, USA) and the phospho-PKR (Thr446) from Thermo (Bonn, Germany). Phosphorylation of Thr446 and Thr451 is critical for PKR kinase activity. The OAS2 and Mx1/2/3-specific antisera were purchased from SCBT (Santa Cruz, USA). Immunofluorescence staining was analysed by confocal laser scanning microscopy (CLSM) using the Leica confocal microscope TCS SP2. The following antisera were used: anti-NS5A (rabbit) (Burckstummer et al., 2006), anti-HCV core (mouse) (Affinity BioReagents, Omaha, USA), anti STAT1 alpha-specific antibody and the phospho-STAT1 specific-antibody. Bound antibodies were visualized using Cy2- and Cy3-conjugated secondary antibodies (Dianova, Hamburg, Germany). For nuclear staining, DAPI (4,6diamidino-2-phenylindole, Sigma, Deisenhofen, Germany) was used. Subcellular fractionation and immunocomplex assay Subcellular fractionation and immunocomplex assay were performed as described (Sauter et al., 2009). The MEK phosphorylation was analysed by autoradiography. To control equal loading the gel was stained with Coomassie. For quantification of the c-Raf activity the MEK phosphorylation was referred to the intensity of the IgG heavy chain.
16
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
Fig. 4.
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
17
Fig. 4. (Continued )
Results Sorafenib blocks the inhibitory effect of interferon ˛ on HCV replication To study whether a combination of lower doses of IFN␣ and of Sorafenib results in decreased adverse effects, but in additive
antiviral effects HCV replicating cells were treated with a combination of IFN␣ and of Sorafenib. HCV replicating cells were generated by electroporation of Huh7.5 cells with HCV RNAs that were made from the constructs JFH-1 by in vitro transcription as described (Himmelsbach et al., 2009; Carvajal-Yepes et al., 2011). The replication-deficient construct JFH-1-GND served as negative control. HCV replicating cells were treated 24 h after
Fig. 4. Sorafenib impairs STAT1/2 phosphorylation. (a) Western blot analysis of cellular lysates derived from Huh7.5 cells stimulated with the indicated amounts of IFN␣ for 0.5 h in the presence or absence of Sorafenib using STAT1/2 and phosphoSTAT1/2-specific antisera. Actin was detected to control equal loading. (b) Immunofluorescence microscopy of Huh7.5 cells that were incubated with 100 interferon ␣, 7.5 M Sorafenib or with the combination of both drugs. Cells were fixed and stained with a STAT1/2specific polyclonal antiserum. Bound antibodies were visualized by a FITC-conjugated secondary antibody. Nuclei were stained using DAPI (blue fluorescence). (c) Reporter gene assay of Huh7.5 cells that were transfected with 0.5 g/well pISREluc. Cells were stimulated with the indicated amounts of IFN␣, 7.5 M Sorafenib or a combination of both drugs. Untreated cells served as control. (d) Luciferase assay with Huh7.5 cells that were transfected with 0.5 g/well pISREluc and cotransfected with 1 g pRafC4 or as a control with 1 g pUC18 respectively. Furthermore cells were either left untreated or were treated with 100 U IFN␣. (e) Schematic view that describes the interference of Sorafenib with interferon ␣-dependent signalling cascades.
18
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
electroporation with increasing concentrations of IFN␣ for 48 h in the presence of 7.5 M Sorafenib, whereas, untreated cells, cells treated with 5 M Sorafenib and cells treated with increasing concentrations of interferon ␣ in the absence of Sorafenib served as controls. A concentration of 5–7.5 M Sorafenib was chosen since it is well tolerated and results in a significant, but not complete inhibition of HCV replication (Ryan et al., 2007). The Western blot analysis using a NS5A-specific antiserum (Burckstummer et al., 2006) revealed that increasing IFN␣ concentrations result in decreasing levels of NS5A. Moreover, it was shown that exclusive application of Sorafenib at a concentration of 7.5 M strongly decreases the amount of NS5A (Ryan et al., 2007). In accordance to our previous observations that demonstrated that 5–7.5 M Sorafenib causes a strong but not complete inhibition of HCV replication. However, when the incubation with IFN␣ was performed in the presence of 7.5 M Sorafenib, the inhibitory effect of IFN␣ was almost completely abolished and vice versa the inhibitory effect of Sorafenib on HCV replication was impaired by the presence of IFN␣ (Fig. 1a). This was confirmed by immunofluorescence microscopy of HCV replicating cells. The immunofluorescence microscopy shows that treatment of the HCV replicating cells with 10 U IFN␣ or with 5 M Sorafenib decreased the amount of NS5A or core strongly. However, in case of Huh7.5 cells simultaneously treated with the same amounts of IFN␣ and Sorafenib, NS5A and core were still detectable confirming that Sorafenib impairs the IFN␣-dependent inhibitory effect on HCV replication (Fig. 1b). To study directly the effect on HCV replication, RNA was isolated from HCV-positive Huh7.5 cells that were stimulated for 6 h with increasing concentrations of IFN␣ in the presence or absence of Sorafenib. Northern blot analyses revealed that the strong IFN␣dependent decrease in the amount of viral RNA is abrogated by the simultaneous application of Sorafenib. Again the inhibitory effect of IFN␣ on the viral replication is almost completely abolished by the presence of Sorafenib (Fig. 1c). Taken together these data indicate that Sorafenib impairs the antiviral effect of IFN␣ on HCV replication. Interferon ˛ activates c-Raf Sorafenib is known as a potent inhibitor of c-Raf (Hahn and Stadler, 2006; Schreck and Rapp, 2006). Therefore, we asked whether the antiviral effect of IFN␣ depends on c-Raf. To study this, we analysed the effect of IFN␣ on c-Raf by Western blotting using an anti-active Raf (phospho-Raf)-specific antiserum (Ser338). The Western blot shows that IFN␣ induces c-Raf phosphorylation (Fig. 2a). To demonstrate unequivocally that IFN␣-activates c-Raf, immunocomplex assays were performed for direct measurement of c-Raf activity. The autoradiograph (Fig. 2b) clearly shows that there is a IFN␣-dependent activation of c-Raf reflected by the increased phosphorylation of MEK. However, if the IFN␣-dependent stimulation was performed in the presence of Sorafenib, the activation of c-Raf was blocked which indicates that IFN␣ activates c-Raf. A major factor that mediates the antiviral effect of IFN␣ is PKR-activation that finally leads to an interruption of protein biosynthesis. In order to analyse whether Sorafenib affects the interferon alpha-dependent activation of PKR, cells were incubated with various concentrations of interferon ␣ in the presence or absence of Sorafenib. The effect on PKR activation was studied by Western blotting using phosphor-PKR (Thr446) and PKR-specific antisera. Since PKR contains at least 15 phosphorylation sites, but only Thr446 and Thr451 are crucial for PKR kinase activity, an antiserum that recognizes phosphoThr446 was used. The blots demonstrate that the interferon-dependent phosphorylation of PKR is abolished by the presence of Sorafenib (Fig. 2c). Since a
