- Email: [email protected]
The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma
G Model
DESC-2490; No. of Pages 9 Journal of Dermatological Science xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
Journal of Dermatological Science journal homepage: www.elsevier.com/jds
The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma Tomoyasu Hattori a,*, Yuko Takeuchi a, Tatsuya Takenouchi b, Akiko Hirofuji c, Tetsuya Tsuchida c, Takenori Kabumoto d, Hiroshi Fujiwara d, Masaaki Ito d, Akira Shimizu a, Etsuko Okada a, Sei-ichiro Motegi a, Atsushi Tamura a, Osamu Ishikawa a a
Department of Dermatology, Gunma University Graduate School of Medicine, Maebashi, Japan. Division of Dermatology, Niigata Cancer Center Hospital, Niigata, Japan c Department of Dermatology, Saitama Medical University, Iruma-gun, Japan d Division of Dermatology, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 September 2012 Received in revised form 1 February 2013 Accepted 17 February 2013
Background: A novel polyomavirus, the Merkel cell polyomavirus (MCPyV) has been implicated in the pathogenesis of Merkel cell carcinoma (MCC); however, the prevalence of MCPyV in Japan has not been extensively investigated. Objective: To clarify the prevalence of MCPyV in Japanese patients with MCC. Methods: MCPyV DNA was examined by polymerase chain reaction (PCR) in formalin-fixed paraffinembedded (FFPE) or frozen tissue samples from 26 patients with MCC diagnosed in four medical centers in Japan. Immunohistochemistry was simultaneously performed using a monoclonal antibody against the viral large T (LT) antigen. FFPE samples from basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) were also analyzed as controls. Results: Twenty-three out of 26 cases (88.5%) were positive for MCPyV DNA by PCR. The amplified products harbored 4 patterns of mutations. Phylogenetic analysis demonstrated that one of our strains was closely related to the other Japanese strains previously reported. The LT antigen was expressed in various degrees in 20 of 26 cases (76.9%) by immunohistochemistry. Histological type had little relation to CM2B4 positivity, whereas 3 of 5 trabecular-type tumors showed no staining. The immunoreactivity for CM2B4 did not correlate with the relative viral DNA load. In BCC and SCC, the LT antigen was immunohistochemically positive, but MCPyV DNA was not detected by PCR. The cells around some MCC and non-MCC tumors were stained with CM2B4 with a distribution similar to CD20- and CD45RO(especially CD8-) positive lymphocytes. Conclusion: MCPyV was highly positive in Japanese patients with MCC. It is of note that the positive rate differs depending upon the detection method. ß 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Keywords: Merkel cell carcinoma Merkel cell polyomavirus Basal cell carcinoma Squamous cell carcinoma
1. Introduction Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer which primarily affects elderly and immunesuppressed individuals. Although MCC is rare, its incidence is increasing [1–6]. Recently, Feng et al. demonstrated that a new human polyomavirus, designated as Merkel cell polyomavirus (MCPyV), is frequently detected in patients with MCC [7].
* Corresponding author at: Department of Dermatology, Gunma University Graduate School of Medicine, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511, Japan. Tel.: +81 27 220 8284; fax: +81 27 220 8285. E-mail address: [email protected] (T. Hattori).
Integration of MCPyV DNA within the tumor genome in a clonal pattern suggests that MCPyV is a causative agent in MCC. The MCPyV genome encodes a large T (LT) antigen, which contains some conserved domains shown to play roles in cell transformation [1,5,6,8,9]. MCPyV was discovered using digital transcriptome subtraction of MCC [7]. MCPyV is a 5.4-kbp long, double-stranded DNA virus with a genome that contains early and late regions [7,10]. The former encodes nonstructural proteins, small and large T antigens that are responsible for viral replication. The latter encodes viral proteins (VPs) that constitute viral particles. LT antigen may play an essential role in MCC tumorigenesis by inhibiting the cell-cycleregulating function of retinoblastoma protein [5,8,9], whereas integrated LT antigen harbors truncating mutations upstream of
0923-1811/$36.00 ß 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
2 Table 1 Primers used for PCR analysis. Experiment MCPyV detection
Primer name LT1 LT3 VP1
MCPyV quantificaion
LT_SYBR
Control
GAPDH
LT sequencing
LTagEx2-1 LTagEx2-2 LTagEx2-3 LTagEx2-4
a
Primer sequence Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
0
0
5 -TACAAGCACTCCACCAAAGC-3 50 -TCCAATTACAGCTGGCCTCT-30 50 -TTGTCTCGCCAGCATTGTAG-30 50 -ATATAGGGGCCTCGTCAACC-30 50 -TTTGCCAGCTTACAGTGTGG-30 50 -TGGATCTAGGCCCTGATTTT-30 50 -TCTTCCTCTGGGTATGGGGTC-30 50 -ATTGGGTGTGCTGGATTCTC-30 50 -GGTCTCCTCTGACTTCAACA-30 50 -AGCCAAATTCGTTGTCATAC-30 50 -TACTGCTTACTGCATCTGCACC-30 50 -GGCGAGCTTCTTGAGGAG-30 50 -GCGATGAATCACTTTCCTCC-30 50 -CCAATTACAGCTGGCCTCTT-30 50 -CCCCTTACAAATTACTGCAAGAG-30 50 -GATGGACAGTTTATATTCAAGGCC-30 50 -GCTTTGCTGCAGCCTTAATAG-30 50 -CAAACACAGGAAATATGAAGCAG-30
Positiona
Size (bp)a
Reference
1514–1953
440
[7]
571–879
309
4137–3786
352
1047–1208
162
[29]
116
[28]
727–1345
619
[30]
1267–1952
686
1870–2488
619
2428–3109
682
Position and size in GenBank NC_010277.1.
the helicase domains, rendering the viral replication function inactive [11]. Small T antigen of MCPyV has also been shown to have cell transformation ability by dysregulating cap-dependent translation [12]. However, there has not yet been any definitive proof that polyomavirus plays a relevant role in human carcinogenesis. The frequency of MCPyV-positive MCC is generally high, ranging from 75% to 90% in Europe and North America [7,13– 19], while it is less prevalent in Australian patients (18.3–24%) [20,21]. This difference may be due to the increased sun exposure in Australia, making a possible viral contribution less frequent; however, another group has recently reported a high prevalence rate of the virus in Australian MCC patients comparable to those from Germany [22]. In contrast there is relatively limited information available on the prevalence of MCPyV in Asian MCC patients [1,23–27], and it is unknown whether or not geographical differences exist. In this study, we investigated the positive rate of MCPyV DNA in Japanese MCC patients in 4 medical centers. To evaluate the polymerase chain reaction (PCR) results, we also performed immunohistochemistry using the identical MCC tissue samples. Samples from basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) were also analyzed to confirm the association of the virus in non-MCC skin cancers. 2. Materials and methods 2.1. Samples The formalin-fixed paraffin-embedded (FFPE) tissue specimens from patients with MCC (11 samples from 7 patients), BCC (10 samples from 10 patients) and SCC (10 samples from 9 patients) were retrieved from the archives of the Department of Dermatology, Gunma University Hospital. Blood samples were collected from 19 healthy volunteers and 2 of the 7 patients with MCC. FFPE samples of MCC tumors were also collected from 3 medical centers: Saitama Medical University Hospital (6 samples from 6 patients); Niigata University Hospital (3 samples from 3 patients); and Niigata Cancer Center Hospital (12 samples from 10 patients). All 3 centers are located approximately 57, 168, and 167 km away from Gunma. Fresh tumor tissue samples were obtained from 2 of the 26 patients with MCC. The average age of the MCC patients at the time of resection was 80 13 years (range 48–96 years). Of the 26 MCC cases, 16 (62%) were women and 10
(38%) were men. This study was conducted according to the Declaration of Helsinki Principles and was approved by the Ethics Committee of Gunma University. All samples were obtained upon informed consent or in compliance with the institutional review board for human studies. 2.2. Preparation of DNA and standard PCR analysis Sections of 5 mm were obtained from the FFPE tissue specimens from the patients. DNA was extracted by DEXPAT (TaKaRa, Otsu, Japan) according to the manufacturer’s protocol, followed by ethanol precipitation. The precipitate was dissolved in TE buffer and used for PCR analysis. Genomic DNA was isolated from whole blood or frozen tissue using a Wizard Genomic DNA Purification Kit (Promega, Madison, WI) according to the manufacturer’s protocol. The presence of MCPyV was detected by primer-directed amplification with PCR. Specific primer pairs, described previously [7] were used to detect the viral LT antigen (LT1 and LT3) and the viral capsid protein (VP1) (Table 1). For the PCR amplification, EX Taq DNA polymerase system (TaKaRa) was used with 3 ml of genomic DNA and 0.4 mM of each primer (30 ml per reaction). A 116-bp segment of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene [28] was also amplified to demonstrate the quality and quantity of the DNA samples (Table 1). The cycling condition consisted of an initial incubation at 95 8C for 1 min, followed by 45 cycles with denaturation at 95 8C for 15 s, annealing at 60 8C for 15 s, and elongation at 72 8C for 30 s. The final elongation step was performed at 72 8C for 10 min. The PCR products were purified and sequenced (Bio Matrix Research, Nagareyama, Japan). 2.3. Quantitative real-time PCR FFPE tissue specimens from either Gunma University or Niigata Cancer Center were subjected to real-time PCR analysis. DNA was extracted by NucleoSpin FFPE DNA (Macherey-Nagel, Du¨ren, Germany), followed by measurement of DNA concentration by a NanoDrop spectrophotometer (ND-1000, Thermo Scientific, Wilmington, DE). The relative viral load was obtained by amplifying the equal volume of DNA with 0.6 mM of each primer (LT_SYBR, Table 1) [29] in the THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) using the 7300 Real Time PCR system (Applied Biosystems, Foster City, CA). The cycling conditions
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
3
Table 2 The results for MCPyV detection in Japanese patients with MCC.
