The phylogenetic position of Udonella (Platyhelminthes)1

International Journal for Parasitology 17 "0887# 0130Ð0149

The phylogenetic position of Udonella "Platyhelminthes#0 D[T[J[ Littlewooda\b\\ K[ Rohdec\ K[A[ Clougha a

Department of Zoology\ The Natural History Museum\ Cromwell Road\ London SW6 4BD\ U[K[ b Division of Life Sciences\ King|s College\ University of London\ London W7 6AH\ U[K[ c Department of Zoology\ University of New England\ Armidale\ NSW 1240\ Australia Received 19 March 0887^ received in revised form 0 May 0887^ accepted 0 May 0887

Abstract Phylogenetic analysis of molecular data from complete 07S rRNA and partial 17S rRNA genes\ of a variety of platyhelminths\ places the enigmatic Udonella caligorum _rmly as a monopisthocotylean monogenean[ Both maximum parsimony and a modi_ed distance measure\ operating under a maximum likelihood model\ gave identical solutions for each data set[ These data further support morphological evidence from ultrastructural studies indicating the neodermatan a.nities of Udonella\ namely shared features in sensory receptors\ surface tegument\ sperm structure and spermiogenesis[ The molecular data reject the class Udonellidea and the placement of udonellids as sister!group to the Neodermata[ As shown previously with molecular data\ the monogeneans appear as a paraphyletic assemblage comprising strongly monophyletic Monopisthocotylea and Polyopisthocotylea[ Their relationships with the trematodes and cestodes are not resolved with 17S rDNA or 07S rDNA alone[ Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ Keywords] Udonella^ 07S rDNA^ 17S rDNA^ Molecular phylogeny^ Systematics^ Cladistics^ Monogenea

0[ Introduction Few helminths have involved systematists in as much discussion for so long as Udonella[ All four described species of Udonella are hyperparasites found exclusively and commonly on caligid cope! pods parasitising marine _shes "e[g[\ see ð0Ł#[ In spite of their ubiquity\ the phylogenetic position of

0 Note] Sequences have been deposited with EMBL under accession numbers AJ117662ÐAJ117792 inclusive[ The full alignments have been deposited with the EMBL "alignment DS23046# and can be accessed by anonymous FTP from ftp[ebi[ac[uk in directory :pub:databases:embl:align[  Corresponding author[ Fax] ¦33 060 827 7643^ e!mail] dtlÝnhm[ac[uk[

Udonella has been discussed repeatedly since the type species was described as a monogenean platy! helminth "Udonella caligorum Johnston\ 0724#[ To date\ some authors still include the genus in the Monogenea "ð1Ł as a special subclass Udonellida\ ð2\ 3Ł#\ although with uncertain a.nities\ and others put it in a separate higher taxon Udonellidea Ivanov\ 0841 with a far more prominent and pivotal position relative to other major clades of ~atworms ð4Ð7Ł[ Ehlers ð8Ł put the genus provisionally in the {{Dalyellioidea|| and stated that it probably does not belong to the Neodermata "a clade consisting of the major groups of parasitic Platyhelminthes#[ Kornakova ð09\ 00Ł examined the reproductive sys! tem of Udonella and concluded that {{the com! parative analysis of all systems of organs has revealed no features of speci_c similarity between

S9919!6408:87 ,08[99¦9[99 Þ 0887 Australian Society for Parasitology[ Published by Elsevier Science Ltd[ Printed in Great Britain PII] S9919!6408"87#99097!7

0131

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149

Udonellida and Monogenea||[ She considered the genus as belonging to the turbellarians\ with ances! tors among the Neorhabdocoela and most probably Typhloplanoida[ Xylander ð01\ 02Ł\ on the basis of EM studies of tegument and sperm\ considered it a typical neodermatan with an as yet unknown sister group within the Neodermata[ Rohde et al[ ð03Ł made an EM study of the ~ame bulbs\ sensory receptors\ tegument and sperm of Udonella and concluded that the genus is a typical neodermatan[ In the structure of its protonephridial capillaries "lack of a septate junction#\ it resembles the cesto! des\ although similar capillaries were also found in a single monopisthocotylean monogenean\ Anoplo! discus cirrusspiralis ð04Ł[ Spermiogenesis of Udonella was examined by Rohde and Watson ð05Ł who concluded that it resembles that of mono! pisthocotylean monogeneans[ The phylogenetic position of Udonella is of par! ticular interest\ since it has been claimed to be the sister group of the major classes of parasitic Platy! helminthes "Cercomeridea ð7Ł#\ a view based on the comparison of super_cially similar characters with! out prior homology assessment\ but not supported by detailed morphological\ including ultra! structural\ studies of characters likely to be homo! logous ð06Ł[ Clearly\ the contradictory opinions as regards its phylogenetic position require an inde! pendent and new assessment[ In this study\ we use molecular data from 07S and 17S rRNA genes to test the morphologically based hypotheses of Brooks et al[ ð6Ł "that Udonella is the sister group of the Neodermata#\ and of Rohde ð07Ł "that Udonella is a neodermatan close to the monogeneans and:or cestodes#\ and put our _ndings in the context of those of other workers who have discussed the phylogenetic a.nities of the group[ We have chosen nuclear ribosomal genes to complement new data from Udonella and additional taxa since the widest variety of pla! tyhelminth taxa have already been sequenced for these genes "ð08Ł^ Littlewood et al[\ data not shown#[