variety of kinases was described to affect PKR-phosphorylation, we analysed whether the inhibitory effect of Sorafenib on the IFN␣dependent PKR phosphorylation indeed depends on its inhibition of c-Raf. For this purpose c-Raf was specifically blocked by overexpression of a transdominant negative mutant (Raf C4) (Bruder et al., 1992). Expression of the tdn mutant was shown by Western blot analysis using a c-Raf-specific antiserum (Fig. 2d), functionality by inhibition of the HBx-dependent activation of AP-1 (data not shown). The P-PKR- and PKR-specific Western blots show that overexpression of the tdn mutant abolishes the IFN␣-dependent phosphorylation of PKR (Fig. 2e). These experiments reveal that the interferon-dependent phosphorylation of PKR requires the functionality of c-Raf. Sorafenib interferes with the induction of IFN˛-dependent genes There are conflicting reports about the interference of Sorafenib with IFN␣-dependent signalling. It is suggested that Sorafenib could interfere with the induction of an IFN␣ response by unspecific inhibition of Jak1 resulting in an impaired induction of IFN␣dependent marker genes (Blechacz et al., 2009; Kumar et al., 2007; Yang et al., 2010). To study whether Sorafenib interferes with the induction of IFN␣-dependent marker genes the expression of PKR, OAS1, and of OAS2 was analysed in the presence or absence of 7.5 M Sorafenib by RT-PCR. The gene expression analysis demonstrates that the induction of these marker genes upon IFN␣ treatment was abolished when combined with 7.5 M Sorafenib (Fig. 3a). Comparable results were obtained by Northern blotting (data not shown) and by Western blotting using OAS1 and MxA-specific antisera (Fig. 3b). Based on this, we asked whether the inhibitory effect of Sorafenib is due to its inhibitory effect on c-Raf. To address this point, c-Raf was again specifically blocked by overexpression of the tdn mutant (RafC4). The RT-PCR shows that the coexpression of the tdn c-Raf mutant does not affect the interferon-dependent induction of these marker genes. The same results were obtained, if higher amounts of the expression vector encoding for RafC4 were transfected (Fig. 3c). These data were corroborated by a Western blot analysis using OAS1- and MxA-specific antisera (Fig. 3d). The analysis of IFN induced marker gene expression displays that the inhibitory effect of Sorafenib is not due to its inhibition of c-Raf. Sorafenib interferes with the STAT activation Sorafenib is described as c-Raf specific inhibitor (Hahn and Stadler, 2006; Schreck and Rapp, 2006), but the activity of other kinases might be affected as well. Since an interference of Sorafenib with Jak1 and Tyk2 that was reported (Hancock et al., 2010; Su et al., 2007) this cannot be excluded. To study whether under the chosen conditions Sorafenib interferes with STAT1 phosphorylation, Huh7.5 cells were stimulated with IFN␣ in the presence or absence of Sorafenib. The effect on STAT phosphorylation was analysed by Western blotting using a phospho-STAT1 and a STAT1 specific antiserum. The Western blot shows that the interferon dependent phosphorylation of STAT1 is prevented in the presence of Sorafenib (Fig. 4a). Phosphorylation of STAT1 is one step in the cascade finally leading to the translocation of STAT1 in the nucleus. To study whether Sorafenib affects the nuclear translocation of STAT1, cells were stimulated with IFN␣ in the presence or absence of Sorafenib. Nuclear translocation of STAT1 was analysed by confocal immunofluorescence microscopy (Fig. 4b) which illustrates that the IFN␣-dependent translocation of STAT1/2 from the cytoplasm to the nucleus is impaired by the kinase inhibitor. Comparable results were obtained by Western blot analysis of the nuclear fraction (data not shown). STAT1/2 are key factors for the induction of
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
ISRE-dependent genes. Reporter gene experiments using an ISREdependent luciferase gene as reporter (pISREluc) revealed that Sorafenib efficiently inhibits the IFN␣-dependent induction of the reporter gene (Fig. 4c) while co-expression of the tdn Raf does not affect the IFN␣-dependent induction of the reporter gene (Fig. 4d). This indicates that the Sorafenib-dependent inhibition of STAT1/2 is not mediated by the inhibitory effect of Sorafenib on c-Raf. Taken together, we were able to demonstrate that Sorafenib in addition to its inhibitory function on PKR phosphorylation prevents independent from c-Raf the activation of STAT1 and thereby interferes with the interferon ␣-dependent induction of marker genes (Fig. 4e).
Discussion Interferon ␣ is a well-established drug for the treatment of HCV infection. However, the frequency of adverse effects associated with the use of interferon is significant affecting the compliance to a IFN␣-based therapy. Recently, we observed that the c-Raf inhibitor Sorafenib that is approved by the FDA for the treatment of HCC and RCC efficiently blocks HCV replication. However, due to the inhibition of the central kinase c-Raf, treatment with Sorafenib over a longer time period might be associated with significant adverse effects described for RCC or HCC patients treated with this substance (Welker et al., 2010). Based on this, we speculated whether a combination of lower doses of IFN␣ and of Sorafenib decreased adverse effects, while additive antiviral effects could be obtained. Surprisingly it was observed that the antiviral effect disappeared if both substances were applied simultaneously. Further analyses revealed that at least two mechanisms confer to this, on the one hand the inhibitory effect of Sorafenib on c-Raf prevents PKR phosphorylation and on the other hand impairs STAT1 phosphorylation. A recent report showed that the IFN␣-dependent tyrosine phosphorylation of PKR depends on the activation of Jak1 and Tyk2 (Su et al., 2007). Further data suggest a direct interaction of Jak1 and PKR. In contrast to these data that are based on monocytes we observed in hepatoma cells a dependence on c-Raf. Both inhibition of c-Raf by Sorafenib or coexpression of a tdn mutant (RafC4) abolishes the interferon ␣-dependent phosphorylation of PKR. However, it cannot be concluded from these data that c-Raf directly phosphorylates PKR. While our data indicate that the interferon ␣-dependent phosphorylation of PKR requires the functionality of c-Raf, the inhibitory effect of Sorafenib on Stat1-phosphorylation does not depend on c-Raf. Here coexpression of RafC4 does neither affect Stat1 phosphorylation (data not shown) nor the translocation of activated Stat1/2 into the nucleus. In accordance to this, the expression of ISRE-dependent genes as MxA or 2 ,5 -OAS is not affected by coexpression of the tdn mutant of c-Raf. In cholongiocarcinoma cells and in glioblastoma cells it was observed that Sorafenib accelerates the dephosphorylation of STAT3 by activation of the phosphatase shatterproof2 (SHP2) (Blechacz et al., 2009; Kumar et al., 2007; Yang et al., 2010) that appeared to be stimulated by c-Raf inhibition. Regarding STAT1, no effect of c-Raf inhibition by coexpression of a tdn mutant (RafC4) on the phosphorylation of STAT1 was observed and in accordance to this, no effect on the induction of interferon ␣dependent marker genes. Based on this it can be assumed that the inhibitory effect of Sorafenib on STAT1 phosphorylation and the subsequently impaired induction of interferon marker genes like MxA and OAS1/2 is due to the Sorafenib-dependent inhibition of Jak1/Tyk2. This is corroborated by a recent multi-pathway cellular analysis of compound selectivity that described significant effects of Sorafenib on the JAK/STAT pathway (Hancock et al., 2010). For the Sorafenib-dependent inhibition of Jak1 an IC50 of 1.2 M was found for 293 cells (Hancock et al., 2010).
