The pro region of Toxoplasma ROP1 is a rhoptry-targeting signal

International Journal for Parasitology 31 (2001) 1177±1186

www.parasitology-online.com

The pro region of Toxoplasma ROP1 is a rhoptry-targeting signal Peter J. Bradley, John C. Boothroyd* Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305-5124, USA Received 23 April 2001; received in revised form 14 May 2001; accepted 14 May 2001

Abstract The rhoptries of Toxoplasma gondii are regulated secretory organelles involved in the invasion of host cells. Rhoptry proteins are synthesised as pre-pro-proteins that are processed ®rst to pro-proteins upon entrance into the secretory pathway, then processed again to their mature forms late in the secretory pathway. The pro-mature processing site of the rhoptry protein ROP1 has been determined, paving the way for understanding the role of the pro region in rhoptry protein function. We demonstrate here that the ROP1 pro region is suf®cient for targeting a reporter protein (amino acids 34±471 of the Trypanosoma brucei VSG117 protein) to the rhoptries. These results, together with our previous work showing that rhoptry targeting is unaffected by deletion of the pro region, indicate that the ROP1 protein contains at least two signals that can function in rhoptry targeting. q 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. Keywords: Toxoplasma gondii; ROP1; Rhoptry; Protein targeting

1. Introduction Toxoplasma gondii is an obligate intracellular parasite of the phylum Apicomplexa that has a world-wide distribution and can infect nearly any vertebrate cell type (Frenkel, 1973; Joiner and Dubremetz, 1993). Toxoplasma enters host cells by an active process that is dependent on parasite actin±myosin based gliding motility (Dobrowolski and Sibley, 1996; Dobrowolski et al., 1997) and involves the regulated release of contents from the parasite's apical secretory organelles: the micronemes, the rhoptries, and the dense granules (Carruthers and Sibley, 1997). Invasion of host cells is accompanied by formation of the parasitophorous vacuole (PV) in which the parasite replicates until the parasites lyse the host cell, completing the lytic cycle (Karsten et al., 1997). The PV does not fuse with the host endocytic system, and thus exists undetected in the host cell cytoplasm (Jones and Hirsch, 1972; Sibley et al., 1985). Analysis of the protein constituents and timing of release from the regulated secretory organelles has implicated the rhoptries in invasion, PV formation, and PV/host organelle association, whereas the micronemes appear to function in attachment to the host cell and the dense granules in further modi®cation of the PV for intracellular survival (Carruthers and Sibley, 1997; Dubremetz et al., 1998; Liendo and Joiner, 2000; Tomley and Soldati, 2001). * Corresponding author. Tel.: 11-650-723-7984; fax: 11-650-723-6853. E-mail address: [email protected] (J.C. Boothroyd).

The rhoptries are apical club-shaped organelles that are composed of a bulb-shaped body that has a mottled appearance and an electron-dense neck through which the contents of the rhoptries are secreted into the host cell upon invasion. The contents of the rhoptries include both protein and lipid, apparently as membranous whorls within the body of the rhoptry (Dubremetz and Schwartzman, 1993). The lipid component may contribute to PV formation upon host cell invasion. As expected for proteins in the secretory pathway, rhoptry proteins are initially synthesised with a typical signal sequence which is presumably processed following entry into the secretory pathway. All rhoptry proteins identi®ed to date also undergo a second processing event whereby a N-terminal `pro' domain is removed to yield the mature polypeptide (Sadak et al., 1988; Ossorio et al., 1992). Two classes of rhoptry proteins are well-characterised, both of which are secreted into the host cell during the early stages of invasion. The ®rst class has a single member, ROP1, which is a lumenal (soluble) rhoptry protein that is secreted into the PV during entry and then quickly disappears (Saffer et al., 1992), suggesting a role early in the process of invasion. Consistent with this, ROP1 has been implicated as a component of a poorly characterised fraction that enhances invasion in vitro (Schwartzman, 1986). ROP1 knock-out parasites in the highly virulent RH strain show an ultrastructural phenotype characterised by reduced diameter and increased electron density of the rhoptries; however, under the few conditions tested, the parasites do not show altered kinetics of invasion in vitro or a gross change in the ability to

