- Email: [email protected]
The prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in Ahvaz, southwestern Iran
Gene Reports 16 (2019) 100415
Contents lists available at ScienceDirect
Gene Reports journal homepage: www.elsevier.com/locate/genrep
The prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in Ahvaz, southwestern Iran
T
⁎
Ahmad Farajzadeh Sheikh, Hajar Hamidi , Mojtaba Shahin, Saeed Shahmohammadi Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
A R T I C LE I N FO
A B S T R A C T
Keywords: Enterococci Glycopeptide Antibiotic resistance vanA gene
Background: Enterococci are one the most important etiology of nosocomial infections which have a major role in spreading and persistence of drug resistance genes in hospitals. This study aimed to investigate the prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in southwestern Iran. Methods: 120 non-repetitive clinical isolates of enterococci during 2015–2016 from educational hospitals of Ahvaz city in southwestern Iran were collected. Enterococcus spp. identified by standard microbiological methods. Antibiotic susceptibility pattern was determined using disk diffusion method. The presence of glycopeptides resistance genes was determined by Multiplex-PCR method. Results: By biochemical tests, 73 (60.8%) isolates were Enterococcus faecium followed by 15 (12.5%) Enterococcus faecalis, 3 (2.5%) Enterococcus durans, 2 (1.7%) Enterococcus gallinarum, and 27 (22.5%) other species of enterococci. In overall, 31 enterococci isolates were found to be vancomycin-resistant and 16 isolates of which were resistant to teicoplanin. Moreover, 16 isolates showed resistant to both vancomycin and teicoplanin. In overall, vanA gene was presented in 29 (24.1%) isolates, of which 24 (32.8%) were identified as E. faecium, 1 (6.6%) as E. faecalis, 1 (6.6%) as E. gallinarum, and 3 (11.1%) as other Enterococcus spp. Moreover, 2 isolates had vanC gene; both of these were identified as E. gallinarum. Conclusions: In summary, we evaluated the enterococci from various infections, and resistance to vancomycin was observed in 26% of the studied isolates and vanA gene was found in 24.1% of the isolates.
1. Introduction
critical ill patients such as patients with end-stage renal disease are at advanced risk of colonization and then more treatment cost and complication (Roghmann et al., 1998; Hemmati et al., 2011). The glycopeptide act by inhibition of peptidoglycan synthesis. Glycopeptides binding to the D-alanyl-D-alanine (D-Ala–D-Ala) terminus of intermediates in peptidoglycan formation and inhibiting cell wall crosslinking (Sujatha and Praharaj, 2012). However, the emergence and dissemination of glycopeptide-resistant enterococci (GRE) in the last decades become a global public health concern (Uttley, 1988; Leclercq et al., 1988). Based on DNA sequences and organization, glycopeptide resistance has been categorized into several types in enterococci. They are designated according to the name of the ligase gene, which encodes either a D-Ala-D-Lac (vanA, vanB, vanD, and vanM) or a D-Ala-D-Ser (vanC, vanE, vanG, vanL, and vanN) ligase for the synthesis of peptidoglycan precursors with low affinity for glycopeptides (Sujatha and Praharaj, 2012; Xu et al., 2010; Lebreton et al., 2011; Boyd et al.,
Enterococci are Gram-positive bacteria that are gut commensal bacteria of both human and animal. Under certain circumstances, they may cause serious infections, including urinary tract infection (UTI), bacteremia, peritonitis, endocarditis, meningitis and wound infections (Heintz et al., 2010; Miller et al., 2016; Nichol et al., 2006). Enterococci are one the most important etiology of nosocomial infections which have a major role in spreading and persistence of drug resistance genes in hospitals (Heintz et al., 2010; Ghassabi et al., 2017). The glycopeptide antibiotics including vancomycin and teicoplanin are regarded to be the last resort for treating a variety of serious infections caused by Gram-positive bacteria, particularly enterococci (Méndez-Álvarez et al., 2000; Ghasabi et al., 2017). The emergence and limited therapeutic choices of vancomycin-resistant enterococci (VRE) have become an important clinical and epidemiological concern since
Abbreviations: CLSI, Clinical and Laboratory Standards Institute; D-Ala–D-Ala, D-alanyl-D-alanine; GRE, glycopeptide-resistant enterococci; PYR, Pyrrolidonyl Aminopeptidase; PCR, polymerase chain reaction ⁎ Corresponding author. E-mail address: [email protected] (H. Hamidi). https://doi.org/10.1016/j.genrep.2019.100415 Received 31 March 2019; Received in revised form 30 April 2019; Accepted 7 May 2019 Available online 08 May 2019 2452-0144/ © 2019 Elsevier Inc. All rights reserved.
Gene Reports 16 (2019) 100415
A.F. Sheikh, et al.
2008). VanA-type resistance is characterized by high-level resistance to both vancomycin and teicoplanin, whereas VanB-type isolates are resistant to variable levels of vancomycin but susceptible to teicoplanin. VanD-type strains are resistance to moderate levels of vancomycin and teicoplanin. VanC, VanE and VanG strains are low-level resistant to vancomycin (Méndez-Álvarez et al., 2000). Regard to rapid dissemination of glycopeptides resistance, rapid and accurate identification of GRE colonized patients is essential to prevent the spread of resistant-strains in hospital environments. The aim of this study was to investigate the prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in Ahvaz, southwestern Iran.
Table 2 Distribution of enterococci isolates in different wards of studied hospitals.
2. Methods and materials
Ward
No
%
Outpatients Urology Nephrology Children Emergency Neonatal Internal Intensive care units Neurology Maternity Gastroenterology Lung Transplantation Infectious
69 10 9 8 7 5 3 3 1 1 1 1 1 1
57.5 8.4 7.5 6.7 5.9 4.2 2.5 2.5 0.8 0.8 0.8 0.8 0.8 0.8
2.1. Study design and bacterial isolates at 56 °C, and 45 s at 72 °C, with 5 min at 72 °C for the final extension. Positive controls for PCR were Enterococcus faecium ATCC 51559 (vanA), Enterococcus faecalis ATCC 51299 (vanB) and Enterococcus gallinarum BM14174 (vanC). Negative controls consisted of the PCR components of the reaction mixtures lacking enterococci DNA. DNA fragments were analyzed by electrophoresis in 0.5 × Tris-borate-EDTA on a 1% agarose gel stained with ethidium bromide.