Age, Sex 90F
Site neck
2
76F
jaw
3 4 5 6
91F 88F 87M 85M
eyelid cheek eyelid buttock
7
95F
forehead
1 2 3 4 5 6 1 2 3 4
82M 84M 93F 51M 82F 88F 48M 74M 88F 60M
upper arm axilla cheek axilla jaw forehead neck forearm face hand
5 6 7
84F 76F 69M
face face buttock
8 9 10 1 2 3
66F 81F 96F 78F 92F 80M
face face face cheek thigh forearm
Institution No. GU 1
SMU
NCC
NU
Sample Lesion PCL MLN MCL PCL Blood PCL PCL RCL PCL MLN PCL PCL Blood PCL PCL PCL PCL PCL PCL PCL PCL PCL PCL MLN PCL PCL PCL MLN PCL PCL PCL PCL PCL PCL PCL
Tr B R R R
Type FFPE FFPE FFPE FFPE
R R R R B R R
FFPE FFPE FFPE FFPE FFPE FFPE Frozen
R R R R R R R R R R R R R R R R R R R R R R
FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE Frozen
Viral load IHC Histological PCR LT3 VP1 (a.u.) CM2B4 Type (-) (-) ND (+) IM S(P) (-) (-) ND (-) (-) (-) ND (-) P P 15.2 (+) IM S(-) (-) (-) ND P (-) 1.5 (-) T P (-) 1 (+++) T S(P) P (-) 6.7 (++) IM P P 4.3 ND IM S P P ND (+++) (-) (-) ND (+++) IM P (-) ND (-) (-) ND P P (++) IM P P (++) IM S(P) P P (-) T P P (-) T P (-) (++) IM P P (-) IM S(-) (-) (-) ND (+) IM S(-) (-) (-) ND (++) IM P P 2.2 (-) IM S(-) P P 8.1 (++) IM P P ND (+) P (-) ND (+++) IM S(P) P P 9.1 (++) IM P P 4.9 (++) IM P (-) ND (+++) P (-) 2.3 (-) IM S(-) P (-) 1 (+++) IM P P 6.6 (+) IM P P (++) IM S(-) P (-) (+) T S(-) P P (++) IM S(P) P P
GU, Gunma University Hospital; SMU, Saitama Medical University Hospital; NCC, Niigata Cancer Center Hospital; NU, Niigata University Hospital; F, female; M, male; PCL, primary cutaneous lesion; MLN, metastasized lymph node; MCL, metastasized cutaneous lesion; RCL, recurrent cutaneous lesion; Tr, treatment; B, biopsy; R, resection; FFPE, formalin-fixed paraffin-embedded; P, positive; (), negative; a.u., arbitrary unit; ND, not done; (+++), strongly positive; (++), positive; (+), weakly positive; IM, intermediate type; T, trabecular type; S, small cell type.
were: 10 min at 95 8C, 40 cycles of 15 s at 95 8C, and 1 min at 60 8C. The GAPDH gene was also amplified in parallel as an internal control and the ratio of LT_SYBR to GAPDH was compared among the samples. 2.4. Sequence analysis of LT antigen Overlapping fragments of the MCPyV LT encoding gene were amplified using 4 primer pairs (Table 1) in order to cover the whole second exon of LT as described by Laude et al. [30]. PCR was performed with an EX Taq DNA polymerase system containing 0.5 mM of primers in a final volume of 30 ml using DNA extracted from the frozen tissue sample of NU3 as a template. The cycling conditions consisted of an initial incubation at 95 8C for 2 min, followed by 45 cycles with denaturation at 95 8C for 30 s, annealing at 60 8C for 30 s, and elongation at 72 8C for 1 min. The final elongation step was performed at 72 8C for 10 min. PCR products were then directly sequenced as described above. Neighborjoining (NJ) phylogenetic trees for nucleotide sequences were constructed from ClustalW alignments (http://www.genome.jp/ tools/clustalw/) using the sequence of NU3 and 12 other MCPyV strains available in GenBank.
2.5. Immunohistochemistry Immunohistochemistry was performed on the identical FFPE tissue sections described above. Briefly, sections (5-mm thick) were deparaffinized with Hemo-De (Falma, Tokyo, Japan), and rehydrated through a graded series of ethanol. Epitope retrieval was performed in Target Retrieval Solution (Dako, Carpinteria, CA) with a pressure cooker (1.2 kg/cm2) at 121 8C for 10 min. Endogenous peroxidase was blocked by incubation in peroxidase blocking solution (Dako) for 5 min, followed by incubation with Protein Block Serum-Free (Dako) for 10 min. The sections were then incubated overnight at 4 8C with primary antibodies, followed by incubation for 1 h with HRP-conjugated secondary antibody solution (EnVision + System-HRP, labeled polymer, Dako). The primary antibodies were anti-MCPyV LT antigen antibody (CM2B4, 2 mg/ml, diluted in Protein Block Serum-Free, Santa Cruz, Santa Cruz, CA), anti-CD45RO antibody (UCHL1, prediluted, Nichirei Biosciences, Tokyo, Japan), anti-CD20 antibody (L26, prediluted, Nichirei Biosciences), anti-CD4 antibody (prediluted, Nichirei Biosciences), and anti-CD8 antibody (prediluted, Nichirei Biosciences). Normal mouse IgG (2 mg/ml, diluted in Protein Block Serum-Free, Santa Cruz) was used for the negative control sections.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
4
Table 3 Mutations in LT3 fragments found in Japanese patients with MCC.
Strains MCC350 JPMCVst1 JPMCVst2 JPMCVst3 JPMCVst4
Sequence (770-779 TCCTCTGTAA TCCT__GTAA TCCT__GTAA TCCT__GTAA TCCT__GTAA
828-854)
GU
TTTATGACAGATTTTGTGTACTTTCCC TTTATGACAGATTTTCTGTACTTTCCC TTTATGACAGATTTTGTGTACTTTCCC TT_ATGACAGATTTTCTGTACTTTCCC TTTATGACAGATTTTCTGTACTTTTCC
Diaminobenzidine (EnVision + Kit/HRP (DAB), Dako) was used for visualization before counterstaining with hematoxylin. 3. Results 3.1. Detection of MCPyV DNA in skin carcinomas of Japanese patients We first analyzed FFPE tissue samples from 26 patients diagnosed with MCC at 4 major medical centers in Gunma, Saitama and Niigata. Twenty-two of the 26 patients (84.6%) were positive for LT3 and 13 (50%) were also positive for VP1 (Table 2); no LT1 fragment was amplified in any of the samples. All samples positive for VP1 were also positive for LT3. The positivity for MCPyV DNA in metastasized lesions was concordant with that in the primary cutaneous lesions. The positive rate of MCPyV DNA in MCC patients ranged from 71.4% to 100% among the 4 centers in the central area of Japan, suggesting a high prevalence of MCPyV in Japanese patients with MCC. To examine whether the presence of MCPyV DNA is specific to MCC tumors, we analyzed FFPE samples from BCC or SCC tumors containing more than 70% tumor tissue. Ten BCC and 11 SCC (including a metastasized lymph node) samples were randomly selected, and PCR analysis was performed using LT3 primers, but no fragment was amplified in any of the BCC or SCC tumor samples (data not shown). Thus, MCPyV DNA was detected exclusively in MCC tumors in our system. Next, we tried to detect MCPyV DNA by PCR using DNA extracted from frozen tissue samples of MCC tumors (GU7 and NU3). Both LT3 and VP1 fragments were amplified in the frozen tissue samples as well as in the FFPE NU3 samples. However, the LT3 fragment was detected only in the frozen tissue samples, but not in the FFPE GU7 samples (Table 2). Thus, the detection of MCPyV DNA by PCR may, to some extent, depend on certain parameters such as tissue fixation, methods of DNA extraction, the amount of available tissue, and storage conditions, as reported previously [31].
NCC
NU
5, 6, 7 3, 4, 7, 8, 10 1, 3 2 1 6
SMU
1 2, 3, 4, 5
nucleotide positions (according to the MCPyV reference sequence, GenBank: NC_010277.1) were found, and had no effect on the amino acid composition of VP1. The sequence showed 100% homology to another Japanese isolate, TKS (GenBank: FJ464337) [23] and an Asian isolate 16b (GenBank: HM011548) [32], and close homology (99%) to the MCPyV reference sequence. On the other hand, as shown in Table 3, LT3 fragments harbored 4 patterns of mutations (JPMCVst1-4), suggesting that the possibility of contamination of the samples could be excluded. All sequences harbored 2 nucleotide gaps at positions 774 and 775 according to the reference sequence. Three strains (except JPMCVst2) had a point mutation at the 843 nucleotide position (G to C substitution). JPMCVst3 had another site deletion at the 830 nucleotide position, while JPMCVst4 had another point mutation at the 852 nucleotide position (C to T substitution). JPMCVst1 showed 100% homology to other Japanese isolates, SCC-JK [33] and TKS [23]. All of the mutations and deletions were located in the intron region of the LT antigen gene. JPMCVst1 was frequently observed in the samples from Gunma and Niigata, while JPMCVst3 was frequently observed in the samples from Saitama (Table 3). 3.4. Phylogenetic analysis of a Japanese MCPyV strain We next sequenced the second exon of the LT antigen gene harboring multiple mutations [11] using DNA extracted from the frozen tissue sample (NU3) by the method described by Laude et al. [30]. Four overlapping fragments of the LT antigenencoding gene, which covered the whole second exon of the LT antigen (base pair numbers 861–3080 according to the reference sequence), can be amplified; however, we could detect only one fragment encompassing part of the LT3 region (base pair numbers 727–1345) (data not shown). Sequence analysis of the fragment demonstrated a novel point mutation at the 1262 nucleotide position, which is located in the region encoding the
3.2. Relative viral load in MCC tumors The relative viral DNA load was examined by real-time PCR among the 5 and 7 MCPyV-positive cases from Gunma University and Niigata Cancer Center, respectively. As shown in Table 2, the relative viral load was highest in GU2, followed by GU5, GU6, GU3, and GU4 among the samples from Gunma University. Likewise, NCC6 showed the highest viral load, followed by NCC4, NCC10, NCC7, NCC8, NCC3, and NCC9 among the samples from Niigata Cancer Center. 3.3. Sequencing analysis of the PCR products To confirm that the PCR-amplified products contain MCPyVspecific DNA, the purified PCR products (18 LT3 and 12 VP1 fragments) were subjected to sequencing analysis. In all VP1 fragments, 3-point mutations at the 3825, 3831, and 3873
Fig. 1. Phylogenetic tree generated with the neighbor-joining method on 13 sequences of Merkel cell polyomavirus (MCPyV) genome. The MCPyV strains were categorized into 2 main clades, Asian and Caucasian, according to the proposal by Martel-Jantin et al. [34]. The new sequence generated in this study (NU3) is in bold.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
5
Fig. 2. Detection of Merkel cell polyomavirus large T antigen using CM2B4 by immunohistochemistry. (A) Merkel cell carcinoma samples stained by CM2B4 were classified into 4 groups: (+++) strongly positive; (++) positive; (+) weakly positive; and (–) negative. Representative cases (GU7, GU5, GU1, and GU3) are shown with control IgG-stained slides, hematoxylin and eosin (HE)-stained slides, and the clinical features. Original magnifications are 400-fold in the CM2B4- and IgG-stained slides and 100-fold in HEstained slides. (B) Small cells with hyperchromatic nuclei showing positive staining for CM2B4 in SMU2 (left), but negative staining in NU1 (right), even though intermediatetype tumor cells are positive for CM2B4 in both cases. Control IgG- and HE-stained slides are also shown. Original magnification is 400-fold.