1[ Materials and methods We chose to test morphologically based hypoth! eses using sequences from complete 07S!like SSU

rRNA genes "rDNA# and partial 17S!like LSU rDNA\ on the basis that these gene regions have wide phylogenetic utility at many levels^ regions of relatively high sequence variability are framed by regions of high sequence conservation\ allowing easy alignment and the establishment of base pos! ition homology between taxa "e[g[ ð19\ 10Ł#[ Fur! thermore\ the availability of ingroup and suitable outgroup SSU and LSU rDNA sequences on EMBL:GenBank allowed analysis of these genes for Udonella[ In addition\ we have added a further 13 SSU and _ve LSU rDNA sequences to increase the density of sampling[ The full list of gene sequences utilised\ their sources\ and GenBank: EMBL accession numbers is presented in Table 0[ Details of taxa used for sequencing in this study are presented in Table 1[

1[0[ DNA extraction\ gene ampli_cation and sequ! encing Specimens were _xed and stored in a minimum of 4 vol[ of 84Ð099) ethanol[ Prior to DNA extrac! tion\ individual worms or pieces of larger ~atworms were rehydrated in two washes and one 0!h soak in TE "TrisÐEDTA# "pH 7[9#[ Individuals were ground in 049!ml TE "pH 7[9#\ 9[4) SDS\ and digested for 2Ð3 h with the addition of 5!ml proteinase K "09 mg ml−0# at 26>C[ Genomic DNA was phenolÐ chloroform extracted and precipitated over 04 min at −19>C in the presence of 9[0 vol[ sodium acetate "pH 3[4Ð5[9#\ and 1[4 vol[ 099) ethanol[ After washing in 69) ethanol\ DNA pellets were dried and redissolved in TE "pH 7[9#[ Complete SSU rDNA was ampli_ed from each extract with PCR ð11Ł using the following primers A and B] 4?!AMCTGGTTGATCCTGCCAG!2? and 4?!AGGTGAACCTGCAGATGGATCA!2?\ re! spectively[ Partial LSU rDNA was PCR ampli_ed using the primers LSU4 and EC!D1] 4?!TAGG TCGACCCGCTGAAYTTAAGCA!2? and 4?! CCTTGGTCCGTGTTTCAAGACGGG!2? ð12Ł[ Standard 49!ml PCR reactions were set up ð_nal concentrations] 199 mM each dNTP\ 1 mM!MgCl1\ 0×reaction bu}er "Perkin Elmer#\ 0 U Taq poly! merase "Amplitaq\ Perkin Elmer# and cycling con! ditions were] hot start "84>C:4 min# followed by

0132

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149 Table 0 Taxa used in this study[ Outgroup taxa were from non!neo! dermatan taxa "turbellarians# EMBL accession numbers Taxa used Platyhelminthes*outgroupset {{Turbellaria|| Catenulida Stenostomum leucops aquariorum Temnocephalida Temnocephala sp[ Rhabdocoela Kronborgia isopodicola Tricladida Bipalium kewense Bipalium sp[ Bdelloura candida Romankenkius lidinosus Schmidtea mediterranea Dendrocoelum lacteum Dendrocoelopsis lactea Crenobia alpina Polycladida Polycelis sp[ Planocera multitentaculata Thysanozoon brocchi Pseudoceros tritriatus Notoplana australis Notoplana koreana Discocelis tigrina Platyhelminthes*ingroups Monogenea Monopisthocotylea Diplectanidae Acleotrema sp[ Ancyrocephalidae Haliotrema chrysotaeniae Tetrancistrum sp[ Monocotylidae Merizocotyle icopae Troglocephalus rhinobatidis Neoheterocotyle rhinobatidis Calicotyle af_nis Dictyocotyle coeliaca Microbothriidae Leptocotyle minor Capsalidae Encotyllabe caballeroi Encotyllabe chironemi Entobdella australis Benedenia lutjani Benedenia sp[

LSU rDNA SSU rDNA

AJ117790a AJ117791a AJ117799a AF915008 X80391 AJ117687a Z88840 U20974 M47235 D74976 M47234 AF915094 D06451\ D72272 D74985 AJ117683a AJ117675a D74986 U69968