0020-7519/01/$20.00 q 2001 Australian Society for Parasitology Inc. Published by Elsevier Science Ltd. All rights reserved. PII: S 0020-751 9(01)00242-9

1178

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

cause fatality in mice (Bradley and Boothroyd, unpublished data; Soldati et al., 1995). The signal(s) which target ROP1 to the rhoptries have not been described, although the ROP1 pro region has been shown not to be necessary for rhoptry targeting (Soldati et al., 1998). The second class of well-characterised rhoptry proteins (ROP2, ROP3, ROP4 and ROP8) are related transmembrane proteins that are inserted into the PV membrane and have been implicated in host organelle association with the PV (Liendo and Joiner, 2000). Recent studies have shown that ROP2 targeting to the rhoptries is mediated by a tyrosine-based motif (YXXf) found in the ROP2 cytoplasmic tail (Hoppe et al., 2000) that is similar to the sorting motifs of transmembrane proteins found in mammalian cells (Marks et al., 1997). ROP1 processing takes place late in the secretory pathway, perhaps in the rhoptries themselves (Soldati et al., 1998). The processing site which determines the boundaries of the ROP1 pro and mature regions has been identi®ed (Bradley and Boothroyd, 1999). The role of the pro regions of rhoptry proteins has not yet been determined, but we have previously reported that ROP1 lacking this region can nonetheless be targeted to the rhoptries (Soldati et al., 1998), indicating that the pro domain is not necessary for these traf®cking events. Surprisingly, however, we demonstrate here that the ROP1 pro region is in fact able to do exactly this. We have excluded a role for other sequences such as the `pre' region (signal peptide), and thus conclude that the proROP1 protein contains at least two targeting signals, one in the pro and one in the mature portion of the protein. 2. Materials and methods 2.1. Parasite and host cell culture Human foreskin ®broblasts (HFF) were grown in Dulbecco's modi®ed Eagle's medium (DMEM) supplemented with 10% foetal bovine serum (Gibco) and 2 mM glutamine. Toxoplasma gondii tachyzoites (strain 4R2DH, see below) were maintained in con¯uent monolayers of HFF cells. 2.2. Disruption of HXGPRT in the ROP1 knock-out 4R2 A hypoxanthine±xanthine±guanine phosphoribosyl transferase (HXGPRT ) disruption was created in the ROP1 knock-out 4R2 (Soldati et al., 1995) by transfection with 50 mg of the HXGPRT knock-out vector pHXGPRTg11DSal (kindly provided by Dr David Roos) and selection of HXGPRT(2)parasites on 6-thioxanthine as previously described (Donald et al., 1996). Parasites resistant to 6-thioxanthine were cloned and the deletion of the HXGPRT gene was con®rmed by Southern blot analysis. The resulting strain lacking both ROP1 and HXGPRT was named 4R2DH. 2.3. ROP1VSG-targeting constructs A diagrammatic sketch of each ROP1VSG fusion