Rb-binding motif, but it did not affect the amino acid composition. Any stop codons were deduced from the sequence. Using the partial sequence of NU3 encompassing JPMCVst1 (758 bp in length) and 12 other MCPyV strains available in GenBank, a phylogenetic study using the NJ method was performed. As shown in Fig. 1, the analysis indicated the presence of 2 main clades, Caucasian and Asian, as described by Martel-Jantin et al. [34]. The NU3 strain belonged to the Asian
clade, and was the most closely related to the other Japanese isolates, TKS [23] and SCC-JK [33]. 3.5. Histological classification and detection of MCPyV LT antigen by immunohistochemistry According to the arrangement and appearance of tumor cells, MCC is classified into 3 histological subtypes: intermediate, small
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 6
T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
Fig. 3. Immunodetection of Merkel cell polyomavirus large T antigen in non-Merkel cell carcinoma tumors. Basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) samples were stained with either CM2B4 or control IgG. Original magnification is 400-fold.
cell, and trabecular [2–4]. Of the 26 MCC cases, 21 were classified as intermediate and 5 as trabecular (Table 2 and Fig. 2A). Small cells with hyperchromatic nuclei were mixed with the intermediate type in 11 of 21 cases and the trabecular type in 2 of 5 cases (Table 2). We next performed immunohistochemistry using a monoclonal antibody (CM2B4) against the epitope in exon 2 of the LT antigen [35]. Of the 30 samples from 26 cases with MCC (24 primary cutaneous lesions, 4 metastasized lymph nodes, and 1 each recurrent skin tumor and metastasized cutaneous lesion), CM2B4-stained tumor cells were observed diffusely and strongly in 6 samples (+++; strongly positive), significantly but partly in 10 samples (++; positive) and weakly in 6 samples (+; weakly positive) with nuclear staining, but showed no staining in 8 samples (Table 2). In total, 20 of the 26 MCC cases (76.9%) expressed MCPyV LT antigen. No signals were detected in control sections treated with normal mouse IgG instead of CM2B4. The samples that were strongly positive for CM2B4 did not correspond to those with a higher viral load (Table 2). Three of 5 trabeculartype lesions showed negative staining, whereas the staining pattern varied among the intermediate-type tumors (Fig. 2A and Table 2). Small cells with hyperchromatic nuclei showed nuclear immunoreactivity for CM2B4, as well as the cells with large lobular nuclei and scant, pale-stained cytoplasm (5 samples); small cells showed no staining in the other 7 samples (Fig. 2B and Table 2). Four lesions (cases GU2, GU7, NCC1, and NCC2) expressed the viral LT antigen, in which viral DNA was not detected by PCR analysis using DNA extracted from FFPE samples (Table 2). BCC and SCC samples were also stained by CM2B4. Four (80%) of the 5 BCC tumors and 2 (40%) of the 5 SCC tumors showed weak, but significant nuclear immunoreactivity (Fig. 3), although MCPyV DNA was not detected from the identical FFPE tissue blocks by PCR. 3.6. CM2B4 positivity in the cells around the skin carcinomas As shown in Fig. 4A, the significant positive signals for CM2B4 were found in the cells around some of the MCC and non-MCC samples to varying degrees, even when the tumor cells were negative for CM2B4. The signal was completely negative in samples treated with control IgG as a primary antibody. No signals were observed in other cell types such as epithelial cells or
endothelial cells in the skin. The distribution of the CM2B4positive cells around the tumors corresponded to those of CD45RO- and CD8-positive lymphocytes and partly to that of CD20-positive lymphocytes (Fig. 4A), suggesting some of these cells might express LT antigen. To examine whether hematopoietic cells may harbor the virus as a reservoir [30,36], we extracted genomic DNA from whole blood from 2 patients with MCC and 19 healthy volunteers and examined the presence of MCPyV DNA by PCR; however, the LT3 fragment was not amplified in any of the samples (Fig. 4B). 4. Discussion In the present study, we confirmed the high prevalence of MCPyV DNA in Japanese patients with MCC. Viral DNA was detected in 23 of 26 patients (88.5%) by PCR, and the prevalence rate was comparable to those reported from Europe, the USA, and Japan [7,13,15,16,18,19,24,25]. The positive rate of the viral DNA was comparably high, ranging from 80% to 100%, among the 4 medical centers located in an approximately 38,400-km2 area of Japan. The phylogenetic analysis demonstrated that one of our strains was closely related to the other Japanese isolates, suggesting that the MCPyV strains in Japan may be genetically conserved. The recent description of MCPyV by Feng et al. [7] has been followed by multiple studies that have supported the notion of a strong epidemiologic link between MCPyV and MCC. Most of the studies have shown a prevalence of MCPyV between 75% and 90% of European and North American MCC patients, while Garneski et al. reported that the virus is less frequently present (per PCR analysis) in Australian MCC patients (5/21, 24%) [20]. This was supported by the finding that only 19 (18.3%) of 104 cases of Australian MCC showed positive staining for MCPyV by immunohistochemistry [21]. These studies support the concept that MCPyV is less frequently associated with MCC arising in a sunexposed, predominantly fair-skinned population, presumably because sun exposure may more strongly drive MCC through an alternative pathway than virus-driven oncogenesis. In contrast to these studies, Schrama et al. demonstrated MCPyV DNA was present in 33 (86%) of the 38 Australian MCC patients by both a PCR-based method and immunohistochemical-LT protein
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
7
Fig. 4. (A) Immunoreactivity for CM2B4 in the cells around the Merkel cell carcinoma (MCC), basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) tumors. The sections were also stained with CD20, CD45RO, CD4, CD8, or control IgG. GU7 and NCC8 were selected as the representatives of CM2B4-positive and -negative MCC tumors, respectively. T = tumor; original magnification is 200-fold. (B) Merkel cell polyomavirus DNA detection in whole blood from healthy volunteers (Ctl) and MCC patients by polymerase chain reaction. LT3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were amplified using gene-specific primers and visualized by ethidium bromidestained agarose gel electrophoresis. FFPE, formalin-fixed paraffin-embedded tissue.
detection [22]. This group concluded the difference between the studies can neither be explained by the geographical issues from which the samples were obtained nor the type of MCC tumors [22]. In an earlier report in Japan, the prevalence of MCPyV had been thought to be relatively low (55%) [23], but subsequent reports showed MCPyV DNA was found in 77% to 100% of Japanese MCC cases [1,24–26], which is comparable to those from Europe, the USA, and Australia. The present multi-center study supports the
results that MCPyV may be highly prevalent on a worldwide level, whereas the incidence rates of MCC varied among the countries (e.g. 0.15, 0.44, and 0.82 per 100,000 in Japan, the USA, and Western Australia, respectively) [25,37,38]. Immunohistochemical analyses for the detection of MCPyV LT protein expression are frequently performed since a monoclonal antibody became commercially available. The antibody (CM2B4) was developed by the research team that found MCPyV using a
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 8
T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
recombinant peptide fragment unique to MCPyV LT antigen [35]. The detection rates of the viral T antigen in MCC by immunohistochemistry are relatively lower, ranging from 58% to 75% [14,35,39,40] compared to those measured by PCR. Ota et al. suggested that the discrepancies between the PCR and immunohistochemistry results can be explained by the absolute viral copy number per human genome in MCPyV-infected tumor tissue [26]. In the present study, the detection rate of MCPyV by immunohistochemistry was lower than that by PCR (76.9% vs 88.5%), but even MCPyV-DNA-negative tumors were positive for MCPyV LT protein expression and the relative viral DNA load was not correlated with LT protein expression level. The conflicting results may be either due to insufficient specificity of the antibody or low efficiency in the PCR analysis. Indeed, Kuwamoto et al. showed that CM2B4 detected MCPyV with 95% sensitivity and 83% specificity in MCC compared with PCR [1,24]. On the other hand, formalin fixation of tissues is a well-known cause of DNA degradation leading to lowquality DNA in the PCR analysis [16]. Thus, MCPyV is strongly associated with MCC by both conventional PCR and immunohistochemical analyses, but there is a discrepancy in the results between the 2 methods. BCC and SCC are skin cancers that often develop on the sunexposed skin of elderly people. In previous reports, the detection rate of MCPyV DNA ranged from 0% to 14% in BCC [13,26,41–43] and from 0% to 26.9% in SCC [43–46]. MCPyV LT expression has rarely been detected in these skin tumors except for 1 BCC [26] and 2 SCC cases [43], which were also positive for viral DNA. In the present study, significant, but low, nuclear immunoreactivity was observed in 80% and 40% of cases of BCC and SCC, respectively, in spite of the negative results in the PCR analysis. In line with this, CM2B4 cannot be suitable as a diagnostic tool to differentiate MCC from other skin tumors [1]. As with some of other human polyomaviruses, the possibility that lymphocytes may serve as a tissue reservoir for MCPyV infection has been raised [35]. Furthermore, Mertz et al. demonstrated that MCPyV persists in inflammatory monocytes (CD14+CD16), but not resident monocytes (CD14loCD16+) [36]. This suggests that MCPyV might spread along the migration routes of inflammatory monocytes. Interestingly, we found that CM2B4positive cells were present around skin tumors with distribution similar to CD20-, CD45RO-, or CD8-positive lymphocytes. Though CM2B4-positive cells were also observed around the BCC and SCC tumors, truncation of LT antigen by the mutations specific for MCC may be involved in carcinogenesis of the tumor [11]. The possibility of cross-reactivity by CM2B4 could not be excluded, although human polyomaviruses newly discovered in succession after the discovery of MCPyV did not harbor the epitope sequence of CM2B4 [10,32,47,48]. Different antibodies against MCPyV LT antigen should be helpful to clarify the cross-reactivity or pseudopositivity [49,50]. On the other hand, previous reports showed that MCPyV DNA was detected in PBMC samples from 15 of 30 (50%) MCC patients and was associated with poorer outcome [30], while the other 2 studies did not detect MCPyV in a cohort of 40 or 45 healthy blood donors [15,17]. These results are consistent with our observation. Although MCPyV does not seem to persist frequently in PBMCs, a certain cell type infiltrating around MCC might act as a reservoir for MCPyV. In the present study, there was no association between the presence of MCPyV and histological types of MCC or tumor-cell morphology, except that trabecular-type MCC tumors may have a tendency to express less LT antigen protein. Previously, Katano et al. pointed out that MCPyV-positive MCCs were morphologically typical with round and vesicular nuclei, whereas MCPyV-negative MCCs showed various morphologies such as polygonal nuclei and some light cytoplasm [23]. A subsequent morphometric study has demonstrated MCPyV-negative MCCs have more irregularly