AF915007 AF915004 AF915003 AF915002 AF915009 AF915096

AJ117684a AJ117666a AJ117667a AJ117673a

AF915001 AJ117679a AF915097 AF915095 AJ117663a

Table 0*continued Gyrodactylidae Gyrodactylus salaris Pseudomurraytrematidae Pseudomurraytrema ardens Polyopisthocotylea Polystomatidae Polystomoides malayi Neoploystoma spratti Hexabothriidae Pseudohexabothrium taeniurae Diclidophoridae Diclidophora denticulata Mazocraeidae Kuhnia scombri Plectanocotylidae Plectanocotyle gurnardi Microcotylidae Neomicrocotyle paci_ca Bivagina pagrosomi Gastrocotylidae Pricea multae Gotocotyla secunda Axinidae Zeuxapta seriolae Trematoda Aspidogastridae Lobatostoma manteri Multicotyle purvisi Echinostomidae Echinostoma caproni Fasciolopsis buski Schistosomatidae Heterobilharzia americana Schistosoma mansoni S[ japonicum S[ haematobium S[ spindale Heronimidae Heronimus mollis Gyliauchenidae Gyliauchen sp[ Lepocreadiidae Tetracerasta blepta Paramphistomidae Calicophoron calicophorum Opisthorchiidae Opisthorchis viverrini Bucephalidae Prosorhynchoides gracilescens Cestoda Gyrocotylidae Gyrocotyle urna Proteocephalidae Proteocephalus neglectus Proteocephalus exiguus

Z15831 AJ117682a

AJ117681a AJ117677a AJ117680a AJ117668a AJ117672a AJ117689a AJ117676a AJ117664a AF915000 AF915098 AF915092

AJ117686a

L05800 AJ117674a AF915093

Z35495 Z35492 Z35493 Z35410 Z35494

L95456 L95557

M51541 Z00489 Z00868 L03375 L95558 LO5569 L95455 X44246 AJ117678a

AJ117688a

AJ117671a

AF915005 X88865

0133

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149 Table 1 Source of material used in this studya

Table 0*continued Taeniidae Echinococcus granulosus Grillotiidae Grillotia erinaceus Caryophyllaeidae Caryophyllaeus sp[ Diphyllobothriidae Spirometra erinacei Triaenophoridae Abothrium gadi Bothriocephalidae Bothriocephalus scorpii Incerta sedis Udonellidae Udonella caligorum

U16904

Species

Source

AJ117670a

Stenostomum leucops aquariorum Temnocephala sp[

Free!living^ in culture

AF915006 D53961 AJ117662a AJ117665a

AJ117792a

AJ117685a

a

Indicates new sequence for this study[

29 cycles of 83>C:0 min\ 49>C:0 min and 61>C:0 minŁ[ Successful primary ampli_cation was achieved with most templates\ but a secondary nested!PCR was required to amplify the SSU rRNA gene from some taxa[ The nested!PCR involved a secondary ampli_cation using the puri_ed "Wizard\ Promega# products of the primary PCR reaction "0 ml of pri! mary reaction# in two subsequent PCR reactions^ one tube contained the 4?!primer A plus an internal 2?!primer\ another tube contained an internal 4?! primer and the 2?!primer B[ The ampli_ed products overlapped one another by approximately 0999 bp[ At least two reactions were performed for each template[ Ampli_ed products were run on a 0) TAE "TrisÐacetate!EDTA# agarose gel\ cut out\ pooled and puri_ed with Wizard Preps "Promega#[ Gene fragments were directly sequenced using standard reaction mixes and procedures on a 262 or 266 ABI automated sequencer with the PRISMTM dye terminator cycle sequencing ready reaction kit "ABI\ Perkin Elmer#[ The SSU rDNA fragment was sequenced using primers A and B and between 00 and 02 other standard "eukaryote! speci_c# internal primers[ The LSU rDNA frag! ment was sequenced using PCR primers and other internal primers "detailed in ð12Ł#[ Both strands of the DNA were sequenced and contigs were assembled with Sequencher v[2[9 "Gene Codes Corporation\ MI#[