construct is shown in the ®gure in which it is discussed. The oligonucleotides used in the construction of ROPVSG fusions were: ROP1-B/M1 GATGATGGATCGCAAACGCGTCTCAGATCTTACGGGCAGCATGCTGCTG ROP1-B/M2 GCAGCATGCTGCCCGTAAGATCTGAGACGCGTTTGCGATCCATCATCC VSG1 GCGCAGATCTGCCAAAGAAGCCCTTGAATA VSG2 CCGGACGCGTTGCAGTTTGAGTTTGTGTAA R87V GGCCACGCGTTCTGACAGGAGCTTCCAC R51V cgccacgcgtGCCCCTGTGCCGTGGCTCGCC R28V CGCCACGCGTATTGTGGCTCGAAAGGGCGGC ROP28Bam gcgcggatcccGGAGTCCCCGCTTATCCATC All PCR ampli®cation was carried out using Pfu polymerase (Stratagene) to minimise PCR errors. Overlap extension PCR using oligonucleotides ROP1-B/M1 and ROP1-B/M2 was used to insert MluI and Bg/II restriction sites into the RH strain ROP1 gene in the plasmid ROP1 2.5 kb (Bradley and Boothroyd, 1999) while deleting the ROP1 stop codon (pROP1MluIBg/II). The overlap extension product was digested with SacI and EcoRI and subcloned into the ROP1 2.5 kb vector in which the wild-type ROP1 sequence had been removed by digestion with the same enzymes. Amino acids 34±471 of the Trypanosoma brucei variant surface glycoprotein (VSG) 117 protein plus a stop codon were ampli®ed from the plasmid mVSG117 (Hsia et al., 1996) with the primers VSG1 and VSG2 containing MluI and Bg/II restriction sites, respectively. The ampli®ed product was digested with MluI and Bg/II and subcloned into pROP1MluIBg/II digested with the same restriction enzymes. The resulting full-length ROP1VSG fusion (pROP1VSG; Fig. 2A) was sequenced at the junctions of the ROP/VSG fusion and the VSG/stop and lacked PCR errors. 2.3.1. Construction of ROP1(1±87)VSG, ROP1(1±51)VSG and ROP1(1±28)VSG ROP1(1±87), ROP1(1±51) and ROP1(1±28) were ampli®ed from the ROP1 2.5 kb template using T3 and R87V, R51V, and R28V primers, respectively. The PCR products were digested with SacI and MluI and subcloned into pROP1VSG in which full-length ROP1 had been removed by digestion with the same restriction enzymes. The ampli®ed regions were sequenced and lacked PCR errors. 2.3.2. Construction of SAG1(1±33)ROP1(28±87)VSG The SAG1 vector pp30 contains a 1.6 kb AvaI genomic fragment of SAG1 gene cloned into pBluescriptII KS (Kim et al., 1994). ROP(28±87)VSG was ampli®ed from the ROP(1±87)VSG construct using the primer ROP28Bam and the vector primer T7, adding a BamHI site at the 5 0 end of the ampli®ed product. The PCR product was digested

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

with BamHI and subcloned into pp30 digested with BamHI. Clones in the correct orientation were selected and sequenced to verify sequences from the start codon to the VSG reporter. The resulting construct contains the SAG1 promoter and an in-frame fusion of regions coding for the SAG1 signal sequence (amino acids 1±33), amino acids 28± 87 of ROP1, and VSG(34±471). The 5 0 untranslated region was from SAG1 and the 3 0 untranslated region was from ROP1 (Fig. 4A).

1179

2.5. Immuno¯uorescence assay of 4R2D H tachyzoites expressing ROP1VSG-targeting constructs HFF on glass coverslips were infected with tachyzoites expressing ROP1VSG-targeting constructs for 24±30 h before ®xation in 3.5% formaldehyde in PBS. The formaldehyde ®x was quenched in PBS/100 mM glycine for 5 min, and the ®xed samples were blocked and permeabilised in

2.4. Expression of ROP1VSG-targeting constructs in the ROP1 knock-out strain (4R2D H) ROP1-targeting constructs (10±50 mg) and pminiHXGP RTI (1 mg; Donald et al., 1996) were linearised with NotI and co-transfected into the ROP1 knock-out strain 4R2DH using NotI restriction enzyme mediated integration as previously described (Black et al., 1995). Stable populations were selected using 50 mg/ml mycophenolic acid and 50 mg/ ml xanthine, and clones expressing the fusion proteins were isolated by limiting dilution (Donald et al., 1996).