shaped nuclei and more abundant cytoplasm than MCPyV-positive MCCs [1,24,51]; however, it is hard to distinguish virus-positive cells from virus-negative cells with light microscopic examination only. The finding that cell morphology and growth phenotype of MCC cell lines did not reflect the presence of MCPyV supports the results of this study [52]. In conclusion, we demonstrated the high prevalence of MCPyV in Japanese MCC patients. However, it is of note that the actual frequency of the viral infection in MCC and other skin cancers remains unclear because the detection rate is varied depending on the method. Further characterization of the association between MCPyV and MCC and/or other skin cancers is needed for better understanding of the methods for viral detection. Funding sources None. References [1] Kuwamoto S. Recent advances in the biology of Merkel cell carcinoma. Hum Pathol 2011;42:1063–77. [2] Jaeger T, Ring J, Andres C. Histological, immunohistological, and clinical features of merkel cell carcinoma in correlation to merkel cell polyomavirus status. J Skin Cancer 2012;2012:983421. [3] Nicolaidou E, Mikrova A, Antoniou C, Katsambas AD. Advances in Merkel cell carcinoma pathogenesis and management: a recently discovered virus, a new international consensus staging system and new diagnostic codes. Br J Dermatol 2012;166:16–21. [4] Schrama D, Becker JC. Merkel cell carcinoma–pathogenesis, clinical aspects and treatment. J Eur Acad Dermatol Venereol 2011;25:1121–9. [5] Bhatia S, Afanasiev O, Nghiem P. Immunobiology of Merkel cell carcinoma: implications for immunotherapy of a polyomavirus-associated cancer. Curr Oncol Rep 2011;13:488–97. [6] Wang TS, Byrne PJ, Jacobs LK, Taube JM. Merkel cell carcinoma: update and review. Semin Cutan Med Surg 2011;30:48–56. [7] Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 2008;319:1096–100. [8] Arron ST, Jennings L, Nindl I, Rosl F, Bouwes Bavinck JN, Seckin D, et al. Viral oncogenesis and its role in nonmelanoma skin cancer. Br J Dermatol 2011;164: 1201–13. [9] Houben R, Schrama D, Becker JC. Molecular pathogenesis of Merkel cell carcinoma. Exp Dermatol 2009;18:193–8. [10] Van Ghelue M, Khan MT, Ehlers B, Moens U. Genome analysis of the new human polyomaviruses. Rev Med Virol 2012;22:354–77. [11] Shuda M, Feng H, Kwun HJ, Rosen ST, Gjoerup O, Moore PS, et al. T antigen mutations are a human tumor-specific signature for Merkel cell polyomavirus. Proc Natl Acad Sci U S A 2008;105:16272–77. [12] Shuda M, Kwun HJ, Feng H, Chang Y, Moore PS. Human Merkel cell polyomavirus small T antigen is an oncoprotein targeting the 4E-BP1 translation regulator. J Clin Invest 2011;121:3623–34. [13] Becker JC, Houben R, Ugurel S, Trefzer U, Pfohler C, Schrama D. MC polyomavirus is frequently present in Merkel cell carcinoma of European patients. J Invest Dermatol 2009;129:248–50. [14] Busam KJ, Jungbluth AA, Rekthman N, Coit D, Pulitzer M, Bini J, et al. Merkel cell polyomavirus expression in merkel cell carcinomas and its absence in combined tumors and pulmonary neuroendocrine carcinomas. Am J Surg Pathol 2009;33:1378–85. [15] Kassem A, Schopflin A, Diaz C, Weyers W, Stickeler E, Werner M, et al. Frequent detection of Merkel cell polyomavirus in human Merkel cell carcinomas and identification of a unique deletion in the VP1 gene. Cancer Res 2008;68: 5009–13. [16] Foulongne V, Dereure O, Kluger N, Moles JP, Guillot B, Segondy M. Merkel cell polyomavirus DNA detection in lesional and nonlesional skin from patients with Merkel cell carcinoma or other skin diseases. Br J Dermatol 2010;162: 59–63. [17] Duncavage EJ, Zehnbauer BA, Pfeifer JD. Prevalence of Merkel cell polyomavirus in Merkel cell carcinoma. Mod Pathol 2009;22:516–21. [18] Sihto H, Kukko H, Koljonen V, Sankila R, Bohling T, Joensuu H. Clinical factors associated with Merkel cell polyomavirus infection in Merkel cell carcinoma. J Natl Cancer Inst 2009;101:938–45. [19] Varga E, Kiss M, Szabo K, Kemeny L. Detection of Merkel cell polyomavirus DNA in Merkel cell carcinomas. Br J Dermatol 2009;161:930–2. [20] Garneski KM, Warcola AH, Feng Q, Kiviat NB, Leonard JH, Nghiem P. Merkel cell polyomavirus is more frequently present in North American than Australian Merkel cell carcinoma tumors. J Invest Dermatol 2009;129:246–8. [21] Paik JY, Hall G, Clarkson A, Lee L, Toon C, Colebatch A, et al. Immunohistochemistry for Merkel cell polyomavirus is highly specific but not sensitive for the diagnosis of Merkel cell carcinoma in the Australian population. Hum Pathol 2011;42:1385–90.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx [22] Schrama D, Peitsch WK, Zapatka M, Kneitz H, Houben R, Eib S, et al. Merkel cell polyomavirus status is not associated with clinical course of Merkel cell carcinoma. J Invest Dermatol 2011;131:1631–8. [23] Katano H, Ito H, Suzuki Y, Nakamura T, Sato Y, Tsuji T, et al. Detection of Merkel cell polyomavirus in Merkel cell carcinoma and Kaposi’s sarcoma. J Med Virol 2009;81:1951–8. [24] Kuwamoto S, Higaki H, Kanai K, Iwasaki T, Sano H, Nagata K, et al. Association of Merkel cell polyomavirus infection with morphologic differences in Merkel cell carcinoma. Hum Pathol 2011;42:632–40. [25] Nakajima H, Takaishi M, Yamamoto M, Kamijima R, Kodama H, Tarutani M, et al. Screening of the specific polyoma virus as diagnostic and prognostic tools for Merkel cell carcinoma. J Dermatol Sci 2009;56:211–3. [26] Ota S, Ishikawa S, Takazawa Y, Goto A, Fujii T, Ohashi K, et al. Quantitative analysis of viral load per haploid genome revealed the different biological features of merkel cell polyomavirus infection in skin tumor. PLoS ONE 2012;7:e39954. [27] Jung HS, Choi YL, Choi JS, Roh JH, Pyon JK, Woo KJ, et al. Detection of Merkel cell polyomavirus in Merkel cell carcinomas and small cell carcinomas by PCR and immunohistochemistry. Histol Histopathol 2011;26:1231–41. [28] Hattori T, Stawski L, Nakerakanti SS, Trojanowska M. Fli1 is a negative regulator of estrogen receptor alpha in dermal fibroblasts. J Invest Dermatol 2011;131:1469–76. [29] Sastre-Garau X, Peter M, Avril MF, Laude H, Couturier J, Rozenberg F, et al. Merkel cell carcinoma of the skin: pathological and molecular evidence for a causative role of MCV in oncogenesis. J Pathol 2009;218:48–56. [30] Laude HC, Jonchere B, Maubec E, Carlotti A, Marinho E, Couturaud B, et al. Distinct merkel cell polyomavirus molecular features in tumour and nontumour specimens from patients with merkel cell carcinoma. PLoS Pathog 2010;6:e1001076. [31] Duncavage EJ, Le BM, Wang D, Pfeifer JD. Merkel cell polyomavirus: a specific marker for Merkel cell carcinoma in histologically similar tumors. Am J Surg Pathol 2009;33:1771–7. [32] Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB. Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe 2010;7:509–15. [33] Imajoh M, Hashia Y, Taniguchi A, Kamioka M, Daibata M. Novel human polyomaviruses Merkel cell polyomavirus and human polyomavirus 9, in Japanese chronic lymphocytic leukemia cases. J Hematol Oncol 2012;5:25. [34] Martel-Jantin C, Filippone C, Cassar O, Peter M, Tomasic G, Vielh P, et al. Genetic variability and integration of Merkel cell polyomavirus in Merkel cell carcinoma. Virology 2012;426:134–42. [35] Shuda M, Arora R, Kwun HJ, Feng H, Sarid R, Fernandez-Figueras MT, et al. Human Merkel cell polyomavirus infection I.MCVT. antigen expression in Merkel cell carcinoma, lymphoid tissues and lymphoid tumors. Int J Cancer 2009;125:1243–9. [36] Mertz KD, Junt T, Schmid M, Pfaltz M, Kempf W. Inflammatory monocytes are a reservoir for Merkel cell polyomavirus. J Invest Dermatol 2010;130:1146–51. [37] Hodgson NC. Merkel cell carcinoma: changing incidence trends. J Surg Oncol 2005;89:1–4.
9
[38] Girschik J, Thorn K, Beer TW, Heenan PJ, Fritschi L. Merkel cell carcinoma in Western Australia: a population-based study of incidence and survival. Br J Dermatol 2011;165:1051–7. [39] Ly TY, Walsh NM, Pasternak S. The spectrum of Merkel cell polyomavirus expression in Merkel cell carcinoma, in a variety of cutaneous neoplasms, and in neuroendocrine carcinomas from different anatomical sites. Hum Pathol 2012;43:557–66. [40] Reisinger DM, Shiffer JD, Cognetta Jr AB, Chang Y, Moore PS. Lack of evidence for basal or squamous cell carcinoma infection with Merkel cell polyomavirus in immunocompetent patients with Merkel cell carcinoma. J Am Acad Dermatol 2010;63:400–3. [41] Andres C, Belloni B, Puchta U, Sander CA, Flaig MJ. Prevalence of MCPyV in Merkel cell carcinoma and non-MCC tumors. J Cutan Pathol 2010;37:28–34. [42] Wieland U, Mauch C, Kreuter A, Krieg T, Pfister H. Merkel cell polyomavirus DNA in persons without merkel cell carcinoma. Emerg Infect Dis 2009;15: 1496–8. [43] Murakami M, Imajoh M, Ikawa T, Nakajima H, Kamioka M, Nemoto Y, et al. Presence of Merkel cell polyomavirus in Japanese cutaneous squamous cell carcinoma. J Clin Virol 2011;50:37–41. [44] Ridd K, Yu S, Bastian BC. The presence of polyomavirus in non-melanoma skin cancer in organ transplant recipients is rare. J Invest Dermatol 2009;129: 250–2. [45] Wieland U, Scola N, Stolte B, Stucker M, Silling S, Kreuter A. No evidence for a causal role of Merkel cell polyomavirus in keratoacanthoma. J Am Acad Dermatol 2012;67:41–6. [46] Dworkin AM, Tseng SY, Allain DC, Iwenofu OH, Peters SB, Toland AE. Merkel cell polyomavirus in cutaneous squamous cell carcinoma of immunocompetent individuals. J Invest Dermatol 2009;129:2868–74. [47] van der Meijden E, Janssens RW, Lauber C, Bouwes Bavinck JN, Gorbalenya AE, Feltkamp MC. Discovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog 2010;6:e1001024. [48] Scuda N, Hofmann J, Calvignac-Spencer S, Ruprecht K, Liman P, Kuhn J, et al. A novel human polyomavirus closely related to the african green monkeyderived lymphotropic polyomavirus. J Virol 2011;85:4586–90. [49] Nakamura T, Sato Y, Watanabe D, Ito H, Shimonohara N, Tsuji T, et al. Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma. Virology 2010;398:273–9. [50] Rodig SJ, Cheng J, Wardzala J, DoRosario A, Scanlon JJ, Laga AC, et al. Improved detection suggests all Merkel cell carcinomas harbor Merkel polyomavirus. J Clin Invest 2012;122:4645–53. [51] Higaki-Mori H, Kuwamoto S, Iwasaki T, Kato M, Murakami I, Nagata K, et al. Association of Merkel cell polyomavirus infection with clinicopathological differences in Merkel cell carcinoma. Hum Pathol 2012;43:2282–91. [52] Fischer N, Brandner J, Fuchs F, Moll I, Grundhoff A. Detection of Merkel cell polyomavirus (MCPyV) in Merkel cell carcinoma cell lines: cell morphology and growth phenotype do not reflect presence of the virus. Int J Cancer 2010;126:2133–42.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
DESC-2490; No. of Pages 9 Journal of Dermatological Science xxx (2013) xxx–xxx
Contents lists available at SciVerse ScienceDirect
Journal of Dermatological Science journal homepage: www.elsevier.com/jds
The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma Tomoyasu Hattori a,*, Yuko Takeuchi a, Tatsuya Takenouchi b, Akiko Hirofuji c, Tetsuya Tsuchida c, Takenori Kabumoto d, Hiroshi Fujiwara d, Masaaki Ito d, Akira Shimizu a, Etsuko Okada a, Sei-ichiro Motegi a, Atsushi Tamura a, Osamu Ishikawa a a
Department of Dermatology, Gunma University Graduate School of Medicine, Maebashi, Japan. Division of Dermatology, Niigata Cancer Center Hospital, Niigata, Japan c Department of Dermatology, Saitama Medical University, Iruma-gun, Japan d Division of Dermatology, Niigata University Graduate School of Medical and Dental Sciences, Niigata, Japan b
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 September 2012 Received in revised form 1 February 2013 Accepted 17 February 2013
Background: A novel polyomavirus, the Merkel cell polyomavirus (MCPyV) has been implicated in the pathogenesis of Merkel cell carcinoma (MCC); however, the prevalence of MCPyV in Japan has not been extensively investigated. Objective: To clarify the prevalence of MCPyV in Japanese patients with MCC. Methods: MCPyV DNA was examined by polymerase chain reaction (PCR) in formalin-fixed paraffinembedded (FFPE) or frozen tissue samples from 26 patients with MCC diagnosed in four medical centers in Japan. Immunohistochemistry was simultaneously performed using a monoclonal antibody against the viral large T (LT) antigen. FFPE samples from basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) were also analyzed as controls. Results: Twenty-three out of 26 cases (88.5%) were positive for MCPyV DNA by PCR. The amplified products harbored 4 patterns of mutations. Phylogenetic analysis demonstrated that one of our strains was closely related to the other Japanese strains previously reported. The LT antigen was expressed in various degrees in 20 of 26 cases (76.9%) by immunohistochemistry. Histological type had little relation to CM2B4 positivity, whereas 3 of 5 trabecular-type tumors showed no staining. The immunoreactivity for CM2B4 did not correlate with the relative viral DNA load. In BCC and SCC, the LT antigen was immunohistochemically positive, but MCPyV DNA was not detected by PCR. The cells around some MCC and non-MCC tumors were stained with CM2B4 with a distribution similar to CD20- and CD45RO(especially CD8-) positive lymphocytes. Conclusion: MCPyV was highly positive in Japanese patients with MCC. It is of note that the positive rate differs depending upon the detection method. ß 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Keywords: Merkel cell carcinoma Merkel cell polyomavirus Basal cell carcinoma Squamous cell carcinoma
1. Introduction Merkel cell carcinoma (MCC) is an aggressive neuroendocrine skin cancer which primarily affects elderly and immunesuppressed individuals. Although MCC is rare, its incidence is increasing [1–6]. Recently, Feng et al. demonstrated that a new human polyomavirus, designated as Merkel cell polyomavirus (MCPyV), is frequently detected in patients with MCC [7].