Ex freshwater crustacean "supplier M[ Riutort\ Spain# Kronborgia isopodicola Ex Exosphaeroma obtusum\ New Zealand Bdelloura candida Ex Limulus polyphemus^ E[ coast\ U[S[A[ Pseudoceros tritriatus Big Cavern Lake\ Palau Notoplana australis Port Ormond\ Vic[\ Australia Troglocephalus rhinobatidis Ex Rhinobatos typus\ Heron Is[\ Australia Calicotyle af_nis Ex Chimaera monstrosa\ deep sea\ Atlantic Dictyocotyle coeliaca Ex Raja radiata\ North Sea\ U[K[ Leptocotyle minor Ex Scyliorhinus caniculus\ North Sea\ U[K[ Encotyllabe chironemi Ex Chironemus marmoratus\ Co}s Harbor\ Australia Benedenia sp[ Ex perciform _sh "supplier S[ Lim\ Malaysia# Pseudomurraytrema ardens Ex Catastomus ardens\ Idaho\ U[S[A[ Polystomoides malayi Ex Cuora amboinensis\ Malaya Neoploystoma spratti Ex Chelodina longicollis\ Armidale\ Australia Pseudohexabothrium taeniurae Ex Taeniura lymna\ Heron Is[\ Australia Diclidophora denticulata Ex Pollachius virens\ North Sea\ U[K[ Kuhnia scombri Ex Scomber scombrus\ North Sea\ U[K[ Plectanocotyle gurnardi Ex Eutrigla gurnardus\ North Sea\ U[K[ Neomicrocotyle paci_ca Ex Caranx hippos\ Chamela Bay\ Mexico Bivagina pagrosomi Ex Chrysophrys aurata\ Co}s Harbor\ Australia Zeuxapta seriolae Ex Seriola hippos\ Co}s Harbor\ Australia Multicotyle purvisi Ex Siebenrockiella crassicollis\ Malaya Prosorhynchoides gracilescens Ex Lophius piscatorius\ North Sea\ U[K[ Gyrocotyle urna Ex Chimaera monstrosa\ fjord\ Norway Grillotia erinaceus Ex Raja radiata\ North Sea\ U[K[ Abothrium gadi Ex Gadus morhua\ North Sea\ U[K[ Bothriocephalus scorpii Ex Myoxocephalus scorpii\ North Sea\ U[K[ Udonella caligorum Ex Caligus sp[\ ex Gadus morhua\ North Sea\ U[K[ a

See Table 0 for classi_cation of taxa and genes sequenced[

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149

All gene sequences have been deposited with EMBL:GenBank under accession numbers detailed in Table 0[ The table also indicates the identity of a range of outgroup taxa used to root the tree[ For both the LSU and SSU rDNA data sets we chose to root the neodermatan taxa on a variety of tur! bellarian taxa\ thus allowing all morphological hypotheses to be tested[ A phylum!wide treatment of the Platyhelminthes utilising molecular and mor! phological data has also been carried out "Lit! tlewood et al[\ data not shown#[ 1[1[ Sequence alignment 1[1[0[ SSU rDNA Initially\ we took aligned reference sequences from the SSU rRNA database at the WWW rRNA server "URL http]::rrna[uia[ac[be^ ð13Ł# and added sequences with ClustalW ð14Ł using default weigh! ting and gap penalties\ and the pro_le alignment option[ Bases which could not be aligned unam! biguously by eye\ and regions of the alignment involving autapomorphic insertions greater than two bases\ were removed prior to phylogenetic analysis[ Wherever possible we selected regions of the alignment which began and ended either with invariant bases or were identical in terms of purine "A:T# or pyrimidine "G:C#[ 1[1[1[ LSU rDNA Partial LSU rDNA sequences were initially alig! ned as above\ but without reference to secondary structure models[ Due to the high variability between sequences\ we chose to work with only highly conserved regions[ For guidance\ we used the alignment used by Mollaret et al[ "ð08Ł^ kindly provided by Isabelle Mollaret#\ which also utilises only highly conserved regions[ Alignments were handled using GDE ð15Ł for a SUN workstation and exported to a Macintosh for phylogenetic analysis[ Ambiguously aligned regions of our alignment were discarded prior to phylogenetic analysis[ 1[2[ Phylogenetic analyses We inferred phylogenies using two methods] maximum parsimony and minimum evolution dis!

0134

tance method with the distance matrix calculated using a maximum likelihood model "PAUP ð16Ł^ also referred to as the paralinear:LogDet distance method ð17\ 18Ł#[ With maximum parsimony "MP# we conducted heuristic searches "09 random addition replicates#\ weighted all characters equally\ and treated all gaps as a _fth!character state[ Only consistency indices "CI# excluding uninformative characters are presented[ Branch support was estimated with bootstrap resampling "n0999#[ For methods using distance matrices "NJ with minimum evolution model# the distance matrix was calculated using the maximum likelihood option in PAUP ð16Ł[ The transition]transversion ratio\ the gamma statistic and the proportion of invariable sites were calculated using an initial NJ tree con! structed using a distance matrix calculated with the Log Det option[ Each of these three maximum likelihood variables was calculated separately\ its value then entered into the model while the next parameter variable was calculated[ This procedure was repeated iteratively until the estimates for each parameter variable "and the log likelihood# did not change[ A _nal maximum likelihood model using these statistics was then employed to estimate the molecular phylogeny[ Branch support was esti! mated with bootstrap resampling "n0999#[ Our optimal topologies\ found by both distance methods and parsimony\ were compared with the morphology based hypotheses both qualitatively and\ where possible\ quantitatively[ Using Mac! Clade ð29Ł\ we generated trees re~ecting the alter! native morphological hypothesis of Brooks et al[ ð6Ł and Brooks and McLennan "ð7Ł\ i[e[ with Udonella as the sister group to the Neodermata#\ and tested the statistical signi_cance of support a}orded by the molecular data on this alternative scheme using the KishinoÐHasegawa test "ð20Ł\ implemented in PAUP#[