Fig. 1. ROP1(1±28)VSG does not localise to the rhoptries. (A) The ROP1(1±28)VSG construct contains the predicted ROP1 signal sequence (striped box) and seven amino acids of the pro domain fused to amino acids 34±471 of the VSG117 protein. The fusion is ¯anked by ROP1 5 0 - and 3 0 UTRs and driven by the ROP1 promoter. (B) Phase contrast image and IFA of intracellular 4R2DH parasites expressing ROP1(1±28)VSG probed with anti-ROP2/3/4 (¯uorescein isothiocyanate (FITC)), anti-VSG (Texas Red), and a double exposure of anti-ROP2/3/4 and anti-VSG as indicated, showing a lack of co-localisation. The phase contrast image contains an arrow pointing to the parasitophorous vacuole (PV) and a scale bar which is 5 mm.

Fig. 2. ROP1VSG is targeted to the rhoptries. (A) The ROP1VSG construct consists of a fusion of pre-pro-ROP1 and the VSG reporter, driven by the ROP1 promoter. (B) Phase contrast image and IFA of intracellular 4R2DH tachyzoites expressing the ROP1VSG construct and showing co-localisation with ROP2/3/4. Panels are probed with anti-ROP2/3/4 (FITC), antiVSG (Texas Red), and a double exposure of anti-ROP2/3/4 and anti-VSG as indicated. (C) IFA of extracellular and invading ROP1VSG-expressing parasites. (Panel 1) Control sample showing apical staining of an extracellular parasite allowed to settle on human foreskin ®broblasts at 08C. (Panel 2) ROPVSG in the nascent vacuole extending from the point of constriction (arrow) of a partially invaded parasite. (Panel 3) ROPVSG staining around the circumference and in the apical portion of a recently invaded parasite.

1180

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

PBT (PBS/3% BSA/0.2% Triton X-100) for 20 min. The samples were stained with primary antibodies diluted in PBT for 1 h: rabbit polyclonal anti-VSG at 1:5000 dilution (Hsia et al., 1996), mAb 4A7 to ROP2/3/4 at a dilution of 1:2000 (Sadak et al., 1988), and a mAb (A3H9) that recognises an uncharacterised rhoptry neck protein at a dilution of 1:1000 (Morrissette et al., 1994). After washing in PBS, the slides were stained with ¯uorescein conjugated goat antimouse and Texas Red conjugated goat anti-rabbit antibodies (ICN Biochemicals) diluted at 1:1000 in PBS/3% BSA. Samples were washed in PBS, mounted in Vectashield and viewed using an Olympus BX60 ¯uorescence microscope with 100 £ phase contrast and differential interference contrast objectives. Images were collected by standard

35 mm photography (Figs. 1, 2 and 5) or using a Hamamatsu ORCA-100 digital camera with Image Pro Plus 4.0 software (MediaCybernetics; Figs. 3 and 4). 2.6. Limited-time invasion assay of ROP1VSG-expressing parasites Limited-time invasion assays of cloned parasites expressing ROP1VSG were performed essentially as described (Carruthers and Sibley, 1997; Reiss et al., 2001). Brie¯y, parasites were allowed to settle onto monolayers of HFFs on coverslips for 30 min at 08C. Samples were then either ®xed immediately (control) or placed at 378C for 5 min prior to ®xation and localisation was assessed by immuno¯uore-

Fig. 3. Mature ROP1 is not necessary for rhoptry targeting. (A) ROP1(1±87)VSG-targeting construct contains the signal sequence (striped box), pro region and four amino acids of mature ROP1 fused to the VSG reporter. (B) Differential interference contrast (DIC) and IFA of 4R2DH parasites expressing ROP1(1± 87)VSG showing co-localisation of VSG and ROP2/3/4 in the body of the rhoptries and extension into the rhoptry necks (arrow). Panels are probed with antiVSG (Texas Red), anti-ROP2/3/4 (FITC), and a merged image of anti-ROP2/3/4 and anti-VSG, as indicated. (C) Co-localisation (merged panel) of the most apical portion of the VSG stain (Texas Red) with the rhoptry neck staining antibody A3H9 (FITC) in parasites expressing ROP1(1±87)VSG. (D) Western blot analysis of parasites expressing ROP1(1±51)VSG (lane 1) and ROP1(1±87)VSG (lane 2) probed with anti-VSG polyclonal antibodies, indicating that ROP1(1± 87)VSG is properly processed. The size markers are shown in kDa.