* Corresponding author at: Department of Dermatology, Gunma University Graduate School of Medicine, 3-39-22 Showa-machi, Maebashi, Gunma 371-8511, Japan. Tel.: +81 27 220 8284; fax: +81 27 220 8285. E-mail address: [email protected] (T. Hattori).
Integration of MCPyV DNA within the tumor genome in a clonal pattern suggests that MCPyV is a causative agent in MCC. The MCPyV genome encodes a large T (LT) antigen, which contains some conserved domains shown to play roles in cell transformation [1,5,6,8,9]. MCPyV was discovered using digital transcriptome subtraction of MCC [7]. MCPyV is a 5.4-kbp long, double-stranded DNA virus with a genome that contains early and late regions [7,10]. The former encodes nonstructural proteins, small and large T antigens that are responsible for viral replication. The latter encodes viral proteins (VPs) that constitute viral particles. LT antigen may play an essential role in MCC tumorigenesis by inhibiting the cell-cycleregulating function of retinoblastoma protein [5,8,9], whereas integrated LT antigen harbors truncating mutations upstream of
0923-1811/$36.00 ß 2013 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
2 Table 1 Primers used for PCR analysis. Experiment MCPyV detection
Primer name LT1 LT3 VP1
MCPyV quantificaion
LT_SYBR
Control
GAPDH
LT sequencing
LTagEx2-1 LTagEx2-2 LTagEx2-3 LTagEx2-4
a
Primer sequence Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
0
0
5 -TACAAGCACTCCACCAAAGC-3 50 -TCCAATTACAGCTGGCCTCT-30 50 -TTGTCTCGCCAGCATTGTAG-30 50 -ATATAGGGGCCTCGTCAACC-30 50 -TTTGCCAGCTTACAGTGTGG-30 50 -TGGATCTAGGCCCTGATTTT-30 50 -TCTTCCTCTGGGTATGGGGTC-30 50 -ATTGGGTGTGCTGGATTCTC-30 50 -GGTCTCCTCTGACTTCAACA-30 50 -AGCCAAATTCGTTGTCATAC-30 50 -TACTGCTTACTGCATCTGCACC-30 50 -GGCGAGCTTCTTGAGGAG-30 50 -GCGATGAATCACTTTCCTCC-30 50 -CCAATTACAGCTGGCCTCTT-30 50 -CCCCTTACAAATTACTGCAAGAG-30 50 -GATGGACAGTTTATATTCAAGGCC-30 50 -GCTTTGCTGCAGCCTTAATAG-30 50 -CAAACACAGGAAATATGAAGCAG-30
Positiona
Size (bp)a
Reference
1514–1953
440
[7]
571–879
309
4137–3786
352
1047–1208
162
[29]
116
[28]
727–1345
619
[30]
1267–1952
686
1870–2488
619
2428–3109
682
Position and size in GenBank NC_010277.1.
the helicase domains, rendering the viral replication function inactive [11]. Small T antigen of MCPyV has also been shown to have cell transformation ability by dysregulating cap-dependent translation [12]. However, there has not yet been any definitive proof that polyomavirus plays a relevant role in human carcinogenesis. The frequency of MCPyV-positive MCC is generally high, ranging from 75% to 90% in Europe and North America [7,13– 19], while it is less prevalent in Australian patients (18.3–24%) [20,21]. This difference may be due to the increased sun exposure in Australia, making a possible viral contribution less frequent; however, another group has recently reported a high prevalence rate of the virus in Australian MCC patients comparable to those from Germany [22]. In contrast there is relatively limited information available on the prevalence of MCPyV in Asian MCC patients [1,23–27], and it is unknown whether or not geographical differences exist. In this study, we investigated the positive rate of MCPyV DNA in Japanese MCC patients in 4 medical centers. To evaluate the polymerase chain reaction (PCR) results, we also performed immunohistochemistry using the identical MCC tissue samples. Samples from basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) were also analyzed to confirm the association of the virus in non-MCC skin cancers. 2. Materials and methods 2.1. Samples The formalin-fixed paraffin-embedded (FFPE) tissue specimens from patients with MCC (11 samples from 7 patients), BCC (10 samples from 10 patients) and SCC (10 samples from 9 patients) were retrieved from the archives of the Department of Dermatology, Gunma University Hospital. Blood samples were collected from 19 healthy volunteers and 2 of the 7 patients with MCC. FFPE samples of MCC tumors were also collected from 3 medical centers: Saitama Medical University Hospital (6 samples from 6 patients); Niigata University Hospital (3 samples from 3 patients); and Niigata Cancer Center Hospital (12 samples from 10 patients). All 3 centers are located approximately 57, 168, and 167 km away from Gunma. Fresh tumor tissue samples were obtained from 2 of the 26 patients with MCC. The average age of the MCC patients at the time of resection was 80 13 years (range 48–96 years). Of the 26 MCC cases, 16 (62%) were women and 10
(38%) were men. This study was conducted according to the Declaration of Helsinki Principles and was approved by the Ethics Committee of Gunma University. All samples were obtained upon informed consent or in compliance with the institutional review board for human studies. 2.2. Preparation of DNA and standard PCR analysis Sections of 5 mm were obtained from the FFPE tissue specimens from the patients. DNA was extracted by DEXPAT (TaKaRa, Otsu, Japan) according to the manufacturer’s protocol, followed by ethanol precipitation. The precipitate was dissolved in TE buffer and used for PCR analysis. Genomic DNA was isolated from whole blood or frozen tissue using a Wizard Genomic DNA Purification Kit (Promega, Madison, WI) according to the manufacturer’s protocol. The presence of MCPyV was detected by primer-directed amplification with PCR. Specific primer pairs, described previously [7] were used to detect the viral LT antigen (LT1 and LT3) and the viral capsid protein (VP1) (Table 1). For the PCR amplification, EX Taq DNA polymerase system (TaKaRa) was used with 3 ml of genomic DNA and 0.4 mM of each primer (30 ml per reaction). A 116-bp segment of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene [28] was also amplified to demonstrate the quality and quantity of the DNA samples (Table 1). The cycling condition consisted of an initial incubation at 95 8C for 1 min, followed by 45 cycles with denaturation at 95 8C for 15 s, annealing at 60 8C for 15 s, and elongation at 72 8C for 30 s. The final elongation step was performed at 72 8C for 10 min. The PCR products were purified and sequenced (Bio Matrix Research, Nagareyama, Japan). 2.3. Quantitative real-time PCR FFPE tissue specimens from either Gunma University or Niigata Cancer Center were subjected to real-time PCR analysis. DNA was extracted by NucleoSpin FFPE DNA (Macherey-Nagel, Du¨ren, Germany), followed by measurement of DNA concentration by a NanoDrop spectrophotometer (ND-1000, Thermo Scientific, Wilmington, DE). The relative viral load was obtained by amplifying the equal volume of DNA with 0.6 mM of each primer (LT_SYBR, Table 1) [29] in the THUNDERBIRD SYBR qPCR Mix (Toyobo, Osaka, Japan) using the 7300 Real Time PCR system (Applied Biosystems, Foster City, CA). The cycling conditions
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
3
Table 2 The results for MCPyV detection in Japanese patients with MCC.