120 non-repetitive clinical isolates of enterococci during 2015–2016 from educational hospitals of Ahvaz city in southwestern Iran were collected. Enterococcus spp. identified by standard microbiological methods, including Gram's stain, colony morphology, catalase test, bile esculin test, growth in 6.5% NaCl and PYR (Pyrrolidonyl Aminopeptidase) test. All the isolates were specified at the species level by biochemical tests consists of mannitol, sorbose, arabinose, lactose and sucrose fermentation, motility test, pigment production and Voges–Proskauer test (Facklam and Collins, 1989).
3. Results
2.2. Antimicrobial susceptibility testing
Out of 120 enterococci, 77 (64.2%) isolates were from female and 43 (35.8%) isolates from male patients. Most of the isolates were also recovered from urine samples (92%), followed by wound (3%), blood (3%), and ascites fluid specimens (1%). Out of 120 isolates, 69 (57.5%) isolates were obtained from outpatient department (OPD) followed by urology ward 10 (8.3%) (Table 2). By biochemical tests, 73 (60.8%) isolates were E. faecium followed by 15 (12.5%) E. faecalis, 3 (2.5%) E. durans, 2 (1.7%) E. gallinarum, and 27 (22.5%) other species of enterococci. In overall, 31 enterococci isolates were found to be vancomycin-resistant by disk diffusion and vancomycin screening test and 16 isolates of which were resistant to teicoplanin. Moreover, 16 isolates showed resistant to both vancomycin and teicoplanin. The full results of antibiotic susceptibility pattern of tested isolates are presented in Table 3. PCR for detecting glycopeptid resistance genes was done for all isolates (Fig. 1). In overall, vanA gene was presented in 29 (24.1%) isolates, of which 24 (32.8%) were identified as E. faecium, 1 (6.6%) as E. faecalis, 1 (6.6%) as E. gallinarum, and 3 (11.1%) as other Enterococcus spp. Moreover, 2 isolates had vanC gene; both of these were identified as E. gallinarum. Meanwhile, vanB, vanD, vanE and vanG genes were not found in any isolates. Nineteen of 29 isolates that contained vanA gene were resistant to vancomycin, while 15 isolates of them were resistant to teicoplanin. Also, one of the vanC contained isolates was resistant to the both vancomycin and teicoplanin.
Antibiotic susceptibility pattern of isolates was determined using disk diffusion method on Mueller-Hinton agar according to Clinical and Laboratory Standards Institute (CLSI) guidelines toward vancomycin (30 μg), teicoplanin (30 μg), nitrofurantoin (300 μg), linezolid (30 μg), fosfomycin (200 μg) and gentamicin (30 μg). In addition, all strains were examined by vancomycin screening agar test (Sujatha and Praharaj, 2012). Staphylococcus aureus ATCC 25923 was used as the standard strain for antibiotic susceptibility testing. 2.3. DNA extraction and multiplex PCR Genomic DNA was extracted from freshly grown colonies using boiling method (Sharifi et al., 2012). Multiplex polymerase chain reaction (PCR) reaction mixtures were prepared under laminar flow under strict precautions to prevent cross-contamination. The list of primer sequences are shown in Table 1 (Depardieu et al., 2004a). Amplification was performed in a final volume of 50 μl volume as previously described (Lebreton et al., 2011). Amplification was carried out with the following thermal cycling profile: initial denaturation for 4 min at 94 °C, 35 cycles of amplification consisting of 45 s at 94 °C, 45 s Table 1 List of used primers in this study. Primer
Sequence (5′ → 3′)
Gene
Size of PCR product (bp)
VanA-F VanA-R VanB-F VanB-R VanC-F VanC-R VanD-F VanD-R VanE-F VanE-R VanG-F VanG-R
GGGAAAACGACAATTGC GTACAATGCGGCCGTTA ACGGAATGGGAAGCCGA TGCACCCGATTTCGTTC ATGGATTGGTACTGGTAT TAGCGGGAGTGACCAGTAA TGTGGGATGCGATATTCAA TGCAGCCAAGTATCCGGTAA TGTGGTATCGGAGCTGCAG ATAGTTTAGCTGGTAAC CGGCATCCGCTGTTTTTGA GAACGATAGACCAATGCCTT
vanA
732
vanB
647
vanC
815/827
vanD
500
vanE
430
vanG
941
Table 3 Pattern of antibiotics resistance in all Enterococci isolates. Antibiotic
Vancomycin Teicoplanin Nitrofurantoin Linezolid Fosfomycin
2
Susceptible no. (%) 60 (50) 93 (77.5) 99 (82.5) 39 (32.5) 108 (90)
Intermediate- resistant no. (%) 29 (24) 11 (9.2) 9 (7.5) 26 (21.7) 9 (7.5)
Resistant no. (%) 31 (26) 16 (13.3) 12 (10) 55 (45.8) 3 (2.5)
Gene Reports 16 (2019) 100415
A.F. Sheikh, et al.
resistance of enterococci to gentamicin is also reported from Kuwait and Turkey (Udo et al., 2004; Kaçmaz and Aksoy, 2005). The Multiplex PCR were performed to detect van genes for all of our enterococci isolates and showed that from 120 isolates, 29 isolates harbored vanA gene and 2 isolates harbor vanC gene. While consistent with our findings the prevalence of vanE (Abadia-Patino et al., 2004), vanD (Depardieu et al., 2004b; Perichon et al., 1997; Perichon et al., 2000), and vanG (Boyd et al., 2006; Depardieu et al., 2003; MezianeCherif et al., 2012) are globally low in enterococci, the present study showed that the possibility of these genes exist in our area is low. In a study in Tehran, the frequency of vanA gene was 12% and vanB was 0% (Emaneini et al., 2008), which is match to our findings. Although it seems that the prevalence of vanB in Iran is low, but in a study in Tehran (Kafil and Asgharzadeh, 2014), 10.2% vanB was reported. The frequency of this gene is likely to be more in the northwest of Iran (Sharifi et al., 2012), but it's not so prevalent in our studied region and also our studied clinical samples.