19
Based on these data it can be concluded that a combined application of Sorafenib and of interferon to control HCV replication is not useful since the interferon-dependent activation of c-Raf counteracts the Sorafenib-dependent inhibition of c-Raf and vice versa the inhibitory effects of Sorafenib und c-Raf und Jak/Tyk prevent the transduction of IFN-dependent effects (Fig. 4d). HCV interferes at several steps with IFN␣-dependent signal transduction: i.e. NS3/4A affects RIG-I (Binder et al., 2007; Cheng et al., 2006) or in case of some genotypes NS5A can bind PKR (Gale et al., 1997) and thereby prevent its phosphorylation. On the one hand integrity of c-Raf is crucial for the IFN␣-dependent phosphorylation of PKR, on the other hand the interference of HCV NS5A with c-Raf that sequesters c-Raf to the replicon complex interrupts c-Raf signalling. Therefore, this can be interpreted as a further strategy of HCV to counteract IFN␣ signalling by preventing c-Raf-dependent PKR phosphorylation. Conflict of interest Nothing to declare. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ejcb.2012.09.001. References Askarieh, G., Alsio, A., Pugnale, P., Negro, F., Ferrari, C., Neumann, A.U., et al., 2010. Systemic and intrahepatic interferon-gamma-inducible protein 10 kDa predicts the first-phase decline in hepatitis C virus RNA and overall viral response to therapy in chronic hepatitis C. Hepatology 51 (May (5)), 1523–1530. Binder, M., Kochs, G., Bartenschlager, R., Lohmann, V., Hepatitis C, 2007. virus escape from the interferon regulatory factor 3 pathway by a passive and active evasion strategy. Hepatology 46 (November (5)), 1365–1374. Blechacz, B.R., Smoot, R.L., Bronk, S.F., Werneburg, N.W., Sirica, A.E., Gores, G.J., 2009. Sorafenib inhibits signal transducer and activator of transcription-3 signaling in cholangiocarcinoma cells by activating the phosphatase shatterproof 2. Hepatology 50 (December (6)), 1861–1870. Bruder, J.T., Heidecker, G., Rapp, U.R., 1992. Serum-TPA-, and Ras-induced expression from Ap-1/Ets-driven promoters requires Raf-1 kinase. Genes Dev. 6 (April (4)), 545–556. Burckstummer, T., Kriegs, M., Lupberger, J., Pauli, E.K., Schmittel, S., Hildt, E., 2006. Raf-1 kinase associates with hepatitis C virus NS5A and regulates viral replication. FEBS Lett. 580 (January (2)), 575–580. Carvajal-Yepes, M., Himmelsbach, K., Schaedler, S., Ploen, D., Krause, J., Ludwig, L., et al., 2011. Hepatitis C virus impairs the induction of cytoprotective Nrf2 target genes by delocalization of small Maf proteins. J. Biol. Chem. 286 (March (11)), 8941–8951. Cheng, G., Zhong, J., Chisari, F.V., 2006. Inhibition of dsRNA-induced signaling in hepatitis C virus-infected cells by NS3 protease-dependent and -independent mechanisms. Proc. Natl. Acad. Sci. U.S.A. 103 (May (22)), 8499–8504. Gale Jr., M.J., Korth, M.J., Tang, N.M., Tan, S.L., Hopkins, D.A., Dever, T.E., et al., 1997. Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein. Virology 230 (April (2)), 217–227. Hahn, O., Stadler, W., 2006. Sorafenib. Curr. Opin. Oncol. 18 (November (6)), 615–621. Hancock, M.K., Lebakken, C.S., Wang, J., Bi, K., 2010. Multi-pathway cellular analysis of compound selectivity. Mol. Biosyst. 6 (October (10)), 1834–1843. Himmelsbach, K., Sauter, D., Baumert, T.F., Ludwig, L., Blum, H.E., Hildt, E., 2009. New aspects of an anti-tumour drug: sorafenib efficiently inhibits HCV replication. Gut 58 (December (12)), 1644–1653. Koziel, M.J., Peters, M.G., 2007. Viral hepatitis in HIV infection. N. Engl. J. Med. 356 (April (14)), 1445–1454. Kumar, K.G., Liu, J., Li, Y., Yu, D., Thomas-Tikhonenko, A., Herlyn, M., et al., 2007. Raf inhibitor stabilizes receptor for the type I interferon but inhibits its antiproliferative effects in human malignant melanoma cells. Cancer Biol. Ther. 6 (September (9)), 1437–1441. Ryan, C.W., Goldman, B.H., Lara Jr., P.N., Mack, P.C., Beer, T.M., Tangen, C.M., et al., 2007. Sorafenib with interferon alfa-2b as first-line treatment of advanced renal carcinoma: a phase II study of the Southwest Oncology Group. J. Clin. Oncol. 25 (August (22)), 3296–3301. Sauter, D., Himmelsbach, K., Kriegs, M., Carvajal, Y.M., Hildt, E., 2009. Localization determines function: N-terminally truncated NS5A fragments accumulate in the nucleus and impair HCV replication. J. Hepatol. 50 (May (5)), 861–871. Schreck, R., Rapp, U.R., 2006. Raf kinases: oncogenesis and drug discovery. Int. J. Cancer 119 (November (10)), 2261–2271.
20
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
Soriano, V., Peters, M.G., Zeuzem, S., 2009. New therapies for hepatitis C virus infection. Clin. Infect. Dis. 48 (February (3)), 313–320. Su, Q., Wang, S., Baltzis, D., Qu, L.K., Raven, J.F., Li, S., et al., 2007. Interferons induce tyrosine phosphorylation of the eIF2alpha kinase PKR through activation of Jak1 and Tyk2. EMBO Rep. 8 (March (3)), 265–270. Torriani, F.J., Rodriguez-Torres, M., Rockstroh, J.K., Lissen, E., Gonzalez-Garcia, J., Lazzarin, A., et al., 2004. Peginterferon Alfa-2a plus ribavirin for chronic hepatitis C virus infection in HIV-infected patients. N. Engl. J. Med. 351 (July (5)), 438– 450. Wakita, T., Pietschmann, T., Kato, T., Date, T., Miyamoto, M., Zhao, Z., et al., 2005. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat. Med. 11 (July (7)), 791–796.