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

sence assay (IFA) with anti-VSG polyclonal antibodies (1:5000) as described above. 2.7. Western blot analysis of ROP1(1±87)VSG- and ROP1(1±51)VSG-expressing parasites Whole-cell lysates of cloned extracellular tachyzoites expressing ROP1(1±87)VSG and a population expressing ROP1(1±51)VSG were prepared as described (Bradley and Boothroyd, 1999). The lysates were separated by SDS±PAGE (11%), transferred to nitrocellulose and probed with polyclonal anti-VSG antibodies at a dilution of 1:5000. 3. Results 3.1. Trypanosome VSG117 is a useful reporter for studies of rhoptry targeting To identify regions of ROP1 that are necessary for targeting to the rhoptries, we have used constructs consisting of

Fig. 4. The ROP1 promoter and signal sequence are not necessary for rhoptry targeting. (A) The SAG1(1±33)ROP1(28±87)VSG construct contains the SAG1 promoter and signal sequence (dotted box) fused to amino acids 28±87 of ROP1 plus the VSG reporter. (B) Differential interference contrast and IFA of 4R2DH parasites expressing SAG1(1± 33)ROP1(28±87)VSG shows staining to the rhoptries and rhoptry necks identical to that seen under the control of the ROP1 promoter and signal sequence (Fig. 3). IFA panels show probing with anti-ROP2/3/4, anti-VSG, and a merged image of ROP2/3/4 and VSG as indicated.

1181

various truncated versions of ROP1 fused to amino acids 34±471 of trypanosome the VSG117 protein. This portion of VSG117 lacks the leader peptide and glycosylphosphatidylinositol (GPI) addition signal and was chosen as a passenger protein because it has a variety of high-titre antibodies available for its detection (Hsia et al., 1996), it traverses the secretory pathway well in trypanosomes and it has no known targeting signals in the absence of a GPI anchor (Bangs et al., 1993, 1996). Hence, on its own, this reporter protein would not be expected to actively traf®c toward one of the regulated secretory compartments in Toxoplasma. The coding region in the fusion constructs was ¯anked by the ROP1 5 0 - and 3 0 -UTRs and their expression was driven by the ROP1 promoter to avoid possible deleterious effects of these regions if derived from a non-rhoptry protein (see below for further discussion of this point). To avoid possible carrier effects due to interaction of the fusions with endogenous (and actively targeted) ROP1, the constructs were expressed in the ROP1 knock-out strain 4R2DH. Localisation was assessed by IFA using anti-VSG antibodies and reagents speci®c for other known rhoptry proteins. Although VSG117 was not expected to possess active targeting signals, it was necessary to ®rst establish this. To do this, we used a construct in which VSG117 (34±

Fig. 5. ROP1(1±51)VSG does not target to the rhoptries. (A) The ROP1(1± 51)VSG construct. (B) Phase contrast image and IFA of intracellular 4R2DH parasites expressing ROP1(1±51)VSG probed with anti-ROP2/3/ 4 (FITC), anti-VSG (Texas Red), and a double exposure of anti-ROP2/3/4 and anti-VSG as indicated. ROP1(1±51)VSG localises to reticular cytoplasmic structures characteristic of ER, that do not co-localise with ROP2/3/4 as seen in the ROP1(1±28)VSG fusion (Fig. 1).