Fig. 1. Gel electrophoresis for PCR of van genes. Lane: 1, E. faecium ATCC 51559 (vanA); Lane 2, E. faecalis ATCC 51299 (vanB); Lane 3, E. gallinarum BM14174 (vanC); Lane 4, negative control; Lanes 5–10, clinical samples; M, Marker of 100 bp DNA ladder.
5. Conclusion In summary, we evaluated the enterococci isolated from various infections, and resistance to vancomycin was observed in 26% of the studied isolates and vanA gene was found in 24.1% of the isolates. In the end, given that the epidemiology of enterococci in distinct geographical regions is different, knowing endemic prevalence of antibiotics resistance pattern in different health centers, and updating therapeutic policies are essential to limiting colonized patients and controlling the spread of resistant strains in Iranian hospitals.
4. Discussion Today the spread of antibiotic resistance among Enterococcus species has become a new challenge in hospitals. Unfortunately therapeutic failure in enterococci infections is become increasing because of not enough local information about their antibiotic resistance pattern, especially glycopeptide antibiotics. In the present study, 120 isolates of enterococci were identified and studied. In this study the majority of the isolates obtained from urine samples (92.5%), and confirmed that the most common site of enterococci infection is UTI (Barros et al., 2009). From the total isolated enterococci, 60.8% belonged to E. feacium. Previously similar to our findings Nelson et al. (2000), Biendo et al. (2010), and Sharifi et al. (2012), introduced E. faecium as the prevalent species. However, the previous findings of Kafil et al. in Tabriz, Iran (Kafil and Asgharzadeh, 2014), Mirzaee et al. in Tehran, Iran (Mirzaei et al., 2013) and Sreeja et al. in India (Sreeja et al., 2012) indicate to a higher prevalence of E. faecalis compared to our study. The reason for increasing E. faecium prevalence in our study is probably the enhancement of E. faecium resistance to antibiotics, especially glycopeptides. While E. faecalis presumably is more susceptible to antibiotics resistance (Kaveh et al., 2016), so may lead to reduce its prevalence in our study. Moreover despite the low frequency of other enterococci such as E. durans and E. gallinarum, these species play a significant role in nosocomial infections and the isolation of them from different parts of hospitals indicates the infectivity risk of these species (Kaveh et al., 2016). In the present study, the most of glycopeptides-resistant isolates are related to wound and urinary tract infections which are comparable to Kafil et al. study (Kafil and Asgharzadeh, 2014). The E. faecalis isolates lead less resistance to glycopeptide antibiotics in comparison with other species. Also, E. faecalis isolates were completely susceptible to nitrofurantoin, and its resistance percentage to linezolid and fosfomycin were low. In contrast, E. faecium showed higher resistance to glycopeptides (19.2%). In addition the resistance to nitrofurantoin, linezolid, and fosfomycin were high. Meanwhile, in relation to glycopeptides resistance, the present study showed that the resistance of enterococci to vancomycin is higher than teicoplanin. Also, high-level glycopeptide resistance in E. durans and E. gallinarum showed importance of them in clinical samples. The overall prevalence of resistance to glycopeptides (both vancomycin and teicoplanin) in this study was 13.3% which is higher in comparison with Emaneini in Tehran (Emaneini et al., 2008). Moreover the low resistance to nitrofurantoin and fosfomycin antibiotics shows that these antibiotics are proper treatments for enterococci infections in our region, especially resistant strains to glycopeptide antibiotics. High
Funding This study was supported by Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran University of Medical Sciences. Acknowledgements The author would like to thank Dr. Seyed Mojtaba Mousavian and Dr. Mohammad Reza Pourshafie for their help to provide bacterial quality control strains. Consent for publication Not applicable. References Abadia-Patino, L., Christiansen, K., Bell, J., Courvalin, P., Perichon, B., 2004. VanE-type vancomycin-resistant Enterococcus faecalis clinical isolates from Australia. Antimicrob. Agents Chemother. 48, 4882–4885. Barros, M., Martinelli, R., Rocha, H., 2009. Enterococcal urinary tract infections in a university hospital: clinical studies. Braz. J. Infect. Dis. 13, 294–296. Biendo, M., Adjide, C., Castelain, S., Belmekki, M., Rousseau, F., Slama, M., Ganry, O., Schmit, J.L., Eb, F., 2010. Molecular characterization of glycopeptide-resistant enterococci from hospitals of the Picardy region (France). Int J Microbiol 2010, 150464. Boyd, D.A., Du, T., Hizon, R., Kaplen, B., Murphy, T., Tyler, S., Brown, S., Jamieson, F., Weiss, K., Mulvey, M.R., 2006. VanG-type vancomycin-resistant Enterococcus faecalis strains isolated in Canada. Antimicrob. Agents Chemother. 50, 2217–2221. Boyd, D.A., Willey, B.M., Fawcett, D., Gillani, N., Mulvey, M.R., 2008. Molecular characterization of Enterococcus faecalis N06-0364 with low-level vancomycin resistance harboring a novel D-Ala-D-Ser gene cluster, vanL. Antimicrob. Agents Chemother. 52, 2667–2672. Depardieu, F., Bonora, M.G., Reynolds, P.E., Courvalin, P., 2003. The vanG glycopeptide resistance operon from Enterococcus faecalis revisited. Mol. Microbiol. 50, 931–948. Depardieu, F., Perichon, B., Courvalin, P., 2004a. Detection of the van alphabet and identification of enterococci and staphylococci at the species level by multiplex PCR. J. Clin. Microbiol. 42, 5857–5860. Depardieu, F., Kolbert, M., Pruul, H., Bell, J., Courvalin, P., 2004b. VanD-type vancomycin-resistant Enterococcus faecium and Enterococcus faecalis. Antimicrob. Agents Chemother. 48, 3892–3904. Emaneini, M., Aligholi, M., Aminshahi, M., 2008. Characterization of glycopeptides,
3
Gene Reports 16 (2019) 100415
A.F. Sheikh, et al.