2[ Results Full SSU rDNA sequences were determined for 13 additional taxa including U[ caligorum\ pro! viding 49 sequences in total for analysis[ Partial LSU rDNA sequences were determined for six

0135

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149

additional taxa including U[ caligorum\ providing 17 sequences for analysis[ The alignment of the SSU rDNA sequences com! prised 0314 unambiguously alignable positions\ of which 0930 were variable and 350 parsimony! informative[ In spite of the length of the LSU rDNA products "ranging from 557 to 0917 bp amongst the six new taxa sequenced here#\ this alignment yielded only 162 unambiguously alignable positions\ pre! dominantly from the 4? end\ representing secondary structure regions C0\ D0\ C1 and D1[ Thus the alignable regions used corresponded with the con! served regions analysed by Mollaret et al[ ð08Ł[ Of these characters\ 040 were variable and 090 par! simony!informative[ The full sequence alignments used in these analyses have been deposited with EMBL under accession DS23046 and are available via anonymous FTP from FTP[EBI[AC[UK under directory pub:databases:embl:align[ Both maximum parsimony and the minimum evolution distance methods of phylogeny recon! struction unequivocally placed Udonella amongst the monopisthocotylean Monogenea using both SSU and LSU rDNA data sets "Figs 0 and 1\ respec! tively#[ For each data set the two methods of phy! logeny reconstruction yielded identical tree topologies\ although there were di}erences between the data sets[

as a paraphyletic assemblage[ The branching pat! terns within the monogenean clades are strongly supported on the basis of a consensus between the two methods of phylogeny reconstruction and high bootstrap support[ Based on the exemplars used\ Udonella appears as the sister group of Gyro! dactylus\ and together they form a clade with the capsalids Encotyllabe and Benedenia[ 2[1[ LSU rDNA Figure 1 is the strict consensus solution of _ve equally parsimonious trees "length370^ CI9[348^ RI9[530#[ As above\ the tree focuses on the relative position of Udonella[ The same top! ology was found with both MP and NJ "minimum evolution# methods\ with the Neodermata as stron! gly monophyletic and Udonella strongly supported as a member of the Monopisthocotylea[ Udonella is once again placed in a clade with the capsalids which in turn is sister group to the Monocotylida[ The earliest divergent monopisthocotylean\ Pseudomurraytrema\ is a member of the Dactylo! gyridea[ Bootstrap support was weaker than the SSU solution throughout and re~ects the smaller data set[ Although the Monogenea are once again shown as a paraphyletic assemblage\ the relative positions of the Monopisthocotylea and the Poly! opisthocotylea are transposed relative to Fig[ 0[

2[0[ SSU rDNA 2[2[ Constraint analyses Figure 0 indicates the strict consensus solution of 105 equally most parsimonious trees "length0653^ CI9[387^ RI9[701#[ The tree is drawn to focus on the position of Udonella and not the inter! relationships of distantly related clades[ The same topology was found regardless of method of phy! logeny reconstruction\ with the Neodermata "ingroup taxa#\ Trematoda\ Cestoda\ Mono! pisthocotylea and Polyopisthocotylea all strongly monophyletic[ Amongst the monogenean taxa the polystomatids\ Mazocraeida "Kuhnia\ Neo! microcotyle\ Plectanocotyle\ Diclidophora\ Bivagina and Zeuxapta# and capsalids are also each strongly supported[ Poor bootstrap support prevents a con! _dent assessment of the interrelationships of the major neodermatan clades "Cestoda\ Trematoda and Monogenea#\ although the Monogenea appear

Forcing Udonella as the sister group to the Neo! dermata\ a phylogenetic solution suggested by Brooks et al[ ð6Ł\ requires 000 and eight more steps for each of the SSU and LSU rDNA most par! simonious phylogenetic solutions\ respectively[ With the SSU rDNA this is a statistically di}erent topology "KishinoÐHasegawa test^ P³9[9990#\ but is not signi_cant with the smaller LSU rDNA data set "KishinoÐHasegawa test^ P9[742#[ The LSU rDNA data set is arguably less informative at this level of phylogenetic analysis as the topology of the most parsimonious solution quickly changes in suboptimal trees "from  one step longer#[ Although only a few taxa are common to each data set\ phylogenetic analysis of homologous ribosomal nuclear genes from a range of platy!