Welker, M.W., Lubomierski, N., Gog, C., Herrmann, E., Engels, K., Vogl, T.J., et al., 2010. Efficacy and safety of sorafenib in advanced hepatocellular carcinoma under daily practice conditions. J. Chemother. 22 (June (3)), 205– 211. Yang, F., Brown, C., Buettner, R., Hedvat, M., Starr, R., Scuto, A., et al., 2010. Sorafenib induces growth arrest and apoptosis of human glioblastoma cells through the dephosphorylation of signal transducers and activators of transcription 3. Mol. Cancer Ther. 9 (April (4)), 953–962. Zeuzem, S., Nelson, D.R., Marcellin, P., 2008. Dynamic evolution of therapy for chronic hepatitis C: how will novel agents be incorporated into the standard of care? Antivir. Ther. 13 (6), 747–760.
Contents lists available at SciVerse ScienceDirect
European Journal of Cell Biology journal homepage: www.elsevier.com/locate/ejcb
The kinase inhibitor Sorafenib impairs the antiviral effect of interferon ␣ on hepatitis C virus replication Kiyoshi Himmelsbach, Eberhard Hildt ∗ Paul-Ehrlich-Institute, Division of Virology, Langen, Germany
a r t i c l e
i n f o
Article history: Received 26 June 2012 Received in revised form 8 September 2012 Accepted 14 September 2012 Keywords: Hepatitis C virus Sorafenib Signal transduction Cell biology Interferon ␣
a b s t r a c t Recently, it was shown that the kinase inhibitor Sorafenib efficiently blocks HCV replication by inhibition of c-Raf. However, a longer treatment with higher doses of Sorafenib might be associated with adverse effects. Therefore, it was analysed whether a decreased dose of Sorafenib can be applied in combination with interferon ␣ to obtain additive antiviral, but at the same time decreased adverse effects. However, Sorafenib abolishes the inhibitory effect of interferon ␣ on HCV replication and vice versa. In order to reveal the underlying mechanisms, we observed that on the one hand IFN␣ activates c-Raf and thereby counteracts the inhibitory effect of Sorafenib on HCV replication that is based on the Sorafenib-dependent inhibition of c-Raf. On the other hand we found that the IFN␣-induced PKR-phosphorylation depends on c-Raf. So, Sorafenib as a potent inhibitor of c-Raf prevents the IFN␣-dependent PKR phosphorylation. Moreover, Sorafenib inhibits c-Raf-independent the phosphorylation of STAT1 resulting in an impaired induction of IFN␣-dependent genes. Taken together, these data indicate that a combined application of Sorafenib and interferon ␣ in order to obtain an antiviral effect is not useful since Sorafenib exerts an inhibitory effect on targets that are crucial for the transduction of interferon ␣-dependent antiviral response. © 2012 Elsevier GmbH. All rights reserved.
Introduction Hepatitis C virus (HCV) infection results in chronic hepatitis in more than 70% of infected individuals. At present more than 170 million people are persistently infected with HCV worldwide (Koziel and Peters, 2007). Persistent HCV infection is associated with chronic inflammation of the liver (hepatitis), which can progress to liver fibrosis, cirrhosis, and hepatocellular carcinoma (HCC). The standard treatment of chronic hepatitis C (CHC) is peginterferon alpha (PEG-IFN␣) plus ribavirin (RBV) for 48 weeks in patients infected with genotype 1, and 24 weeks for those infected with genotype 2 or 3 (Torriani et al., 2004; Zeuzem et al., 2008). However, the frequency of adverse effects associated with the use of interferon is significant. Adverse effects include the flu-like syndrome, haematological side effects, psychiatric side effects, etc. (Askarieh et al., 2010). Recent approaches to affect HCV replication are based on the development of HCV-specific protease inhibitors and on kinase
Abbreviations: HCV, hepatitis C virus; HCC, hepatocellular carcinoma; IFN, interferon; tdn, trans dominant negative; RBV, ribavirin; OAS, oligoadenylate synthase; PKR, protein kinase R. ∗ Corresponding author at: Paul-Ehrlich-Institute, Division of Virology, PaulEhrlich-Str. 51-59, D-63225 Langen, Germany. Tel.: +49 6103772140; fax: +49 6103771273. E-mail address: [email protected] (E. Hildt). 0171-9335/$ – see front matter © 2012 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.ejcb.2012.09.001
inhibitors (Soriano et al., 2009). It has been shown by us recently that the kinase inhibitor Sorafenib efficiently impairs HCV replication of infectious HCV particles by inhibition of c-Raf as observed in HCV infected Huh7.5 cells or primary human hepatocytes (Himmelsbach et al., 2009). This promising approach might be limited by the fact that the main target of Sorafenib c-Raf as a central kinase is involved in the control of a variety of intracellular signal transduction cascades: Therefore, in case of Sorafenib treatment over a longer time period, significant adverse effects can be expected as described for RCC or HCC patients treated with this substance (Welker et al., 2010). In light of this it was tempting to speculate whether a combination of lower doses of IFN␣ and of Sorafenib could help to decrease adverse effects, but results in additive antiviral effects. Materials and methods Plasmids Plasmids pJFH1, pJFH1/GND, pFK-lucJFH1/wt and pRafC4 have been described previously (Himmelsbach et al., 2009; Bruder et al., 1992; Carvajal-Yepes et al., 2011; Wakita et al., 2005). The overexpression of the RafC4 mutant was demonstrated by Western blot analysis (data not shown). For analysis of ISRE-dependent gene expression pISREluc (Stratagene, La Jolla, CA, USA) was used as reporter construct.
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
13
Fig. 1. Sorafenib impairs the inhibitory effect of IFN␣ on HCV replication. (a) Western blot analysis of cellular lysates derived from HCV replicating Huh7.5 cells stimulated with the indicated amounts of IFN␣ in the absence or presence of 7.5 M Sorafenib. NS5A was detected using a polyclonal rabbit derived serum (Bruder et al., 1992), actin was detected to control equal loading. (b) Immunofluorescence microscopy of HCV replicating cells using core- (green) or NS5A- (red) specific antisera. Nuclei were stained with DAPI. Untreated HCV-positive cells served as control. Cells were grown in the presence of 100 U/ml IFN for 6 h or 5 M Sorafenib or both reagents were administered simultaneously. (c) Northern blot analysis of total RNA isolated from HCV replicating cells that were incubated with the incubated amounts of IFN␣ for 6 h in the presence or absence of 5 M Sorafenib. Untreated HCV positive cells served as control. For detection of HCV a NS5A-specific probe was used. Detection of 28S and 18S rRNA served as loading control.