Miller, W.R., Murray, B.E., Rice, L.B., Arias, C.A., 2016. Vancomycin-resistant enterococci: therapeutic challenges in the 21st century. Infect. Dis. Clin. N. Am. 30, 415–439. Mirzaei, B., Farivar, T.N., Juhari, P., Mehr, M.A., Babaei, R., 2013. Investigation of the prevalence of vanA and vanB genes in vancomycin resistant enterococcus (VRE) by Taq man real time PCR assay. J Microbiol Infect Dis 3. Nelson, R.R., McGregor, K.F., Brown, A.R., Amyes, S.G., Young, H., 2000. Isolation and characterization of glycopeptide-resistant enterococci from hospitalized patients over a 30-month period. J. Clin. Microbiol. 38, 2112–2116. Nichol, K.A., Sill, M., Laing, N.M., Johnson, J.L., Hoban, D.J., Zhanel, G.G., 2006. Molecular epidemiology of urinary tract isolates of vancomycin-resistant Enterococcus faecium from North America. Int. J. Antimicrob. Agents 27, 392–396. Perichon, B., Reynolds, P., Courvalin, P., 1997. VanD-type glycopeptide-resistant Enterococcus faecium BM4339. Antimicrob. Agents Chemother. 41, 2016–2018. Perichon, B., Casadewall, B., Reynolds, P., Courvalin, P., 2000. Glycopeptide-resistant Enterococcus faecium BM4416 is a VanD-type strain with an impaired D-Alanine:DAlanine ligase. Antimicrob. Agents Chemother. 44, 1346–1348. Roghmann, M.C., Fink, J.C., Polish, L., Maker, T., Brewrink, J., Morris Jr., J.G., Light, P.D., 1998. Colonization with vancomycin-resistant enterococci in chronic hemodialysis patients. Am. J. Kidney Dis. 32, 254–257. Sharifi, Y., Hasani, A., Ghotaslou, R., Varshochi, M., Hasani, A., Aghazadeh, M., Milani, M., 2012. Survey of virulence determinants among vancomycin resistant Enterococcus faecalis and Enterococcus faecium isolated from clinical specimens of hospitalized patients of north west of Iran. Open Microbiol J 6, 34–39. Sreeja, S., Babu, P.R.S., Prathab, A.G., 2012. The prevalence and the characterization of the enterococcus species from various clinical samples in a tertiary care hospital. J. Clin. Diagn. Res. 6, 1486–1488. Sujatha, S., Praharaj, I., 2012. Glycopeptide resistance in gram-positive cocci: a review. Interdiscip Perspect Infect Dis 2012, 781679. Udo, E.E., Al-Sweih, N., John, P., Jacob, L.E., Mohanakrishnan, S., 2004. Characterization of high-level aminoglycoside-resistant enterococci in Kuwait hospitals. Microb. Drug Resist. 10, 139–145. Uttley, A.H., 1988. Vancomycin-resistant enterococci. Lancet 2, 57–58. Xu, X., Lin, D., Yan, G., Ye, X., Wu, S., Guo, Y., Zhu, D., Hu, F., Zhang, Y., Wang, F., et al., 2010. vanM, a new glycopeptide resistance gene cluster found in Enterococcus faecium. Antimicrob. Agents Chemother. 54, 4643–4647.
aminoglycosides and macrolide resistance among Enterococcus faecalis and Enterococcus faecium isolates from hospitals in Tehran. Pol. J. Microbiol. 57, 173–178. Facklam, R.R., Collins, M.D., 1989. Identification of Enterococcus species isolated from human infections by a conventional test scheme. J. Clin. Microbiol. 27, 731–734. Ghasabi, F., Halaji, M., Nouri, S., 2017. Determination of vancomycin-resistant Staphylococcus aureus. J Res Pharm Pract 6, 60. Ghassabi, F., Hashempour, T., Moghadami, M., Davarpanah, M.A., Kalani, M., Chatrabnous, N., Halaji, M., Shahraki, H.R., Hadi, N., 2017. Bacterial etiology and antibiotic resistance pattern of septicemia in HIV and non-HIV patients admitted to tertiary care hospitals, Shiraz, South of Iran. Cell. Mol. Biol. (Noisy-le-Grand) 63, 115–121. Heintz, B.H., Halilovic, J., Christensen, C.L., 2010. Vancomycin-resistant enterococcal urinary tract infections. Pharmacotherapy 30, 1136–1149. Hemmati, H., Khosravi, M., Heidarzadeh, A., Hashkavaei, P., Refahibakhsh, N., 2011. Vascular access and survival in hemodialysis patients in Rasht, Iran. Iran. J. Kidney Dis. 5, 34–37. Kaçmaz, B., Aksoy, A., 2005. Antimicrobial resistance of enterococci in Turkey. Int. J. Antimicrob. Agents 25, 535–538. Kafil, H.S., Asgharzadeh, M., 2014. Vancomycin-resistant enteroccus faecium and Enterococcus faecalis isolated from education hospital of Iran. Maedica (Buchar) 9, 323–327. Kaveh, M., Bazargani, A., Ramzi, M., Sedigh Ebrahim-Saraie, H., Heidari, H., 2016. Colonization rate and risk factors of vancomycin-resistant enterococci among patients received hematopoietic stem cell transplantation in Shiraz, Southern Iran. Int J Organ Transplant Med 7, 197–205. Lebreton, F., Depardieu, F., Bourdon, N., Fines-Guyon, M., Berger, P., Camiade, S., Leclercq, R., Courvalin, P., Cattoir, V., 2011. D-Ala-d-Ser VanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 55, 4606–4612. Leclercq, R., Derlot, E., Duval, J., Courvalin, P., 1988. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N. Engl. J. Med. 319, 157–161. Méndez-Álvarez, S., Pérez-Hernández, X., Claverie-Martín, F., 2000. Glycopeptide resistance in enterococci. Int. Microbiol. 3, 71–80. Meziane-Cherif, D., Saul, F.A., Haouz, A., Courvalin, P., 2012. Structural and functional characterization of VanG D-Ala: D-Ser ligase associated with vancomycin resistance in Enterococcus faecalis. J. Biol. Chem. 287, 37583–37592.