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149

0136

Fig[ 0[ Tree topology found with complete SSU rDNA data using both maximum parsimony "MP# and neighbour!joining "NJ# using the HKY74 "maximum likelihood# model in PAUP ð16Ł[ For MP the tree is a strict consensus of 105 equally most parsimonious solutions "length0653^ CI9[387^ RI9[701#[ For NJ] transition:transversion ratio0[38^ −ln likelihood09 678^ gamma rate distribution with shape parameter9[669^ proportion of invariable positions9[260[ Bootstrap support "n0999 replicates# are shown for MP and NJ above and below branches\ respectively[ See Table 0 for details regarding taxa used[

helminths places Udonella as a monopistho! cotylean monogenean with possible sister group status with Gydrodactylus "order Gyrodactyl! dactylidea#\ and certainly a member of a larger clade including the Capsalidea[

3[ Discussion When the surgeon George Johnston ð21Ł orig! inally described U[ caligorum in 0724\ he alluded to the problems systematists would have with the

0137

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149

Fig[ 1[ Tree topology found with partial LSU rDNA data using both maximum parsimony "MP# and neighbour!joining "NJ# using the HKY74 "maximum likelihood# model in PAUP ð16Ł[ For MP the tree is a strict consensus of _ve equally most parsimonious solutions "length370^ CI9[348^ RI9[530#[ For NJ] transition:transversion ratio0[55^ −ln likelihood1379^ gamma rate distribution with shape parameter9[555^ proportion of invariable positions9[166[ Bootstrap support "n0999 replicates# are shown for MP and NJ above and below branches\ respectively[ See Table 0 for details regarding taxa used[

genus when he described it as a {{leech|| that {{waves and contorts itself like a worm in pain|| with its structure seemingly {{allied to some intestinal worms|| "pp[ 383Ð385#[ Since its description\ the phylogenetic position of

Udonella has been in doubt because of a number of peculiar characteristics[ In particular\ it lacks hooks at any stage of its development\ whereas mon! ogeneans "the group which it super_cially resembles most closely in its ectoparasitic habit and pos!

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149

session of a posterior sucker# have hooks at least in the larval stage[ However\ lack of hooks in Udonella may be a consequence of its attachment to cope! pods\ whose hard exoskeletons are probably not suitable for penetration by hooks[ Furthermore\ the tegument of the posterior sucker of Udonella is separated from that of the main body by a septate junction ð05Ł\ as also found in the temnocephalids but not in any of the neodermatans[ Nichols ð22Ł also alluded to the a.nities with temnocephalans based on histological sections and staining of the protonephridial system[ Electron!microscopic studies have shown that Udonella belongs to the Neodermata[ Like other Neodermata\ it has a syncytial surface tegument connected to underlying perikarya by cytoplasmic processes ð02\ 03Ł^ its sensory receptors have elec! tron!dense collars characteristic of the Neodermata ð02\ 03Ł^ spermatozoa have two axonemes of the 8¦{{0|| type incorporated in the sperm body\ and they lack dense bodies ð02\ 03Ł^ during sper! miogenesis\ two short free ~agella appear which are later incorporated in the sperm body in a way simi! lar to that of monopisthocotylean monogeneans "modi_ed proximo!distal fusion ð07Ł#^ and pro! tonephridial ~ame bulbs are formed by two inter! digitating cells "ð03Ł^ possibly a plesiomorphic character#[ Our DNA data give further support to the view that Udonella is a neodermatan[ Our DNA analysis shows that Udonella is most likely to be a modi_ed monopisthocotylean mono! genean\ as also suggested by spermiogenesis "see above#[ Occurrence of protonephridial capillaries that lack a junction\ a characteristic common to cestodes\ is not a strong argument against this position\ since it is also known from one mono! pisthocotylean\ i[e[ A[ cirrusspiralis ð04Ł[ It is likely that lack of a junction is due to secondary loss\ as indicated by the presence in Anoplodiscus of struc! tures resembling rudimentary junctions[ The phylogenetic a.liation of Udonella pre! sented here is reminiscent of earlier morpho! logically based schemes[ In particular\ the order Capsaloidea erected by Price ð23Ł and interpreted by Sproston ð24Ł included the udonellids\ micro! bothriids\ monocotylids and capsalids[ These taxa form a clade in our analyses\ although Gyro! dactylus "a member of the Gyrodactyloidea in Spro!