14
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
Fig. 2. Sorafenib impairs IFN␣-dependent PKR phosphorylation. (a) Western blot analysis using c-Raf- and anti-active c-Raf (phospho-Raf Ser338)-specific antisera of cellular lysates derived from Huh7.5 cells stimulated with the indicated amounts of IFN␣ for 6 h. (b) Immunocomplex assay for analysis of c-Raf activity using recombinant MEK and ␥32 P-ATP as substrates. Prior precipitation Huh7.5 cells were treated for 6 h with the indicated amounts of IFN␣, Sorafenib or with a combination of both compounds. The factors represent the relative activity referred to the untreated cells that served as control. (c) Western blot analysis using PKR and phospho-PKR-specific (Thr446) antisera of cellular lysates derived from Huh7.5 cells stimulated for 6 h with the indicated amounts of IFN␣ in the absence or presence of 7.5 M Sorafenib. Untreated Huh7.5 cells served as controls. Actin was detected to control equal loading. (d) Western blot analysis using a c-Raf-specific antiserum cellular lysates derived from Huh7.5 cells transfected with the indicated amount of pUC18 or pRafC4. Untransfected Huh7.5 cells served as additional control. Actin was detected to control equal loading. (e) Huh7.5 cells were transfected as indicated with pRafC4 (0.5 g/well of a six well plate) or for the control experiments with the equal amount of pUC18 and stimulated for 6 h as indicated with IFN␣. The cells were lysed and analysed by Western blotting using PKR and phospho-PKR-specific antisera. Actin was detected to control equal loading.
Cell culture, transfection and inhibitors For transfection and infection assays the Huh7-derived cell clone Huh7.5, which is highly permissive for HCV RNA replication, was used. Cells were cultivated in Dulbecco’s modified Eagle’s medium (DMEM; Sigma, Deisenhofen, Germany) supplemented with 2 mM l-glutamine, nonessential amino acids, 100 units of penicillin per ml, 100 g of streptomycin per ml, and 10% foetal calf serum (DMEM complete). Transfection experiments were performed using PEI (polyethyleneimine) as
transfection reagent as described (Himmelsbach et al., 2009) using 0.8 g plasmid/well of a six-well-plate. Transfection of an eGFP expression vector was performed for determination of the transfection efficiency that was found to be about 60–75%. Luciferase reporter gene assays were performed as described (Carvajal-Yepes et al., 2011). Sorafenib was purchased from (LC Laboratories Woburn, MA, USA), dissolved in DMSO and applied as described recently (Himmelsbach et al., 2009). Interferon ␣ was purchased from Pepro Tech (Rocky Hill NJ, USA).
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
15
Fig. 3. Sorafenib prevents the induction of IFN␣-dependent genes. (a) Real time PCR analysis of total RNA isolated from Huh7.5 cells that were incubated with the indicated amounts of IFN for 6 h in the presence or absence of 7.5 M Sorafenib. Primer for the amplification of OAS1, MxA and PKR-specific fragments were used. Amplification of an actin-specific fragment served as internal control. All experiments were done in triplicate. The figure shows the mean values. The bars represent the standard deviation. (b) Western blot analysis using OAS1- and MxA-specific antisera of cellular lysates derived from Huh7.5 cells that were stimulated with 100 U IFN␣ for 6 h in the presence or absence of 7.5 M Sorafenib. Unstimulated Huh7.5 cells served as control. Actin was detected to control equal loading. (c) Huh7.5 cells were transfected with an expression vector encoding for the tdn Raf mutant RafC4 or with the equivalent amount of pcDNA3.1 as control. Cells were stimulated with interferon ␣ at the indicated concentrations. RT-PCR analysis was performed as described above. All experiments were done in triplicate. The figure shows the mean values. The bars represent the standard deviation. (d) Western blot analysis using OAS1- and MxA-specific antisera of cellular lysates derived from Huh7.5 cells that were transfected with pRafC4 or with the equivalent amount of pUC18 as control. Cells were stimulated with 100 U IFN␣. Unstimulated Huh7.5 cells served as control. Actin was detected to control equal loading.
In vitro transcription and RNA transfection In vitro transcription and electroporation of HCV RNAs were performed as described (Carvajal-Yepes et al., 2011; Burckstummer et al., 2006; Sauter et al., 2009). All experiments were done at least in triplicate. RT-PCR, real time PCR and Northern blotting RNA isolation was performed using Trizol (Invitrogen, Karlsruhe, Germany), according to the instructions of the manufacturer. For cDNA synthesis, 2–4 g of total RNA were treated with DNase I. First-strand synthesis was carried out using SupercriptII reverse transcriptase (Invitrogen). Northern blotting was performed as described (Himmelsbach et al., 2009). Real time PCR for quantification of HCV RNA was performed using a commercial assay kit (Maxima SYBR Green, Fermentas) according to the instructions of the manufacturer. The following primer were used for RT-PCR: HCVfwd: atgaccacaaggcctttcg, HCVrev: cgggagccatagtgg; OAS1fwd: ggtagctcctacctgtgtg, OAS1rev: gaggggcagggatgaatggc; OAS2fwd: ctgaagttctgtctgttcacg. OAS2rev: ccaagatggt-gcaggtaactc; PKRfwd: ctgaaggtgacttctcagcag, PKrev: cccttactccttgttcgctttcc; GAPDHfwd: gacccttcattgacctcaac, and GAPDHrev: tggactgtggtcatgagtcc Western blot analysis and immunofluorescence microscopy Western blotting was performed as described (Carvajal-Yepes et al., 2011). For detection of the NS5A protein, a rabbit-derived polyclonal serum (Burckstummer et al., 2006) was used. For detection of c-Raf, a commercial mouse monoclonal antibody was
used (Transduction Laboratories, San Jose, USA). The antibody for detection of phospho-c-Raf (Ser338) was purchased from Upstate (Billerica,USA). For detection of core and NS3, commercial sera purchased from Affinity BioReagents (Omaha, USA), and ViroStat (Portland, USA), respectively, were instrumental. The anti STAT1 alpha-specific antibody was purchased from Millipore (AB16951), the phospho-STAT1 specific from Santa Cruz (SCBT, Santa Cruz, USA) the PKR-specific from Cell Signaling (Danvers, USA) and the phospho-PKR (Thr446) from Thermo (Bonn, Germany). Phosphorylation of Thr446 and Thr451 is critical for PKR kinase activity. The OAS2 and Mx1/2/3-specific antisera were purchased from SCBT (Santa Cruz, USA). Immunofluorescence staining was analysed by confocal laser scanning microscopy (CLSM) using the Leica confocal microscope TCS SP2. The following antisera were used: anti-NS5A (rabbit) (Burckstummer et al., 2006), anti-HCV core (mouse) (Affinity BioReagents, Omaha, USA), anti STAT1 alpha-specific antibody and the phospho-STAT1 specific-antibody. Bound antibodies were visualized using Cy2- and Cy3-conjugated secondary antibodies (Dianova, Hamburg, Germany). For nuclear staining, DAPI (4,6diamidino-2-phenylindole, Sigma, Deisenhofen, Germany) was used. Subcellular fractionation and immunocomplex assay Subcellular fractionation and immunocomplex assay were performed as described (Sauter et al., 2009). The MEK phosphorylation was analysed by autoradiography. To control equal loading the gel was stained with Coomassie. For quantification of the c-Raf activity the MEK phosphorylation was referred to the intensity of the IgG heavy chain.