Age, Sex 90F
Site neck
2
76F
jaw
3 4 5 6
91F 88F 87M 85M
eyelid cheek eyelid buttock
7
95F
forehead
1 2 3 4 5 6 1 2 3 4
82M 84M 93F 51M 82F 88F 48M 74M 88F 60M
upper arm axilla cheek axilla jaw forehead neck forearm face hand
5 6 7
84F 76F 69M
face face buttock
8 9 10 1 2 3
66F 81F 96F 78F 92F 80M
face face face cheek thigh forearm
Institution No. GU 1
SMU
NCC
NU
Sample Lesion PCL MLN MCL PCL Blood PCL PCL RCL PCL MLN PCL PCL Blood PCL PCL PCL PCL PCL PCL PCL PCL PCL PCL MLN PCL PCL PCL MLN PCL PCL PCL PCL PCL PCL PCL
Tr B R R R
Type FFPE FFPE FFPE FFPE
R R R R B R R
FFPE FFPE FFPE FFPE FFPE FFPE Frozen
R R R R R R R R R R R R R R R R R R R R R R
FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE FFPE Frozen
Viral load IHC Histological PCR LT3 VP1 (a.u.) CM2B4 Type (-) (-) ND (+) IM S(P) (-) (-) ND (-) (-) (-) ND (-) P P 15.2 (+) IM S(-) (-) (-) ND P (-) 1.5 (-) T P (-) 1 (+++) T S(P) P (-) 6.7 (++) IM P P 4.3 ND IM S P P ND (+++) (-) (-) ND (+++) IM P (-) ND (-) (-) ND P P (++) IM P P (++) IM S(P) P P (-) T P P (-) T P (-) (++) IM P P (-) IM S(-) (-) (-) ND (+) IM S(-) (-) (-) ND (++) IM P P 2.2 (-) IM S(-) P P 8.1 (++) IM P P ND (+) P (-) ND (+++) IM S(P) P P 9.1 (++) IM P P 4.9 (++) IM P (-) ND (+++) P (-) 2.3 (-) IM S(-) P (-) 1 (+++) IM P P 6.6 (+) IM P P (++) IM S(-) P (-) (+) T S(-) P P (++) IM S(P) P P
GU, Gunma University Hospital; SMU, Saitama Medical University Hospital; NCC, Niigata Cancer Center Hospital; NU, Niigata University Hospital; F, female; M, male; PCL, primary cutaneous lesion; MLN, metastasized lymph node; MCL, metastasized cutaneous lesion; RCL, recurrent cutaneous lesion; Tr, treatment; B, biopsy; R, resection; FFPE, formalin-fixed paraffin-embedded; P, positive; (), negative; a.u., arbitrary unit; ND, not done; (+++), strongly positive; (++), positive; (+), weakly positive; IM, intermediate type; T, trabecular type; S, small cell type.
were: 10 min at 95 8C, 40 cycles of 15 s at 95 8C, and 1 min at 60 8C. The GAPDH gene was also amplified in parallel as an internal control and the ratio of LT_SYBR to GAPDH was compared among the samples. 2.4. Sequence analysis of LT antigen Overlapping fragments of the MCPyV LT encoding gene were amplified using 4 primer pairs (Table 1) in order to cover the whole second exon of LT as described by Laude et al. [30]. PCR was performed with an EX Taq DNA polymerase system containing 0.5 mM of primers in a final volume of 30 ml using DNA extracted from the frozen tissue sample of NU3 as a template. The cycling conditions consisted of an initial incubation at 95 8C for 2 min, followed by 45 cycles with denaturation at 95 8C for 30 s, annealing at 60 8C for 30 s, and elongation at 72 8C for 1 min. The final elongation step was performed at 72 8C for 10 min. PCR products were then directly sequenced as described above. Neighborjoining (NJ) phylogenetic trees for nucleotide sequences were constructed from ClustalW alignments (http://www.genome.jp/ tools/clustalw/) using the sequence of NU3 and 12 other MCPyV strains available in GenBank.
2.5. Immunohistochemistry Immunohistochemistry was performed on the identical FFPE tissue sections described above. Briefly, sections (5-mm thick) were deparaffinized with Hemo-De (Falma, Tokyo, Japan), and rehydrated through a graded series of ethanol. Epitope retrieval was performed in Target Retrieval Solution (Dako, Carpinteria, CA) with a pressure cooker (1.2 kg/cm2) at 121 8C for 10 min. Endogenous peroxidase was blocked by incubation in peroxidase blocking solution (Dako) for 5 min, followed by incubation with Protein Block Serum-Free (Dako) for 10 min. The sections were then incubated overnight at 4 8C with primary antibodies, followed by incubation for 1 h with HRP-conjugated secondary antibody solution (EnVision + System-HRP, labeled polymer, Dako). The primary antibodies were anti-MCPyV LT antigen antibody (CM2B4, 2 mg/ml, diluted in Protein Block Serum-Free, Santa Cruz, Santa Cruz, CA), anti-CD45RO antibody (UCHL1, prediluted, Nichirei Biosciences, Tokyo, Japan), anti-CD20 antibody (L26, prediluted, Nichirei Biosciences), anti-CD4 antibody (prediluted, Nichirei Biosciences), and anti-CD8 antibody (prediluted, Nichirei Biosciences). Normal mouse IgG (2 mg/ml, diluted in Protein Block Serum-Free, Santa Cruz) was used for the negative control sections.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
4
Table 3 Mutations in LT3 fragments found in Japanese patients with MCC.
Strains MCC350 JPMCVst1 JPMCVst2 JPMCVst3 JPMCVst4
Sequence (770-779 TCCTCTGTAA TCCT__GTAA TCCT__GTAA TCCT__GTAA TCCT__GTAA
828-854)
GU
TTTATGACAGATTTTGTGTACTTTCCC TTTATGACAGATTTTCTGTACTTTCCC TTTATGACAGATTTTGTGTACTTTCCC TT_ATGACAGATTTTCTGTACTTTCCC TTTATGACAGATTTTCTGTACTTTTCC
Diaminobenzidine (EnVision + Kit/HRP (DAB), Dako) was used for visualization before counterstaining with hematoxylin. 3. Results 3.1. Detection of MCPyV DNA in skin carcinomas of Japanese patients We first analyzed FFPE tissue samples from 26 patients diagnosed with MCC at 4 major medical centers in Gunma, Saitama and Niigata. Twenty-two of the 26 patients (84.6%) were positive for LT3 and 13 (50%) were also positive for VP1 (Table 2); no LT1 fragment was amplified in any of the samples. All samples positive for VP1 were also positive for LT3. The positivity for MCPyV DNA in metastasized lesions was concordant with that in the primary cutaneous lesions. The positive rate of MCPyV DNA in MCC patients ranged from 71.4% to 100% among the 4 centers in the central area of Japan, suggesting a high prevalence of MCPyV in Japanese patients with MCC. To examine whether the presence of MCPyV DNA is specific to MCC tumors, we analyzed FFPE samples from BCC or SCC tumors containing more than 70% tumor tissue. Ten BCC and 11 SCC (including a metastasized lymph node) samples were randomly selected, and PCR analysis was performed using LT3 primers, but no fragment was amplified in any of the BCC or SCC tumor samples (data not shown). Thus, MCPyV DNA was detected exclusively in MCC tumors in our system. Next, we tried to detect MCPyV DNA by PCR using DNA extracted from frozen tissue samples of MCC tumors (GU7 and NU3). Both LT3 and VP1 fragments were amplified in the frozen tissue samples as well as in the FFPE NU3 samples. However, the LT3 fragment was detected only in the frozen tissue samples, but not in the FFPE GU7 samples (Table 2). Thus, the detection of MCPyV DNA by PCR may, to some extent, depend on certain parameters such as tissue fixation, methods of DNA extraction, the amount of available tissue, and storage conditions, as reported previously [31].
NCC
NU
5, 6, 7 3, 4, 7, 8, 10 1, 3 2 1 6
SMU
1 2, 3, 4, 5
nucleotide positions (according to the MCPyV reference sequence, GenBank: NC_010277.1) were found, and had no effect on the amino acid composition of VP1. The sequence showed 100% homology to another Japanese isolate, TKS (GenBank: FJ464337) [23] and an Asian isolate 16b (GenBank: HM011548) [32], and close homology (99%) to the MCPyV reference sequence. On the other hand, as shown in Table 3, LT3 fragments harbored 4 patterns of mutations (JPMCVst1-4), suggesting that the possibility of contamination of the samples could be excluded. All sequences harbored 2 nucleotide gaps at positions 774 and 775 according to the reference sequence. Three strains (except JPMCVst2) had a point mutation at the 843 nucleotide position (G to C substitution). JPMCVst3 had another site deletion at the 830 nucleotide position, while JPMCVst4 had another point mutation at the 852 nucleotide position (C to T substitution). JPMCVst1 showed 100% homology to other Japanese isolates, SCC-JK [33] and TKS [23]. All of the mutations and deletions were located in the intron region of the LT antigen gene. JPMCVst1 was frequently observed in the samples from Gunma and Niigata, while JPMCVst3 was frequently observed in the samples from Saitama (Table 3). 3.4. Phylogenetic analysis of a Japanese MCPyV strain We next sequenced the second exon of the LT antigen gene harboring multiple mutations [11] using DNA extracted from the frozen tissue sample (NU3) by the method described by Laude et al. [30]. Four overlapping fragments of the LT antigenencoding gene, which covered the whole second exon of the LT antigen (base pair numbers 861–3080 according to the reference sequence), can be amplified; however, we could detect only one fragment encompassing part of the LT3 region (base pair numbers 727–1345) (data not shown). Sequence analysis of the fragment demonstrated a novel point mutation at the 1262 nucleotide position, which is located in the region encoding the
3.2. Relative viral load in MCC tumors The relative viral DNA load was examined by real-time PCR among the 5 and 7 MCPyV-positive cases from Gunma University and Niigata Cancer Center, respectively. As shown in Table 2, the relative viral load was highest in GU2, followed by GU5, GU6, GU3, and GU4 among the samples from Gunma University. Likewise, NCC6 showed the highest viral load, followed by NCC4, NCC10, NCC7, NCC8, NCC3, and NCC9 among the samples from Niigata Cancer Center. 3.3. Sequencing analysis of the PCR products To confirm that the PCR-amplified products contain MCPyVspecific DNA, the purified PCR products (18 LT3 and 12 VP1 fragments) were subjected to sequencing analysis. In all VP1 fragments, 3-point mutations at the 3825, 3831, and 3873
Fig. 1. Phylogenetic tree generated with the neighbor-joining method on 13 sequences of Merkel cell polyomavirus (MCPyV) genome. The MCPyV strains were categorized into 2 main clades, Asian and Caucasian, according to the proposal by Martel-Jantin et al. [34]. The new sequence generated in this study (NU3) is in bold.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
5
Fig. 2. Detection of Merkel cell polyomavirus large T antigen using CM2B4 by immunohistochemistry. (A) Merkel cell carcinoma samples stained by CM2B4 were classified into 4 groups: (+++) strongly positive; (++) positive; (+) weakly positive; and (–) negative. Representative cases (GU7, GU5, GU1, and GU3) are shown with control IgG-stained slides, hematoxylin and eosin (HE)-stained slides, and the clinical features. Original magnifications are 400-fold in the CM2B4- and IgG-stained slides and 100-fold in HEstained slides. (B) Small cells with hyperchromatic nuclei showing positive staining for CM2B4 in SMU2 (left), but negative staining in NU1 (right), even though intermediatetype tumor cells are positive for CM2B4 in both cases. Control IgG- and HE-stained slides are also shown. Original magnification is 400-fold.