4
Contents lists available at ScienceDirect
Gene Reports journal homepage: www.elsevier.com/locate/genrep
The prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in Ahvaz, southwestern Iran
T
⁎
Ahmad Farajzadeh Sheikh, Hajar Hamidi , Mojtaba Shahin, Saeed Shahmohammadi Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran
A R T I C LE I N FO
A B S T R A C T
Keywords: Enterococci Glycopeptide Antibiotic resistance vanA gene
Background: Enterococci are one the most important etiology of nosocomial infections which have a major role in spreading and persistence of drug resistance genes in hospitals. This study aimed to investigate the prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in southwestern Iran. Methods: 120 non-repetitive clinical isolates of enterococci during 2015–2016 from educational hospitals of Ahvaz city in southwestern Iran were collected. Enterococcus spp. identified by standard microbiological methods. Antibiotic susceptibility pattern was determined using disk diffusion method. The presence of glycopeptides resistance genes was determined by Multiplex-PCR method. Results: By biochemical tests, 73 (60.8%) isolates were Enterococcus faecium followed by 15 (12.5%) Enterococcus faecalis, 3 (2.5%) Enterococcus durans, 2 (1.7%) Enterococcus gallinarum, and 27 (22.5%) other species of enterococci. In overall, 31 enterococci isolates were found to be vancomycin-resistant and 16 isolates of which were resistant to teicoplanin. Moreover, 16 isolates showed resistant to both vancomycin and teicoplanin. In overall, vanA gene was presented in 29 (24.1%) isolates, of which 24 (32.8%) were identified as E. faecium, 1 (6.6%) as E. faecalis, 1 (6.6%) as E. gallinarum, and 3 (11.1%) as other Enterococcus spp. Moreover, 2 isolates had vanC gene; both of these were identified as E. gallinarum. Conclusions: In summary, we evaluated the enterococci from various infections, and resistance to vancomycin was observed in 26% of the studied isolates and vanA gene was found in 24.1% of the isolates.
1. Introduction
critical ill patients such as patients with end-stage renal disease are at advanced risk of colonization and then more treatment cost and complication (Roghmann et al., 1998; Hemmati et al., 2011). The glycopeptide act by inhibition of peptidoglycan synthesis. Glycopeptides binding to the D-alanyl-D-alanine (D-Ala–D-Ala) terminus of intermediates in peptidoglycan formation and inhibiting cell wall crosslinking (Sujatha and Praharaj, 2012). However, the emergence and dissemination of glycopeptide-resistant enterococci (GRE) in the last decades become a global public health concern (Uttley, 1988; Leclercq et al., 1988). Based on DNA sequences and organization, glycopeptide resistance has been categorized into several types in enterococci. They are designated according to the name of the ligase gene, which encodes either a D-Ala-D-Lac (vanA, vanB, vanD, and vanM) or a D-Ala-D-Ser (vanC, vanE, vanG, vanL, and vanN) ligase for the synthesis of peptidoglycan precursors with low affinity for glycopeptides (Sujatha and Praharaj, 2012; Xu et al., 2010; Lebreton et al., 2011; Boyd et al.,
Enterococci are Gram-positive bacteria that are gut commensal bacteria of both human and animal. Under certain circumstances, they may cause serious infections, including urinary tract infection (UTI), bacteremia, peritonitis, endocarditis, meningitis and wound infections (Heintz et al., 2010; Miller et al., 2016; Nichol et al., 2006). Enterococci are one the most important etiology of nosocomial infections which have a major role in spreading and persistence of drug resistance genes in hospitals (Heintz et al., 2010; Ghassabi et al., 2017). The glycopeptide antibiotics including vancomycin and teicoplanin are regarded to be the last resort for treating a variety of serious infections caused by Gram-positive bacteria, particularly enterococci (Méndez-Álvarez et al., 2000; Ghasabi et al., 2017). The emergence and limited therapeutic choices of vancomycin-resistant enterococci (VRE) have become an important clinical and epidemiological concern since
Abbreviations: CLSI, Clinical and Laboratory Standards Institute; D-Ala–D-Ala, D-alanyl-D-alanine; GRE, glycopeptide-resistant enterococci; PYR, Pyrrolidonyl Aminopeptidase; PCR, polymerase chain reaction ⁎ Corresponding author. E-mail address: [email protected] (H. Hamidi). https://doi.org/10.1016/j.genrep.2019.100415 Received 31 March 2019; Received in revised form 30 April 2019; Accepted 7 May 2019 Available online 08 May 2019 2452-0144/ © 2019 Elsevier Inc. All rights reserved.
Gene Reports 16 (2019) 100415
A.F. Sheikh, et al.
2008). VanA-type resistance is characterized by high-level resistance to both vancomycin and teicoplanin, whereas VanB-type isolates are resistant to variable levels of vancomycin but susceptible to teicoplanin. VanD-type strains are resistance to moderate levels of vancomycin and teicoplanin. VanC, VanE and VanG strains are low-level resistant to vancomycin (Méndez-Álvarez et al., 2000). Regard to rapid dissemination of glycopeptides resistance, rapid and accurate identification of GRE colonized patients is essential to prevent the spread of resistant-strains in hospital environments. The aim of this study was to investigate the prevalence of phenotypic and genotypic glycopeptides resistance among clinical isolates of enterococci in Ahvaz, southwestern Iran.
Table 2 Distribution of enterococci isolates in different wards of studied hospitals.
2. Methods and materials
Ward
No
%
Outpatients Urology Nephrology Children Emergency Neonatal Internal Intensive care units Neurology Maternity Gastroenterology Lung Transplantation Infectious
69 10 9 8 7 5 3 3 1 1 1 1 1 1
57.5 8.4 7.5 6.7 5.9 4.2 2.5 2.5 0.8 0.8 0.8 0.8 0.8 0.8
2.1. Study design and bacterial isolates at 56 °C, and 45 s at 72 °C, with 5 min at 72 °C for the final extension. Positive controls for PCR were Enterococcus faecium ATCC 51559 (vanA), Enterococcus faecalis ATCC 51299 (vanB) and Enterococcus gallinarum BM14174 (vanC). Negative controls consisted of the PCR components of the reaction mixtures lacking enterococci DNA. DNA fragments were analyzed by electrophoresis in 0.5 × Tris-borate-EDTA on a 1% agarose gel stained with ethidium bromide.