0138

ston ð24Ł# is also included and closely allied to Udonella in the SSU rDNA set[ In summary\ using two molecular data sets\ our study has shown\ in conjunction with earlier EM studies\ that Udonella is a neodermatan\ and that it must be included in the Monogenea ðalthough this group may be paraphyletic\ based solely on riboso! mal sequence data "ð08\ 25Ł\ this study#Ł and cer! tainly the Monopisthocotylea[ The interrelation! ships of the major neodermatan clades are not resolved by either the SSU or the LSU rDNA data sets\ and the weak support between the major classes suggests that the apparent paraphyly of the Monogenea is by no means con_rmed by these data[

Acknowledgements We are deeply indebted to the following indi! viduals who provided us with material for this study] Peter Anderson\ Jaume Bagun½a\ Bjo rn Berland\ Ian Beveridge\ Michelle Kelly!Borges\ Rod Bray\ Leslie Chisholm\ Lynn Van Every\ Delane Kritsky\ Soo!Ung Lee\ Gerardo Perez! Ponce de Leon\ Susan Lim\ Maria Reuter and Marta Riutort[ David Swo}ord kindly provided a pre!release version of PAUP "v[ d50# which was invaluable[ Elisabeth Herniou sequenced the SSU of Neomicrocotyle and Benedenia[ Ian Ridgers and Julia Bartley provided expert technical assistance running the automated sequencer[ D[T[J[L[ and K[A[C[ were funded by a Wellcome Trust Senior Research Fellowship "932854:Z:84:Z# to D[T[J[L[ K[R[ was funded by the Australian Research Council and the University of New England[

References ð0Ł Aken|Ova TO\ Lester RJG[ Udonella myliobati n[ comb[ "Platyhelminthes] Udonellidae# and its occurrence in East! ern Australia[ J Parasitol 0885^71]0906Ð0912[ ð1Ł Land J van der[ Remarks on the subclass Udonellida "Mon! ogenea# with description of a new species[ Zoolog Mededeel 0856^31]57Ð70[ ð2Ł Lyons KM[ The epidermis and sense organs of the Mon! ogenea and some related groups[ Adv Parasitol 0862^00]082Ð121[ ð3Ł Justine J!L\ Lamberts A\ Mattei X[ Spermatozoon ultra!

0149

ð4Ł

ð5Ł

ð6Ł

ð7Ł

ð8Ł ð09Ł

ð00Ł

ð01Ł

ð02Ł

ð03Ł

ð04Ł

ð05Ł

ð06Ł

ð07Ł

ð08Ł

D[T[J[ Littlewood et al[ : International Journal for Parasitolo`y 17 "0887# 0130Ð0149 structure and phylogenetic relationships in the mon! ogeneans "Platyhelminthes#[ Int J Parasitol 0874^04]590Ð 597[ Ivanov AI[ Udonella caligorum Johnston\ 0724*a rep! resentative of a new class of ~atworms ðin RussianŁ[ Zoolog Zhur 0841^20]064Ð067[ Ivanov AI[ The structure of Udonella caligorum Johnston\ 0724 and the position of Udonellidae in the systematics of ~atworms ðin RussianŁ[ Parazitol Sbornik 0841^03]001Ð052[ Brooks DR\ O|Grady RT\ Glen DR[ The phylogeny of the Cercomeria Brooks\ 0871 "Platyhelminthes#[ Proc Hel! minthol Soc Wash 0874^41]0Ð19[ Brooks DR\ McLennan DA[ Comparative study of adapt! ive radiations with an example using parasitic ~atworms "Platyhelminthes\ Cercomeria#[ Am Nat 0882^031]644Ð667[ Ehlers U[ Das phylogenetische System der Plathelminthes[ Stuttgart] Gustav Fischer Verlag\ 0874[ Kornakova EE[ The structure of the reproductive system of Udonella[ Trudy Zoolog Instituta Akad Nauk SSSR\ Leningrad 0876^050]13Ð49 "in Russian#[ Kornakova EE[ On the morphology and phylogeny of the Udonellida[ 4th Int Symp Biol Turb Gottingen 0876]16 "Abstract#[ Xylander W[ Ultrastructural evidence for the position of Udonellidae[ 4th Int Symp Biol Turb Gottingen 0876]15 "Abstract#[ Xylander W[ Ultrastructural studies on Udonellidae] evi! dence for a position within the Neodermata[ Fortschr Zool 0877^25]40Ð46[ Rohde K\ Watson N\ Roubal F[ Ultrastructure of ~ame bulbs\ sense receptors\ tegument and sperm of Udonella "Platyhelminthes# and the phylogenetic position of the genus[ Zool Anz 0878^111]032Ð046[ Rohde K\ Watson N\ Roubal F[ Ultrastructure of the pro! tonephridial system of Anoplodiscus cirrusspiralis "Mon! ogenea Monopisthocotylea#[ Int J Parasitol 0881^11]332Ð 346[ Rohde K\ Watson N[ Comparative ultrastructural study of the posterior suckers of four species of symbiotic Pla! tyhelminthes\ Temnocephala sp[ "Temnocephalida#\ Udonella caligorum "Udonellidea#\ Anoplodiscus cir! russpiralis "Monogenea] Monopisthocotylea#\ and Phi! lophthalmus sp[ "Trematoda] Digenea#[ Folia Parasitol 0884^31]00Ð17[ Rohde K[ Robust phylogenies and adaptive radiations] a critical examination of methods used to identify key inno! vations[ Am Nat 0885^037]370Ð499[ Rohde K\ Watson N[ Spermatogenesis in Udonella "Pla! tyhelminthes\ Udonellidea# and the phylogenetic position of the genus[ Int J Parasitol 0882^12]614Ð624[ Mollaret I\ Jamieson BGM\ Adlard RD\ et al[ Phylogenetic analysis of the Monogenea and their relationships with Digenea and Eucestoda inferred from 17S rDNA sequences[ Mol Biochem Parasitol 0886^89]322Ð327[