Rb-binding motif, but it did not affect the amino acid composition. Any stop codons were deduced from the sequence. Using the partial sequence of NU3 encompassing JPMCVst1 (758 bp in length) and 12 other MCPyV strains available in GenBank, a phylogenetic study using the NJ method was performed. As shown in Fig. 1, the analysis indicated the presence of 2 main clades, Caucasian and Asian, as described by Martel-Jantin et al. [34]. The NU3 strain belonged to the Asian
clade, and was the most closely related to the other Japanese isolates, TKS [23] and SCC-JK [33]. 3.5. Histological classification and detection of MCPyV LT antigen by immunohistochemistry According to the arrangement and appearance of tumor cells, MCC is classified into 3 histological subtypes: intermediate, small
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 6
T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
Fig. 3. Immunodetection of Merkel cell polyomavirus large T antigen in non-Merkel cell carcinoma tumors. Basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) samples were stained with either CM2B4 or control IgG. Original magnification is 400-fold.
cell, and trabecular [2–4]. Of the 26 MCC cases, 21 were classified as intermediate and 5 as trabecular (Table 2 and Fig. 2A). Small cells with hyperchromatic nuclei were mixed with the intermediate type in 11 of 21 cases and the trabecular type in 2 of 5 cases (Table 2). We next performed immunohistochemistry using a monoclonal antibody (CM2B4) against the epitope in exon 2 of the LT antigen [35]. Of the 30 samples from 26 cases with MCC (24 primary cutaneous lesions, 4 metastasized lymph nodes, and 1 each recurrent skin tumor and metastasized cutaneous lesion), CM2B4-stained tumor cells were observed diffusely and strongly in 6 samples (+++; strongly positive), significantly but partly in 10 samples (++; positive) and weakly in 6 samples (+; weakly positive) with nuclear staining, but showed no staining in 8 samples (Table 2). In total, 20 of the 26 MCC cases (76.9%) expressed MCPyV LT antigen. No signals were detected in control sections treated with normal mouse IgG instead of CM2B4. The samples that were strongly positive for CM2B4 did not correspond to those with a higher viral load (Table 2). Three of 5 trabeculartype lesions showed negative staining, whereas the staining pattern varied among the intermediate-type tumors (Fig. 2A and Table 2). Small cells with hyperchromatic nuclei showed nuclear immunoreactivity for CM2B4, as well as the cells with large lobular nuclei and scant, pale-stained cytoplasm (5 samples); small cells showed no staining in the other 7 samples (Fig. 2B and Table 2). Four lesions (cases GU2, GU7, NCC1, and NCC2) expressed the viral LT antigen, in which viral DNA was not detected by PCR analysis using DNA extracted from FFPE samples (Table 2). BCC and SCC samples were also stained by CM2B4. Four (80%) of the 5 BCC tumors and 2 (40%) of the 5 SCC tumors showed weak, but significant nuclear immunoreactivity (Fig. 3), although MCPyV DNA was not detected from the identical FFPE tissue blocks by PCR. 3.6. CM2B4 positivity in the cells around the skin carcinomas As shown in Fig. 4A, the significant positive signals for CM2B4 were found in the cells around some of the MCC and non-MCC samples to varying degrees, even when the tumor cells were negative for CM2B4. The signal was completely negative in samples treated with control IgG as a primary antibody. No signals were observed in other cell types such as epithelial cells or
endothelial cells in the skin. The distribution of the CM2B4positive cells around the tumors corresponded to those of CD45RO- and CD8-positive lymphocytes and partly to that of CD20-positive lymphocytes (Fig. 4A), suggesting some of these cells might express LT antigen. To examine whether hematopoietic cells may harbor the virus as a reservoir [30,36], we extracted genomic DNA from whole blood from 2 patients with MCC and 19 healthy volunteers and examined the presence of MCPyV DNA by PCR; however, the LT3 fragment was not amplified in any of the samples (Fig. 4B). 4. Discussion In the present study, we confirmed the high prevalence of MCPyV DNA in Japanese patients with MCC. Viral DNA was detected in 23 of 26 patients (88.5%) by PCR, and the prevalence rate was comparable to those reported from Europe, the USA, and Japan [7,13,15,16,18,19,24,25]. The positive rate of the viral DNA was comparably high, ranging from 80% to 100%, among the 4 medical centers located in an approximately 38,400-km2 area of Japan. The phylogenetic analysis demonstrated that one of our strains was closely related to the other Japanese isolates, suggesting that the MCPyV strains in Japan may be genetically conserved. The recent description of MCPyV by Feng et al. [7] has been followed by multiple studies that have supported the notion of a strong epidemiologic link between MCPyV and MCC. Most of the studies have shown a prevalence of MCPyV between 75% and 90% of European and North American MCC patients, while Garneski et al. reported that the virus is less frequently present (per PCR analysis) in Australian MCC patients (5/21, 24%) [20]. This was supported by the finding that only 19 (18.3%) of 104 cases of Australian MCC showed positive staining for MCPyV by immunohistochemistry [21]. These studies support the concept that MCPyV is less frequently associated with MCC arising in a sunexposed, predominantly fair-skinned population, presumably because sun exposure may more strongly drive MCC through an alternative pathway than virus-driven oncogenesis. In contrast to these studies, Schrama et al. demonstrated MCPyV DNA was present in 33 (86%) of the 38 Australian MCC patients by both a PCR-based method and immunohistochemical-LT protein
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
7
Fig. 4. (A) Immunoreactivity for CM2B4 in the cells around the Merkel cell carcinoma (MCC), basal cell carcinoma (BCC) and squamous cell carcinoma (SCC) tumors. The sections were also stained with CD20, CD45RO, CD4, CD8, or control IgG. GU7 and NCC8 were selected as the representatives of CM2B4-positive and -negative MCC tumors, respectively. T = tumor; original magnification is 200-fold. (B) Merkel cell polyomavirus DNA detection in whole blood from healthy volunteers (Ctl) and MCC patients by polymerase chain reaction. LT3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were amplified using gene-specific primers and visualized by ethidium bromidestained agarose gel electrophoresis. FFPE, formalin-fixed paraffin-embedded tissue.
detection [22]. This group concluded the difference between the studies can neither be explained by the geographical issues from which the samples were obtained nor the type of MCC tumors [22]. In an earlier report in Japan, the prevalence of MCPyV had been thought to be relatively low (55%) [23], but subsequent reports showed MCPyV DNA was found in 77% to 100% of Japanese MCC cases [1,24–26], which is comparable to those from Europe, the USA, and Australia. The present multi-center study supports the
results that MCPyV may be highly prevalent on a worldwide level, whereas the incidence rates of MCC varied among the countries (e.g. 0.15, 0.44, and 0.82 per 100,000 in Japan, the USA, and Western Australia, respectively) [25,37,38]. Immunohistochemical analyses for the detection of MCPyV LT protein expression are frequently performed since a monoclonal antibody became commercially available. The antibody (CM2B4) was developed by the research team that found MCPyV using a
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 8
T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx
recombinant peptide fragment unique to MCPyV LT antigen [35]. The detection rates of the viral T antigen in MCC by immunohistochemistry are relatively lower, ranging from 58% to 75% [14,35,39,40] compared to those measured by PCR. Ota et al. suggested that the discrepancies between the PCR and immunohistochemistry results can be explained by the absolute viral copy number per human genome in MCPyV-infected tumor tissue [26]. In the present study, the detection rate of MCPyV by immunohistochemistry was lower than that by PCR (76.9% vs 88.5%), but even MCPyV-DNA-negative tumors were positive for MCPyV LT protein expression and the relative viral DNA load was not correlated with LT protein expression level. The conflicting results may be either due to insufficient specificity of the antibody or low efficiency in the PCR analysis. Indeed, Kuwamoto et al. showed that CM2B4 detected MCPyV with 95% sensitivity and 83% specificity in MCC compared with PCR [1,24]. On the other hand, formalin fixation of tissues is a well-known cause of DNA degradation leading to lowquality DNA in the PCR analysis [16]. Thus, MCPyV is strongly associated with MCC by both conventional PCR and immunohistochemical analyses, but there is a discrepancy in the results between the 2 methods. BCC and SCC are skin cancers that often develop on the sunexposed skin of elderly people. In previous reports, the detection rate of MCPyV DNA ranged from 0% to 14% in BCC [13,26,41–43] and from 0% to 26.9% in SCC [43–46]. MCPyV LT expression has rarely been detected in these skin tumors except for 1 BCC [26] and 2 SCC cases [43], which were also positive for viral DNA. In the present study, significant, but low, nuclear immunoreactivity was observed in 80% and 40% of cases of BCC and SCC, respectively, in spite of the negative results in the PCR analysis. In line with this, CM2B4 cannot be suitable as a diagnostic tool to differentiate MCC from other skin tumors [1]. As with some of other human polyomaviruses, the possibility that lymphocytes may serve as a tissue reservoir for MCPyV infection has been raised [35]. Furthermore, Mertz et al. demonstrated that MCPyV persists in inflammatory monocytes (CD14+CD16), but not resident monocytes (CD14loCD16+) [36]. This suggests that MCPyV might spread along the migration routes of inflammatory monocytes. Interestingly, we found that CM2B4positive cells were present around skin tumors with distribution similar to CD20-, CD45RO-, or CD8-positive lymphocytes. Though CM2B4-positive cells were also observed around the BCC and SCC tumors, truncation of LT antigen by the mutations specific for MCC may be involved in carcinogenesis of the tumor [11]. The possibility of cross-reactivity by CM2B4 could not be excluded, although human polyomaviruses newly discovered in succession after the discovery of MCPyV did not harbor the epitope sequence of CM2B4 [10,32,47,48]. Different antibodies against MCPyV LT antigen should be helpful to clarify the cross-reactivity or pseudopositivity [49,50]. On the other hand, previous reports showed that MCPyV DNA was detected in PBMC samples from 15 of 30 (50%) MCC patients and was associated with poorer outcome [30], while the other 2 studies did not detect MCPyV in a cohort of 40 or 45 healthy blood donors [15,17]. These results are consistent with our observation. Although MCPyV does not seem to persist frequently in PBMCs, a certain cell type infiltrating around MCC might act as a reservoir for MCPyV. In the present study, there was no association between the presence of MCPyV and histological types of MCC or tumor-cell morphology, except that trabecular-type MCC tumors may have a tendency to express less LT antigen protein. Previously, Katano et al. pointed out that MCPyV-positive MCCs were morphologically typical with round and vesicular nuclei, whereas MCPyV-negative MCCs showed various morphologies such as polygonal nuclei and some light cytoplasm [23]. A subsequent morphometric study has demonstrated MCPyV-negative MCCs have more irregularly