120 non-repetitive clinical isolates of enterococci during 2015–2016 from educational hospitals of Ahvaz city in southwestern Iran were collected. Enterococcus spp. identified by standard microbiological methods, including Gram's stain, colony morphology, catalase test, bile esculin test, growth in 6.5% NaCl and PYR (Pyrrolidonyl Aminopeptidase) test. All the isolates were specified at the species level by biochemical tests consists of mannitol, sorbose, arabinose, lactose and sucrose fermentation, motility test, pigment production and Voges–Proskauer test (Facklam and Collins, 1989).
3. Results
2.2. Antimicrobial susceptibility testing
Out of 120 enterococci, 77 (64.2%) isolates were from female and 43 (35.8%) isolates from male patients. Most of the isolates were also recovered from urine samples (92%), followed by wound (3%), blood (3%), and ascites fluid specimens (1%). Out of 120 isolates, 69 (57.5%) isolates were obtained from outpatient department (OPD) followed by urology ward 10 (8.3%) (Table 2). By biochemical tests, 73 (60.8%) isolates were E. faecium followed by 15 (12.5%) E. faecalis, 3 (2.5%) E. durans, 2 (1.7%) E. gallinarum, and 27 (22.5%) other species of enterococci. In overall, 31 enterococci isolates were found to be vancomycin-resistant by disk diffusion and vancomycin screening test and 16 isolates of which were resistant to teicoplanin. Moreover, 16 isolates showed resistant to both vancomycin and teicoplanin. The full results of antibiotic susceptibility pattern of tested isolates are presented in Table 3. PCR for detecting glycopeptid resistance genes was done for all isolates (Fig. 1). In overall, vanA gene was presented in 29 (24.1%) isolates, of which 24 (32.8%) were identified as E. faecium, 1 (6.6%) as E. faecalis, 1 (6.6%) as E. gallinarum, and 3 (11.1%) as other Enterococcus spp. Moreover, 2 isolates had vanC gene; both of these were identified as E. gallinarum. Meanwhile, vanB, vanD, vanE and vanG genes were not found in any isolates. Nineteen of 29 isolates that contained vanA gene were resistant to vancomycin, while 15 isolates of them were resistant to teicoplanin. Also, one of the vanC contained isolates was resistant to the both vancomycin and teicoplanin.
Antibiotic susceptibility pattern of isolates was determined using disk diffusion method on Mueller-Hinton agar according to Clinical and Laboratory Standards Institute (CLSI) guidelines toward vancomycin (30 μg), teicoplanin (30 μg), nitrofurantoin (300 μg), linezolid (30 μg), fosfomycin (200 μg) and gentamicin (30 μg). In addition, all strains were examined by vancomycin screening agar test (Sujatha and Praharaj, 2012). Staphylococcus aureus ATCC 25923 was used as the standard strain for antibiotic susceptibility testing. 2.3. DNA extraction and multiplex PCR Genomic DNA was extracted from freshly grown colonies using boiling method (Sharifi et al., 2012). Multiplex polymerase chain reaction (PCR) reaction mixtures were prepared under laminar flow under strict precautions to prevent cross-contamination. The list of primer sequences are shown in Table 1 (Depardieu et al., 2004a). Amplification was performed in a final volume of 50 μl volume as previously described (Lebreton et al., 2011). Amplification was carried out with the following thermal cycling profile: initial denaturation for 4 min at 94 °C, 35 cycles of amplification consisting of 45 s at 94 °C, 45 s Table 1 List of used primers in this study. Primer
Sequence (5′ → 3′)
Gene
Size of PCR product (bp)
VanA-F VanA-R VanB-F VanB-R VanC-F VanC-R VanD-F VanD-R VanE-F VanE-R VanG-F VanG-R
GGGAAAACGACAATTGC GTACAATGCGGCCGTTA ACGGAATGGGAAGCCGA TGCACCCGATTTCGTTC ATGGATTGGTACTGGTAT TAGCGGGAGTGACCAGTAA TGTGGGATGCGATATTCAA TGCAGCCAAGTATCCGGTAA TGTGGTATCGGAGCTGCAG ATAGTTTAGCTGGTAAC CGGCATCCGCTGTTTTTGA GAACGATAGACCAATGCCTT
vanA
732
vanB
647
vanC
815/827
vanD
500
vanE
430
vanG
941
Table 3 Pattern of antibiotics resistance in all Enterococci isolates. Antibiotic
Vancomycin Teicoplanin Nitrofurantoin Linezolid Fosfomycin
2
Susceptible no. (%) 60 (50) 93 (77.5) 99 (82.5) 39 (32.5) 108 (90)
Intermediate- resistant no. (%) 29 (24) 11 (9.2) 9 (7.5) 26 (21.7) 9 (7.5)
Resistant no. (%) 31 (26) 16 (13.3) 12 (10) 55 (45.8) 3 (2.5)
Gene Reports 16 (2019) 100415
A.F. Sheikh, et al.
resistance of enterococci to gentamicin is also reported from Kuwait and Turkey (Udo et al., 2004; Kaçmaz and Aksoy, 2005). The Multiplex PCR were performed to detect van genes for all of our enterococci isolates and showed that from 120 isolates, 29 isolates harbored vanA gene and 2 isolates harbor vanC gene. While consistent with our findings the prevalence of vanE (Abadia-Patino et al., 2004), vanD (Depardieu et al., 2004b; Perichon et al., 1997; Perichon et al., 2000), and vanG (Boyd et al., 2006; Depardieu et al., 2003; MezianeCherif et al., 2012) are globally low in enterococci, the present study showed that the possibility of these genes exist in our area is low. In a study in Tehran, the frequency of vanA gene was 12% and vanB was 0% (Emaneini et al., 2008), which is match to our findings. Although it seems that the prevalence of vanB in Iran is low, but in a study in Tehran (Kafil and Asgharzadeh, 2014), 10.2% vanB was reported. The frequency of this gene is likely to be more in the northwest of Iran (Sharifi et al., 2012), but it's not so prevalent in our studied region and also our studied clinical samples.