ð19Ł Hasegawa M\ Iida Y\ Yano T\ Takaiwa F\ Iwabuchi M[ Phylogenetic relationships among eukaryote kingdoms inferred from ribosomal RNA sequences[ J Mol Evol 0874^11]21Ð27[ ð10Ł Hillis DM\ Mable BK\ Larson A\ Davis SK\ Zimmer E[ Nucleic acids IV] sequencing and cloning\ ch[ 8[ In] Hillis DM\ Moritz C\ editors[ Molecular systematics[ Sunderland\ Massachussetts] Sinauer Associates\ 0885]210Ð70[ ð11Ł Saiki RF\ Gelfand DH\ Sto}el S\ et al[ Primer!directed enzymatic ampli_cation of DNA with a thermostable DNA polymerase[ Science 0877^128]376Ð380[ ð12Ł Littlewood DTJ\ Rohde K\ Clough KA[ Parasite speciation within one host species<*phylogenetic evidence from site! speci_c polystome monogeneans[ Int J Parasitol 0886^16]0178Ð0186[ ð13Ł Van de Peer Y\ Caers A\ De Rijk P\ De Wachter R[ Dat! abase on the structure of small ribosomal subunit RNA[ Nucleic Acids Res 0887^15]068Ð071[ ð14Ł Thompson JD\ Higgins DG\ Gibson TJ[ CLUSTAL!W* improving the sensitivity of progressive multiple sequence alignment through sequence weighting\ position!speci_c gap penalties and weight matrix choice[ Nucleic Acids Res 0883^11]3562Ð3579[ ð15Ł Smith SW\ Overbeek R\ Woese CR\ Gilbert W\ Gillevet PM[ The Genetic Data Environment] an expandable guide for multiple sequence!analysis[ Comput[ Appl Biosci 0883^09]560Ð564[ ð16Ł Swo}ord DL[ PAUP] Phylogenetic Analysis Using Par! simony "and other methods#\ version 3[9[ Sunderland\ Massachussetts] Sinauer Associates\ in press[ ð17Ł Lake JA[ Reconstructing evolutionary trees from DNA and protein sequences] paralinear distances[ Proc Natl Acad Sci USA 0880^80]0344Ð0348[ ð18Ł Lockhart PJ\ Steel MA\ Hendy MD\ Penny D[ Recovering evolutionary trees under a more realistic model of sequence evolution[ Mol Biol Evol 0883^00]594Ð501[ ð29Ł Maddison WP\ Maddison DR[ MacClade\ version 2[95[ Sunderland\ Massachusetts] Sinauer Associates\ 0881[ ð20Ł Kishino H\ Hasegawa M[ Evaluation of the maximum like! lihood estimate of the evolutionary tree topologies from DNA sequence data\ and the branching order in Homi! noidea[ J Mol Evol 0878^18]069Ð068[ ð21Ł Johnston G[ Illustrations in British zoology[ Mag Nat Hist 0724^Article IV\No[ 33]385Ð7[ ð22Ł Nichols KM[ Observations on lesser!known ~atworms] Udonella[ Int J Parasitol 0864^4]364Ð371[ ð23Ł Price EW[ North American monogenetic trematodes "Sum! maries of doctoral theses\ 0823Ð5#[ George Washington Univ Bull 0825]09Ð2[ ð24Ł Sproston NG[ A synopsis of the monogenetic trematodes[ Trans Zool Soc Lond 0835^14]074Ð599[ ð25Ł Justine J!L[ Non!monophyly of the monogeneans< Int J Parasitol\ in press[