16
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
Fig. 4.
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
17
Fig. 4. (Continued )
Results Sorafenib blocks the inhibitory effect of interferon ˛ on HCV replication To study whether a combination of lower doses of IFN␣ and of Sorafenib results in decreased adverse effects, but in additive
antiviral effects HCV replicating cells were treated with a combination of IFN␣ and of Sorafenib. HCV replicating cells were generated by electroporation of Huh7.5 cells with HCV RNAs that were made from the constructs JFH-1 by in vitro transcription as described (Himmelsbach et al., 2009; Carvajal-Yepes et al., 2011). The replication-deficient construct JFH-1-GND served as negative control. HCV replicating cells were treated 24 h after
Fig. 4. Sorafenib impairs STAT1/2 phosphorylation. (a) Western blot analysis of cellular lysates derived from Huh7.5 cells stimulated with the indicated amounts of IFN␣ for 0.5 h in the presence or absence of Sorafenib using STAT1/2 and phosphoSTAT1/2-specific antisera. Actin was detected to control equal loading. (b) Immunofluorescence microscopy of Huh7.5 cells that were incubated with 100 interferon ␣, 7.5 M Sorafenib or with the combination of both drugs. Cells were fixed and stained with a STAT1/2specific polyclonal antiserum. Bound antibodies were visualized by a FITC-conjugated secondary antibody. Nuclei were stained using DAPI (blue fluorescence). (c) Reporter gene assay of Huh7.5 cells that were transfected with 0.5 g/well pISREluc. Cells were stimulated with the indicated amounts of IFN␣, 7.5 M Sorafenib or a combination of both drugs. Untreated cells served as control. (d) Luciferase assay with Huh7.5 cells that were transfected with 0.5 g/well pISREluc and cotransfected with 1 g pRafC4 or as a control with 1 g pUC18 respectively. Furthermore cells were either left untreated or were treated with 100 U IFN␣. (e) Schematic view that describes the interference of Sorafenib with interferon ␣-dependent signalling cascades.
18
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
electroporation with increasing concentrations of IFN␣ for 48 h in the presence of 7.5 M Sorafenib, whereas, untreated cells, cells treated with 5 M Sorafenib and cells treated with increasing concentrations of interferon ␣ in the absence of Sorafenib served as controls. A concentration of 5–7.5 M Sorafenib was chosen since it is well tolerated and results in a significant, but not complete inhibition of HCV replication (Ryan et al., 2007). The Western blot analysis using a NS5A-specific antiserum (Burckstummer et al., 2006) revealed that increasing IFN␣ concentrations result in decreasing levels of NS5A. Moreover, it was shown that exclusive application of Sorafenib at a concentration of 7.5 M strongly decreases the amount of NS5A (Ryan et al., 2007). In accordance to our previous observations that demonstrated that 5–7.5 M Sorafenib causes a strong but not complete inhibition of HCV replication. However, when the incubation with IFN␣ was performed in the presence of 7.5 M Sorafenib, the inhibitory effect of IFN␣ was almost completely abolished and vice versa the inhibitory effect of Sorafenib on HCV replication was impaired by the presence of IFN␣ (Fig. 1a). This was confirmed by immunofluorescence microscopy of HCV replicating cells. The immunofluorescence microscopy shows that treatment of the HCV replicating cells with 10 U IFN␣ or with 5 M Sorafenib decreased the amount of NS5A or core strongly. However, in case of Huh7.5 cells simultaneously treated with the same amounts of IFN␣ and Sorafenib, NS5A and core were still detectable confirming that Sorafenib impairs the IFN␣-dependent inhibitory effect on HCV replication (Fig. 1b). To study directly the effect on HCV replication, RNA was isolated from HCV-positive Huh7.5 cells that were stimulated for 6 h with increasing concentrations of IFN␣ in the presence or absence of Sorafenib. Northern blot analyses revealed that the strong IFN␣dependent decrease in the amount of viral RNA is abrogated by the simultaneous application of Sorafenib. Again the inhibitory effect of IFN␣ on the viral replication is almost completely abolished by the presence of Sorafenib (Fig. 1c). Taken together these data indicate that Sorafenib impairs the antiviral effect of IFN␣ on HCV replication. Interferon ˛ activates c-Raf Sorafenib is known as a potent inhibitor of c-Raf (Hahn and Stadler, 2006; Schreck and Rapp, 2006). Therefore, we asked whether the antiviral effect of IFN␣ depends on c-Raf. To study this, we analysed the effect of IFN␣ on c-Raf by Western blotting using an anti-active Raf (phospho-Raf)-specific antiserum (Ser338). The Western blot shows that IFN␣ induces c-Raf phosphorylation (Fig. 2a). To demonstrate unequivocally that IFN␣-activates c-Raf, immunocomplex assays were performed for direct measurement of c-Raf activity. The autoradiograph (Fig. 2b) clearly shows that there is a IFN␣-dependent activation of c-Raf reflected by the increased phosphorylation of MEK. However, if the IFN␣-dependent stimulation was performed in the presence of Sorafenib, the activation of c-Raf was blocked which indicates that IFN␣ activates c-Raf. A major factor that mediates the antiviral effect of IFN␣ is PKR-activation that finally leads to an interruption of protein biosynthesis. In order to analyse whether Sorafenib affects the interferon alpha-dependent activation of PKR, cells were incubated with various concentrations of interferon ␣ in the presence or absence of Sorafenib. The effect on PKR activation was studied by Western blotting using phosphor-PKR (Thr446) and PKR-specific antisera. Since PKR contains at least 15 phosphorylation sites, but only Thr446 and Thr451 are crucial for PKR kinase activity, an antiserum that recognizes phosphoThr446 was used. The blots demonstrate that the interferon-dependent phosphorylation of PKR is abolished by the presence of Sorafenib (Fig. 2c). Since a