Fig. 1. Gel electrophoresis for PCR of van genes. Lane: 1, E. faecium ATCC 51559 (vanA); Lane 2, E. faecalis ATCC 51299 (vanB); Lane 3, E. gallinarum BM14174 (vanC); Lane 4, negative control; Lanes 5–10, clinical samples; M, Marker of 100 bp DNA ladder.
5. Conclusion In summary, we evaluated the enterococci isolated from various infections, and resistance to vancomycin was observed in 26% of the studied isolates and vanA gene was found in 24.1% of the isolates. In the end, given that the epidemiology of enterococci in distinct geographical regions is different, knowing endemic prevalence of antibiotics resistance pattern in different health centers, and updating therapeutic policies are essential to limiting colonized patients and controlling the spread of resistant strains in Iranian hospitals.
4. Discussion Today the spread of antibiotic resistance among Enterococcus species has become a new challenge in hospitals. Unfortunately therapeutic failure in enterococci infections is become increasing because of not enough local information about their antibiotic resistance pattern, especially glycopeptide antibiotics. In the present study, 120 isolates of enterococci were identified and studied. In this study the majority of the isolates obtained from urine samples (92.5%), and confirmed that the most common site of enterococci infection is UTI (Barros et al., 2009). From the total isolated enterococci, 60.8% belonged to E. feacium. Previously similar to our findings Nelson et al. (2000), Biendo et al. (2010), and Sharifi et al. (2012), introduced E. faecium as the prevalent species. However, the previous findings of Kafil et al. in Tabriz, Iran (Kafil and Asgharzadeh, 2014), Mirzaee et al. in Tehran, Iran (Mirzaei et al., 2013) and Sreeja et al. in India (Sreeja et al., 2012) indicate to a higher prevalence of E. faecalis compared to our study. The reason for increasing E. faecium prevalence in our study is probably the enhancement of E. faecium resistance to antibiotics, especially glycopeptides. While E. faecalis presumably is more susceptible to antibiotics resistance (Kaveh et al., 2016), so may lead to reduce its prevalence in our study. Moreover despite the low frequency of other enterococci such as E. durans and E. gallinarum, these species play a significant role in nosocomial infections and the isolation of them from different parts of hospitals indicates the infectivity risk of these species (Kaveh et al., 2016). In the present study, the most of glycopeptides-resistant isolates are related to wound and urinary tract infections which are comparable to Kafil et al. study (Kafil and Asgharzadeh, 2014). The E. faecalis isolates lead less resistance to glycopeptide antibiotics in comparison with other species. Also, E. faecalis isolates were completely susceptible to nitrofurantoin, and its resistance percentage to linezolid and fosfomycin were low. In contrast, E. faecium showed higher resistance to glycopeptides (19.2%). In addition the resistance to nitrofurantoin, linezolid, and fosfomycin were high. Meanwhile, in relation to glycopeptides resistance, the present study showed that the resistance of enterococci to vancomycin is higher than teicoplanin. Also, high-level glycopeptide resistance in E. durans and E. gallinarum showed importance of them in clinical samples. The overall prevalence of resistance to glycopeptides (both vancomycin and teicoplanin) in this study was 13.3% which is higher in comparison with Emaneini in Tehran (Emaneini et al., 2008). Moreover the low resistance to nitrofurantoin and fosfomycin antibiotics shows that these antibiotics are proper treatments for enterococci infections in our region, especially resistant strains to glycopeptide antibiotics. High
Funding This study was supported by Department of Microbiology, School of Medicine, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, Iran University of Medical Sciences. Acknowledgements The author would like to thank Dr. Seyed Mojtaba Mousavian and Dr. Mohammad Reza Pourshafie for their help to provide bacterial quality control strains. Consent for publication Not applicable. References Abadia-Patino, L., Christiansen, K., Bell, J., Courvalin, P., Perichon, B., 2004. VanE-type vancomycin-resistant Enterococcus faecalis clinical isolates from Australia. Antimicrob. Agents Chemother. 48, 4882–4885. Barros, M., Martinelli, R., Rocha, H., 2009. Enterococcal urinary tract infections in a university hospital: clinical studies. Braz. J. Infect. Dis. 13, 294–296. Biendo, M., Adjide, C., Castelain, S., Belmekki, M., Rousseau, F., Slama, M., Ganry, O., Schmit, J.L., Eb, F., 2010. Molecular characterization of glycopeptide-resistant enterococci from hospitals of the Picardy region (France). Int J Microbiol 2010, 150464. Boyd, D.A., Du, T., Hizon, R., Kaplen, B., Murphy, T., Tyler, S., Brown, S., Jamieson, F., Weiss, K., Mulvey, M.R., 2006. VanG-type vancomycin-resistant Enterococcus faecalis strains isolated in Canada. Antimicrob. Agents Chemother. 50, 2217–2221. Boyd, D.A., Willey, B.M., Fawcett, D., Gillani, N., Mulvey, M.R., 2008. Molecular characterization of Enterococcus faecalis N06-0364 with low-level vancomycin resistance harboring a novel D-Ala-D-Ser gene cluster, vanL. Antimicrob. Agents Chemother. 52, 2667–2672. Depardieu, F., Bonora, M.G., Reynolds, P.E., Courvalin, P., 2003. The vanG glycopeptide resistance operon from Enterococcus faecalis revisited. Mol. Microbiol. 50, 931–948. Depardieu, F., Perichon, B., Courvalin, P., 2004a. Detection of the van alphabet and identification of enterococci and staphylococci at the species level by multiplex PCR. J. Clin. Microbiol. 42, 5857–5860. Depardieu, F., Kolbert, M., Pruul, H., Bell, J., Courvalin, P., 2004b. VanD-type vancomycin-resistant Enterococcus faecium and Enterococcus faecalis. Antimicrob. Agents Chemother. 48, 3892–3904. Emaneini, M., Aligholi, M., Aminshahi, M., 2008. Characterization of glycopeptides,
3
Gene Reports 16 (2019) 100415
A.F. Sheikh, et al.