shaped nuclei and more abundant cytoplasm than MCPyV-positive MCCs [1,24,51]; however, it is hard to distinguish virus-positive cells from virus-negative cells with light microscopic examination only. The finding that cell morphology and growth phenotype of MCC cell lines did not reflect the presence of MCPyV supports the results of this study [52]. In conclusion, we demonstrated the high prevalence of MCPyV in Japanese MCC patients. However, it is of note that the actual frequency of the viral infection in MCC and other skin cancers remains unclear because the detection rate is varied depending on the method. Further characterization of the association between MCPyV and MCC and/or other skin cancers is needed for better understanding of the methods for viral detection. Funding sources None. References [1] Kuwamoto S. Recent advances in the biology of Merkel cell carcinoma. Hum Pathol 2011;42:1063–77. [2] Jaeger T, Ring J, Andres C. Histological, immunohistological, and clinical features of merkel cell carcinoma in correlation to merkel cell polyomavirus status. J Skin Cancer 2012;2012:983421. [3] Nicolaidou E, Mikrova A, Antoniou C, Katsambas AD. Advances in Merkel cell carcinoma pathogenesis and management: a recently discovered virus, a new international consensus staging system and new diagnostic codes. Br J Dermatol 2012;166:16–21. [4] Schrama D, Becker JC. Merkel cell carcinoma–pathogenesis, clinical aspects and treatment. J Eur Acad Dermatol Venereol 2011;25:1121–9. [5] Bhatia S, Afanasiev O, Nghiem P. Immunobiology of Merkel cell carcinoma: implications for immunotherapy of a polyomavirus-associated cancer. Curr Oncol Rep 2011;13:488–97. [6] Wang TS, Byrne PJ, Jacobs LK, Taube JM. Merkel cell carcinoma: update and review. Semin Cutan Med Surg 2011;30:48–56. [7] Feng H, Shuda M, Chang Y, Moore PS. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 2008;319:1096–100. [8] Arron ST, Jennings L, Nindl I, Rosl F, Bouwes Bavinck JN, Seckin D, et al. Viral oncogenesis and its role in nonmelanoma skin cancer. Br J Dermatol 2011;164: 1201–13. [9] Houben R, Schrama D, Becker JC. Molecular pathogenesis of Merkel cell carcinoma. Exp Dermatol 2009;18:193–8. [10] Van Ghelue M, Khan MT, Ehlers B, Moens U. Genome analysis of the new human polyomaviruses. Rev Med Virol 2012;22:354–77. [11] Shuda M, Feng H, Kwun HJ, Rosen ST, Gjoerup O, Moore PS, et al. T antigen mutations are a human tumor-specific signature for Merkel cell polyomavirus. Proc Natl Acad Sci U S A 2008;105:16272–77. [12] Shuda M, Kwun HJ, Feng H, Chang Y, Moore PS. Human Merkel cell polyomavirus small T antigen is an oncoprotein targeting the 4E-BP1 translation regulator. J Clin Invest 2011;121:3623–34. [13] Becker JC, Houben R, Ugurel S, Trefzer U, Pfohler C, Schrama D. MC polyomavirus is frequently present in Merkel cell carcinoma of European patients. J Invest Dermatol 2009;129:248–50. [14] Busam KJ, Jungbluth AA, Rekthman N, Coit D, Pulitzer M, Bini J, et al. Merkel cell polyomavirus expression in merkel cell carcinomas and its absence in combined tumors and pulmonary neuroendocrine carcinomas. Am J Surg Pathol 2009;33:1378–85. [15] Kassem A, Schopflin A, Diaz C, Weyers W, Stickeler E, Werner M, et al. Frequent detection of Merkel cell polyomavirus in human Merkel cell carcinomas and identification of a unique deletion in the VP1 gene. Cancer Res 2008;68: 5009–13. [16] Foulongne V, Dereure O, Kluger N, Moles JP, Guillot B, Segondy M. Merkel cell polyomavirus DNA detection in lesional and nonlesional skin from patients with Merkel cell carcinoma or other skin diseases. Br J Dermatol 2010;162: 59–63. [17] Duncavage EJ, Zehnbauer BA, Pfeifer JD. Prevalence of Merkel cell polyomavirus in Merkel cell carcinoma. Mod Pathol 2009;22:516–21. [18] Sihto H, Kukko H, Koljonen V, Sankila R, Bohling T, Joensuu H. Clinical factors associated with Merkel cell polyomavirus infection in Merkel cell carcinoma. J Natl Cancer Inst 2009;101:938–45. [19] Varga E, Kiss M, Szabo K, Kemeny L. Detection of Merkel cell polyomavirus DNA in Merkel cell carcinomas. Br J Dermatol 2009;161:930–2. [20] Garneski KM, Warcola AH, Feng Q, Kiviat NB, Leonard JH, Nghiem P. Merkel cell polyomavirus is more frequently present in North American than Australian Merkel cell carcinoma tumors. J Invest Dermatol 2009;129:246–8. [21] Paik JY, Hall G, Clarkson A, Lee L, Toon C, Colebatch A, et al. Immunohistochemistry for Merkel cell polyomavirus is highly specific but not sensitive for the diagnosis of Merkel cell carcinoma in the Australian population. Hum Pathol 2011;42:1385–90.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010
G Model
DESC-2490; No. of Pages 9 T. Hattori et al. / Journal of Dermatological Science xxx (2013) xxx–xxx [22] Schrama D, Peitsch WK, Zapatka M, Kneitz H, Houben R, Eib S, et al. Merkel cell polyomavirus status is not associated with clinical course of Merkel cell carcinoma. J Invest Dermatol 2011;131:1631–8. [23] Katano H, Ito H, Suzuki Y, Nakamura T, Sato Y, Tsuji T, et al. Detection of Merkel cell polyomavirus in Merkel cell carcinoma and Kaposi’s sarcoma. J Med Virol 2009;81:1951–8. [24] Kuwamoto S, Higaki H, Kanai K, Iwasaki T, Sano H, Nagata K, et al. Association of Merkel cell polyomavirus infection with morphologic differences in Merkel cell carcinoma. Hum Pathol 2011;42:632–40. [25] Nakajima H, Takaishi M, Yamamoto M, Kamijima R, Kodama H, Tarutani M, et al. Screening of the specific polyoma virus as diagnostic and prognostic tools for Merkel cell carcinoma. J Dermatol Sci 2009;56:211–3. [26] Ota S, Ishikawa S, Takazawa Y, Goto A, Fujii T, Ohashi K, et al. Quantitative analysis of viral load per haploid genome revealed the different biological features of merkel cell polyomavirus infection in skin tumor. PLoS ONE 2012;7:e39954. [27] Jung HS, Choi YL, Choi JS, Roh JH, Pyon JK, Woo KJ, et al. Detection of Merkel cell polyomavirus in Merkel cell carcinomas and small cell carcinomas by PCR and immunohistochemistry. Histol Histopathol 2011;26:1231–41. [28] Hattori T, Stawski L, Nakerakanti SS, Trojanowska M. Fli1 is a negative regulator of estrogen receptor alpha in dermal fibroblasts. J Invest Dermatol 2011;131:1469–76. [29] Sastre-Garau X, Peter M, Avril MF, Laude H, Couturier J, Rozenberg F, et al. Merkel cell carcinoma of the skin: pathological and molecular evidence for a causative role of MCV in oncogenesis. J Pathol 2009;218:48–56. [30] Laude HC, Jonchere B, Maubec E, Carlotti A, Marinho E, Couturaud B, et al. Distinct merkel cell polyomavirus molecular features in tumour and nontumour specimens from patients with merkel cell carcinoma. PLoS Pathog 2010;6:e1001076. [31] Duncavage EJ, Le BM, Wang D, Pfeifer JD. Merkel cell polyomavirus: a specific marker for Merkel cell carcinoma in histologically similar tumors. Am J Surg Pathol 2009;33:1771–7. [32] Schowalter RM, Pastrana DV, Pumphrey KA, Moyer AL, Buck CB. Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe 2010;7:509–15. [33] Imajoh M, Hashia Y, Taniguchi A, Kamioka M, Daibata M. Novel human polyomaviruses Merkel cell polyomavirus and human polyomavirus 9, in Japanese chronic lymphocytic leukemia cases. J Hematol Oncol 2012;5:25. [34] Martel-Jantin C, Filippone C, Cassar O, Peter M, Tomasic G, Vielh P, et al. Genetic variability and integration of Merkel cell polyomavirus in Merkel cell carcinoma. Virology 2012;426:134–42. [35] Shuda M, Arora R, Kwun HJ, Feng H, Sarid R, Fernandez-Figueras MT, et al. Human Merkel cell polyomavirus infection I.MCVT. antigen expression in Merkel cell carcinoma, lymphoid tissues and lymphoid tumors. Int J Cancer 2009;125:1243–9. [36] Mertz KD, Junt T, Schmid M, Pfaltz M, Kempf W. Inflammatory monocytes are a reservoir for Merkel cell polyomavirus. J Invest Dermatol 2010;130:1146–51. [37] Hodgson NC. Merkel cell carcinoma: changing incidence trends. J Surg Oncol 2005;89:1–4.
9
[38] Girschik J, Thorn K, Beer TW, Heenan PJ, Fritschi L. Merkel cell carcinoma in Western Australia: a population-based study of incidence and survival. Br J Dermatol 2011;165:1051–7. [39] Ly TY, Walsh NM, Pasternak S. The spectrum of Merkel cell polyomavirus expression in Merkel cell carcinoma, in a variety of cutaneous neoplasms, and in neuroendocrine carcinomas from different anatomical sites. Hum Pathol 2012;43:557–66. [40] Reisinger DM, Shiffer JD, Cognetta Jr AB, Chang Y, Moore PS. Lack of evidence for basal or squamous cell carcinoma infection with Merkel cell polyomavirus in immunocompetent patients with Merkel cell carcinoma. J Am Acad Dermatol 2010;63:400–3. [41] Andres C, Belloni B, Puchta U, Sander CA, Flaig MJ. Prevalence of MCPyV in Merkel cell carcinoma and non-MCC tumors. J Cutan Pathol 2010;37:28–34. [42] Wieland U, Mauch C, Kreuter A, Krieg T, Pfister H. Merkel cell polyomavirus DNA in persons without merkel cell carcinoma. Emerg Infect Dis 2009;15: 1496–8. [43] Murakami M, Imajoh M, Ikawa T, Nakajima H, Kamioka M, Nemoto Y, et al. Presence of Merkel cell polyomavirus in Japanese cutaneous squamous cell carcinoma. J Clin Virol 2011;50:37–41. [44] Ridd K, Yu S, Bastian BC. The presence of polyomavirus in non-melanoma skin cancer in organ transplant recipients is rare. J Invest Dermatol 2009;129: 250–2. [45] Wieland U, Scola N, Stolte B, Stucker M, Silling S, Kreuter A. No evidence for a causal role of Merkel cell polyomavirus in keratoacanthoma. J Am Acad Dermatol 2012;67:41–6. [46] Dworkin AM, Tseng SY, Allain DC, Iwenofu OH, Peters SB, Toland AE. Merkel cell polyomavirus in cutaneous squamous cell carcinoma of immunocompetent individuals. J Invest Dermatol 2009;129:2868–74. [47] van der Meijden E, Janssens RW, Lauber C, Bouwes Bavinck JN, Gorbalenya AE, Feltkamp MC. Discovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog 2010;6:e1001024. [48] Scuda N, Hofmann J, Calvignac-Spencer S, Ruprecht K, Liman P, Kuhn J, et al. A novel human polyomavirus closely related to the african green monkeyderived lymphotropic polyomavirus. J Virol 2011;85:4586–90. [49] Nakamura T, Sato Y, Watanabe D, Ito H, Shimonohara N, Tsuji T, et al. Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma. Virology 2010;398:273–9. [50] Rodig SJ, Cheng J, Wardzala J, DoRosario A, Scanlon JJ, Laga AC, et al. Improved detection suggests all Merkel cell carcinomas harbor Merkel polyomavirus. J Clin Invest 2012;122:4645–53. [51] Higaki-Mori H, Kuwamoto S, Iwasaki T, Kato M, Murakami I, Nagata K, et al. Association of Merkel cell polyomavirus infection with clinicopathological differences in Merkel cell carcinoma. Hum Pathol 2012;43:2282–91. [52] Fischer N, Brandner J, Fuchs F, Moll I, Grundhoff A. Detection of Merkel cell polyomavirus (MCPyV) in Merkel cell carcinoma cell lines: cell morphology and growth phenotype do not reflect presence of the virus. Int J Cancer 2010;126:2133–42.
Please cite this article in press as: Hattori T, et al. The prevalence of Merkel cell polyomavirus in Japanese patients with Merkel cell carcinoma. J Dermatol Sci (2013), http://dx.doi.org/10.1016/j.jdermsci.2013.02.010