variety of kinases was described to affect PKR-phosphorylation, we analysed whether the inhibitory effect of Sorafenib on the IFN␣dependent PKR phosphorylation indeed depends on its inhibition of c-Raf. For this purpose c-Raf was specifically blocked by overexpression of a transdominant negative mutant (Raf C4) (Bruder et al., 1992). Expression of the tdn mutant was shown by Western blot analysis using a c-Raf-specific antiserum (Fig. 2d), functionality by inhibition of the HBx-dependent activation of AP-1 (data not shown). The P-PKR- and PKR-specific Western blots show that overexpression of the tdn mutant abolishes the IFN␣-dependent phosphorylation of PKR (Fig. 2e). These experiments reveal that the interferon-dependent phosphorylation of PKR requires the functionality of c-Raf. Sorafenib interferes with the induction of IFN˛-dependent genes There are conflicting reports about the interference of Sorafenib with IFN␣-dependent signalling. It is suggested that Sorafenib could interfere with the induction of an IFN␣ response by unspecific inhibition of Jak1 resulting in an impaired induction of IFN␣dependent marker genes (Blechacz et al., 2009; Kumar et al., 2007; Yang et al., 2010). To study whether Sorafenib interferes with the induction of IFN␣-dependent marker genes the expression of PKR, OAS1, and of OAS2 was analysed in the presence or absence of 7.5 M Sorafenib by RT-PCR. The gene expression analysis demonstrates that the induction of these marker genes upon IFN␣ treatment was abolished when combined with 7.5 M Sorafenib (Fig. 3a). Comparable results were obtained by Northern blotting (data not shown) and by Western blotting using OAS1 and MxA-specific antisera (Fig. 3b). Based on this, we asked whether the inhibitory effect of Sorafenib is due to its inhibitory effect on c-Raf. To address this point, c-Raf was again specifically blocked by overexpression of the tdn mutant (RafC4). The RT-PCR shows that the coexpression of the tdn c-Raf mutant does not affect the interferon-dependent induction of these marker genes. The same results were obtained, if higher amounts of the expression vector encoding for RafC4 were transfected (Fig. 3c). These data were corroborated by a Western blot analysis using OAS1- and MxA-specific antisera (Fig. 3d). The analysis of IFN induced marker gene expression displays that the inhibitory effect of Sorafenib is not due to its inhibition of c-Raf. Sorafenib interferes with the STAT activation Sorafenib is described as c-Raf specific inhibitor (Hahn and Stadler, 2006; Schreck and Rapp, 2006), but the activity of other kinases might be affected as well. Since an interference of Sorafenib with Jak1 and Tyk2 that was reported (Hancock et al., 2010; Su et al., 2007) this cannot be excluded. To study whether under the chosen conditions Sorafenib interferes with STAT1 phosphorylation, Huh7.5 cells were stimulated with IFN␣ in the presence or absence of Sorafenib. The effect on STAT phosphorylation was analysed by Western blotting using a phospho-STAT1 and a STAT1 specific antiserum. The Western blot shows that the interferon dependent phosphorylation of STAT1 is prevented in the presence of Sorafenib (Fig. 4a). Phosphorylation of STAT1 is one step in the cascade finally leading to the translocation of STAT1 in the nucleus. To study whether Sorafenib affects the nuclear translocation of STAT1, cells were stimulated with IFN␣ in the presence or absence of Sorafenib. Nuclear translocation of STAT1 was analysed by confocal immunofluorescence microscopy (Fig. 4b) which illustrates that the IFN␣-dependent translocation of STAT1/2 from the cytoplasm to the nucleus is impaired by the kinase inhibitor. Comparable results were obtained by Western blot analysis of the nuclear fraction (data not shown). STAT1/2 are key factors for the induction of
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
ISRE-dependent genes. Reporter gene experiments using an ISREdependent luciferase gene as reporter (pISREluc) revealed that Sorafenib efficiently inhibits the IFN␣-dependent induction of the reporter gene (Fig. 4c) while co-expression of the tdn Raf does not affect the IFN␣-dependent induction of the reporter gene (Fig. 4d). This indicates that the Sorafenib-dependent inhibition of STAT1/2 is not mediated by the inhibitory effect of Sorafenib on c-Raf. Taken together, we were able to demonstrate that Sorafenib in addition to its inhibitory function on PKR phosphorylation prevents independent from c-Raf the activation of STAT1 and thereby interferes with the interferon ␣-dependent induction of marker genes (Fig. 4e).
Discussion Interferon ␣ is a well-established drug for the treatment of HCV infection. However, the frequency of adverse effects associated with the use of interferon is significant affecting the compliance to a IFN␣-based therapy. Recently, we observed that the c-Raf inhibitor Sorafenib that is approved by the FDA for the treatment of HCC and RCC efficiently blocks HCV replication. However, due to the inhibition of the central kinase c-Raf, treatment with Sorafenib over a longer time period might be associated with significant adverse effects described for RCC or HCC patients treated with this substance (Welker et al., 2010). Based on this, we speculated whether a combination of lower doses of IFN␣ and of Sorafenib decreased adverse effects, while additive antiviral effects could be obtained. Surprisingly it was observed that the antiviral effect disappeared if both substances were applied simultaneously. Further analyses revealed that at least two mechanisms confer to this, on the one hand the inhibitory effect of Sorafenib on c-Raf prevents PKR phosphorylation and on the other hand impairs STAT1 phosphorylation. A recent report showed that the IFN␣-dependent tyrosine phosphorylation of PKR depends on the activation of Jak1 and Tyk2 (Su et al., 2007). Further data suggest a direct interaction of Jak1 and PKR. In contrast to these data that are based on monocytes we observed in hepatoma cells a dependence on c-Raf. Both inhibition of c-Raf by Sorafenib or coexpression of a tdn mutant (RafC4) abolishes the interferon ␣-dependent phosphorylation of PKR. However, it cannot be concluded from these data that c-Raf directly phosphorylates PKR. While our data indicate that the interferon ␣-dependent phosphorylation of PKR requires the functionality of c-Raf, the inhibitory effect of Sorafenib on Stat1-phosphorylation does not depend on c-Raf. Here coexpression of RafC4 does neither affect Stat1 phosphorylation (data not shown) nor the translocation of activated Stat1/2 into the nucleus. In accordance to this, the expression of ISRE-dependent genes as MxA or 2 ,5 -OAS is not affected by coexpression of the tdn mutant of c-Raf. In cholongiocarcinoma cells and in glioblastoma cells it was observed that Sorafenib accelerates the dephosphorylation of STAT3 by activation of the phosphatase shatterproof2 (SHP2) (Blechacz et al., 2009; Kumar et al., 2007; Yang et al., 2010) that appeared to be stimulated by c-Raf inhibition. Regarding STAT1, no effect of c-Raf inhibition by coexpression of a tdn mutant (RafC4) on the phosphorylation of STAT1 was observed and in accordance to this, no effect on the induction of interferon ␣dependent marker genes. Based on this it can be assumed that the inhibitory effect of Sorafenib on STAT1 phosphorylation and the subsequently impaired induction of interferon marker genes like MxA and OAS1/2 is due to the Sorafenib-dependent inhibition of Jak1/Tyk2. This is corroborated by a recent multi-pathway cellular analysis of compound selectivity that described significant effects of Sorafenib on the JAK/STAT pathway (Hancock et al., 2010). For the Sorafenib-dependent inhibition of Jak1 an IC50 of 1.2 M was found for 293 cells (Hancock et al., 2010).