Miller, W.R., Murray, B.E., Rice, L.B., Arias, C.A., 2016. Vancomycin-resistant enterococci: therapeutic challenges in the 21st century. Infect. Dis. Clin. N. Am. 30, 415–439. Mirzaei, B., Farivar, T.N., Juhari, P., Mehr, M.A., Babaei, R., 2013. Investigation of the prevalence of vanA and vanB genes in vancomycin resistant enterococcus (VRE) by Taq man real time PCR assay. J Microbiol Infect Dis 3. Nelson, R.R., McGregor, K.F., Brown, A.R., Amyes, S.G., Young, H., 2000. Isolation and characterization of glycopeptide-resistant enterococci from hospitalized patients over a 30-month period. J. Clin. Microbiol. 38, 2112–2116. Nichol, K.A., Sill, M., Laing, N.M., Johnson, J.L., Hoban, D.J., Zhanel, G.G., 2006. Molecular epidemiology of urinary tract isolates of vancomycin-resistant Enterococcus faecium from North America. Int. J. Antimicrob. Agents 27, 392–396. Perichon, B., Reynolds, P., Courvalin, P., 1997. VanD-type glycopeptide-resistant Enterococcus faecium BM4339. Antimicrob. Agents Chemother. 41, 2016–2018. Perichon, B., Casadewall, B., Reynolds, P., Courvalin, P., 2000. Glycopeptide-resistant Enterococcus faecium BM4416 is a VanD-type strain with an impaired D-Alanine:DAlanine ligase. Antimicrob. Agents Chemother. 44, 1346–1348. Roghmann, M.C., Fink, J.C., Polish, L., Maker, T., Brewrink, J., Morris Jr., J.G., Light, P.D., 1998. Colonization with vancomycin-resistant enterococci in chronic hemodialysis patients. Am. J. Kidney Dis. 32, 254–257. Sharifi, Y., Hasani, A., Ghotaslou, R., Varshochi, M., Hasani, A., Aghazadeh, M., Milani, M., 2012. Survey of virulence determinants among vancomycin resistant Enterococcus faecalis and Enterococcus faecium isolated from clinical specimens of hospitalized patients of north west of Iran. Open Microbiol J 6, 34–39. Sreeja, S., Babu, P.R.S., Prathab, A.G., 2012. The prevalence and the characterization of the enterococcus species from various clinical samples in a tertiary care hospital. J. Clin. Diagn. Res. 6, 1486–1488. Sujatha, S., Praharaj, I., 2012. Glycopeptide resistance in gram-positive cocci: a review. Interdiscip Perspect Infect Dis 2012, 781679. Udo, E.E., Al-Sweih, N., John, P., Jacob, L.E., Mohanakrishnan, S., 2004. Characterization of high-level aminoglycoside-resistant enterococci in Kuwait hospitals. Microb. Drug Resist. 10, 139–145. Uttley, A.H., 1988. Vancomycin-resistant enterococci. Lancet 2, 57–58. Xu, X., Lin, D., Yan, G., Ye, X., Wu, S., Guo, Y., Zhu, D., Hu, F., Zhang, Y., Wang, F., et al., 2010. vanM, a new glycopeptide resistance gene cluster found in Enterococcus faecium. Antimicrob. Agents Chemother. 54, 4643–4647.
aminoglycosides and macrolide resistance among Enterococcus faecalis and Enterococcus faecium isolates from hospitals in Tehran. Pol. J. Microbiol. 57, 173–178. Facklam, R.R., Collins, M.D., 1989. Identification of Enterococcus species isolated from human infections by a conventional test scheme. J. Clin. Microbiol. 27, 731–734. Ghasabi, F., Halaji, M., Nouri, S., 2017. Determination of vancomycin-resistant Staphylococcus aureus. J Res Pharm Pract 6, 60. Ghassabi, F., Hashempour, T., Moghadami, M., Davarpanah, M.A., Kalani, M., Chatrabnous, N., Halaji, M., Shahraki, H.R., Hadi, N., 2017. Bacterial etiology and antibiotic resistance pattern of septicemia in HIV and non-HIV patients admitted to tertiary care hospitals, Shiraz, South of Iran. Cell. Mol. Biol. (Noisy-le-Grand) 63, 115–121. Heintz, B.H., Halilovic, J., Christensen, C.L., 2010. Vancomycin-resistant enterococcal urinary tract infections. Pharmacotherapy 30, 1136–1149. Hemmati, H., Khosravi, M., Heidarzadeh, A., Hashkavaei, P., Refahibakhsh, N., 2011. Vascular access and survival in hemodialysis patients in Rasht, Iran. Iran. J. Kidney Dis. 5, 34–37. Kaçmaz, B., Aksoy, A., 2005. Antimicrobial resistance of enterococci in Turkey. Int. J. Antimicrob. Agents 25, 535–538. Kafil, H.S., Asgharzadeh, M., 2014. Vancomycin-resistant enteroccus faecium and Enterococcus faecalis isolated from education hospital of Iran. Maedica (Buchar) 9, 323–327. Kaveh, M., Bazargani, A., Ramzi, M., Sedigh Ebrahim-Saraie, H., Heidari, H., 2016. Colonization rate and risk factors of vancomycin-resistant enterococci among patients received hematopoietic stem cell transplantation in Shiraz, Southern Iran. Int J Organ Transplant Med 7, 197–205. Lebreton, F., Depardieu, F., Bourdon, N., Fines-Guyon, M., Berger, P., Camiade, S., Leclercq, R., Courvalin, P., Cattoir, V., 2011. D-Ala-d-Ser VanN-type transferable vancomycin resistance in Enterococcus faecium. Antimicrob. Agents Chemother. 55, 4606–4612. Leclercq, R., Derlot, E., Duval, J., Courvalin, P., 1988. Plasmid-mediated resistance to vancomycin and teicoplanin in Enterococcus faecium. N. Engl. J. Med. 319, 157–161. Méndez-Álvarez, S., Pérez-Hernández, X., Claverie-Martín, F., 2000. Glycopeptide resistance in enterococci. Int. Microbiol. 3, 71–80. Meziane-Cherif, D., Saul, F.A., Haouz, A., Courvalin, P., 2012. Structural and functional characterization of VanG D-Ala: D-Ser ligase associated with vancomycin resistance in Enterococcus faecalis. J. Biol. Chem. 287, 37583–37592.
4