19
Based on these data it can be concluded that a combined application of Sorafenib and of interferon to control HCV replication is not useful since the interferon-dependent activation of c-Raf counteracts the Sorafenib-dependent inhibition of c-Raf and vice versa the inhibitory effects of Sorafenib und c-Raf und Jak/Tyk prevent the transduction of IFN-dependent effects (Fig. 4d). HCV interferes at several steps with IFN␣-dependent signal transduction: i.e. NS3/4A affects RIG-I (Binder et al., 2007; Cheng et al., 2006) or in case of some genotypes NS5A can bind PKR (Gale et al., 1997) and thereby prevent its phosphorylation. On the one hand integrity of c-Raf is crucial for the IFN␣-dependent phosphorylation of PKR, on the other hand the interference of HCV NS5A with c-Raf that sequesters c-Raf to the replicon complex interrupts c-Raf signalling. Therefore, this can be interpreted as a further strategy of HCV to counteract IFN␣ signalling by preventing c-Raf-dependent PKR phosphorylation. Conflict of interest Nothing to declare. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ejcb.2012.09.001. References Askarieh, G., Alsio, A., Pugnale, P., Negro, F., Ferrari, C., Neumann, A.U., et al., 2010. Systemic and intrahepatic interferon-gamma-inducible protein 10 kDa predicts the first-phase decline in hepatitis C virus RNA and overall viral response to therapy in chronic hepatitis C. Hepatology 51 (May (5)), 1523–1530. Binder, M., Kochs, G., Bartenschlager, R., Lohmann, V., Hepatitis C, 2007. virus escape from the interferon regulatory factor 3 pathway by a passive and active evasion strategy. Hepatology 46 (November (5)), 1365–1374. Blechacz, B.R., Smoot, R.L., Bronk, S.F., Werneburg, N.W., Sirica, A.E., Gores, G.J., 2009. Sorafenib inhibits signal transducer and activator of transcription-3 signaling in cholangiocarcinoma cells by activating the phosphatase shatterproof 2. Hepatology 50 (December (6)), 1861–1870. Bruder, J.T., Heidecker, G., Rapp, U.R., 1992. Serum-TPA-, and Ras-induced expression from Ap-1/Ets-driven promoters requires Raf-1 kinase. Genes Dev. 6 (April (4)), 545–556. Burckstummer, T., Kriegs, M., Lupberger, J., Pauli, E.K., Schmittel, S., Hildt, E., 2006. Raf-1 kinase associates with hepatitis C virus NS5A and regulates viral replication. FEBS Lett. 580 (January (2)), 575–580. Carvajal-Yepes, M., Himmelsbach, K., Schaedler, S., Ploen, D., Krause, J., Ludwig, L., et al., 2011. Hepatitis C virus impairs the induction of cytoprotective Nrf2 target genes by delocalization of small Maf proteins. J. Biol. Chem. 286 (March (11)), 8941–8951. Cheng, G., Zhong, J., Chisari, F.V., 2006. Inhibition of dsRNA-induced signaling in hepatitis C virus-infected cells by NS3 protease-dependent and -independent mechanisms. Proc. Natl. Acad. Sci. U.S.A. 103 (May (22)), 8499–8504. Gale Jr., M.J., Korth, M.J., Tang, N.M., Tan, S.L., Hopkins, D.A., Dever, T.E., et al., 1997. Evidence that hepatitis C virus resistance to interferon is mediated through repression of the PKR protein kinase by the nonstructural 5A protein. Virology 230 (April (2)), 217–227. Hahn, O., Stadler, W., 2006. Sorafenib. Curr. Opin. Oncol. 18 (November (6)), 615–621. Hancock, M.K., Lebakken, C.S., Wang, J., Bi, K., 2010. Multi-pathway cellular analysis of compound selectivity. Mol. Biosyst. 6 (October (10)), 1834–1843. Himmelsbach, K., Sauter, D., Baumert, T.F., Ludwig, L., Blum, H.E., Hildt, E., 2009. New aspects of an anti-tumour drug: sorafenib efficiently inhibits HCV replication. Gut 58 (December (12)), 1644–1653. Koziel, M.J., Peters, M.G., 2007. Viral hepatitis in HIV infection. N. Engl. J. Med. 356 (April (14)), 1445–1454. Kumar, K.G., Liu, J., Li, Y., Yu, D., Thomas-Tikhonenko, A., Herlyn, M., et al., 2007. Raf inhibitor stabilizes receptor for the type I interferon but inhibits its antiproliferative effects in human malignant melanoma cells. Cancer Biol. Ther. 6 (September (9)), 1437–1441. Ryan, C.W., Goldman, B.H., Lara Jr., P.N., Mack, P.C., Beer, T.M., Tangen, C.M., et al., 2007. Sorafenib with interferon alfa-2b as first-line treatment of advanced renal carcinoma: a phase II study of the Southwest Oncology Group. J. Clin. Oncol. 25 (August (22)), 3296–3301. Sauter, D., Himmelsbach, K., Kriegs, M., Carvajal, Y.M., Hildt, E., 2009. Localization determines function: N-terminally truncated NS5A fragments accumulate in the nucleus and impair HCV replication. J. Hepatol. 50 (May (5)), 861–871. Schreck, R., Rapp, U.R., 2006. Raf kinases: oncogenesis and drug discovery. Int. J. Cancer 119 (November (10)), 2261–2271.
20
K. Himmelsbach, E. Hildt / European Journal of Cell Biology 92 (2013) 12–20
Soriano, V., Peters, M.G., Zeuzem, S., 2009. New therapies for hepatitis C virus infection. Clin. Infect. Dis. 48 (February (3)), 313–320. Su, Q., Wang, S., Baltzis, D., Qu, L.K., Raven, J.F., Li, S., et al., 2007. Interferons induce tyrosine phosphorylation of the eIF2alpha kinase PKR through activation of Jak1 and Tyk2. EMBO Rep. 8 (March (3)), 265–270. Torriani, F.J., Rodriguez-Torres, M., Rockstroh, J.K., Lissen, E., Gonzalez-Garcia, J., Lazzarin, A., et al., 2004. Peginterferon Alfa-2a plus ribavirin for chronic hepatitis C virus infection in HIV-infected patients. N. Engl. J. Med. 351 (July (5)), 438– 450. Wakita, T., Pietschmann, T., Kato, T., Date, T., Miyamoto, M., Zhao, Z., et al., 2005. Production of infectious hepatitis C virus in tissue culture from a cloned viral genome. Nat. Med. 11 (July (7)), 791–796.
Welker, M.W., Lubomierski, N., Gog, C., Herrmann, E., Engels, K., Vogl, T.J., et al., 2010. Efficacy and safety of sorafenib in advanced hepatocellular carcinoma under daily practice conditions. J. Chemother. 22 (June (3)), 205– 211. Yang, F., Brown, C., Buettner, R., Hedvat, M., Starr, R., Scuto, A., et al., 2010. Sorafenib induces growth arrest and apoptosis of human glioblastoma cells through the dephosphorylation of signal transducers and activators of transcription 3. Mol. Cancer Ther. 9 (April (4)), 953–962. Zeuzem, S., Nelson, D.R., Marcellin, P., 2008. Dynamic evolution of therapy for chronic hepatitis C: how will novel agents be incorporated into the standard of care? Antivir. Ther. 13 (6), 747–760.