1182

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

471) was fused to just the region coding for the predicted ROP1 signal sequence (amino acids 1±21) plus seven adjacent residues to allow for its removal (Fig. 1A). This construct was placed in our ROP1 expression vector (see Section 2) and introduced into 4R2DH by co-transfection with the HXGPRT selection plasmid pminiHXGPRTI (Donald et al., 1996). Following selection with MPA/ xanthine, the stable population was examined and the VSG localisation determined by IFA using co-localisation with known rhoptry proteins ROP2/3/4 (Sadak et al., 1988). The results (Fig. 1B) show that there is indeed no targeting of the VSG reporter to the rhoptries, although rather than being released into the vacuole, the VSG apparently was retained within a diffuse, reticular matrix within the cytoplasm, presumably the endoplasmic reticulum (ER). This staining was clearly distinct from the rhoptries as revealed by staining with antibodies to ROP2/3/4. As expected, expression levels varied among individual transformants, perhaps as a function of the number of copies inserted and/or the locus into which the insertion occurred. Essentially, the same ER-like staining was seen, however, independent of the expression levels (data not shown). The reasons for this staining pattern are not known, but they do not affect the interpretation of the experiments to follow because, for our purposes, what is critical is that VSG does not possess a fortuitous rhoptry-targeting signal. 3.2. Full-length ROP1 targets trypanosome VSG to the rhoptries We next needed to determine if a full-length ROP1/VSG fusion would localise to the rhoptries (i.e. to exclude that the VSG portion of the fusion might somehow prevent rhoptry targeting). To do this, a construct was generated in which VSG117 (34±471) was fused to the C-terminus of fulllength ROP1 via a two-amino acid linker encoded by the restriction site used in its construction (`ROP1VSG'; Fig. 2A). This was placed into the standard expression plasmid and introduced into 4R2DH. Upon selection of populations stably expressing the selectable HXGPRT marker, VSG localisation was determined by IFA using polyclonal antiVSG antibodies. As expected, some parasites had extremely high levels of expression and non-speci®c VSG staining, presumably due to overwhelming the secretory pathway as reported by others (data not shown; Hoppe et al., 2000). We restricted our analysis, therefore, to those parasites in which the VSG signal ranged from just detectable above background through to parasites in which the signal was strong but not overwhelming, and all ®gures show representative examples of such. The results (Fig. 2B) show that the ROP1VSG construct localises to club-shaped apical organelles characteristic of rhoptries and this staining co-localises with the rhoptry proteins ROP2/3/4 (Sadak et al., 1988). These results demonstrate that full-length ROP1 faithfully targets a Cterminal fusion partner of VSG117 to the rhoptries, con®rm-

ing the utility of this approach, in general, and the VSG reporter, in particular. ROP1 is secreted into the newly forming PV during the early stages of host cell invasion, but then becomes undetectable in the PV shortly thereafter (Saffer et al., 1992). To determine if our ROP1VSG fusion is also secreted upon invasion, we assessed the location of the ROP1VSG fusion during an invasion assay in which parasites are allowed to settle on host cells (but do not invade) at 08C, then warmed to 378C brie¯y to allow invasion to proceed, ®xed and localisation is then assessed by IFA. Prior to invasion, ROP1VSG is located in structures characteristic of the rhoptries at the apical end of the parasite (Fig. 2C, panel 1). After warming to 378C, parasites can be detected in the process of invasion by an obvious constriction at the point of entry into the host cell (Fig. 2C, panel 2, arrow). In such parasites, ROP1VSG staining is strikingly different, localising to the forming PV beginning just at the constriction point. In parasites that have completed invasion, this staining extends around the circumference of the parasite, consistent with release into the newly formed, closely apposed PV (Fig. 2C, panel 3). Apical staining can also often be detected within newly invading parasites, indicating that not all of the contents of the rhoptries are secreted upon invasion. These data indicate that the ROP1VSG fusion is secreted by newly invading parasites as observed for wild-type ROP1 (Saffer et al., 1992). 3.3. Mature ROP1 is not necessary for targeting VSG to the rhoptries We have previously shown that the ROP1 pro region is not necessary for rhoptry targeting, indicating that a ROP1targeting signal is located in the mature region of the protein (Soldati et al., 1998). To delimit this targeting signal, we therefore carried out a deletion analysis of ROP1 whereby segments were progressively removed from its C-terminus before fusing to the VSG reporter. Surprisingly, we ®nd that essentially the entire mature region can be deleted and yet rhoptry targeting of the VSG fusion partner is maintained (data not shown). The most extreme example of this is shown in Fig. 3. In this experiment, the fusion (`ROP1± 87VSG') is comprised of the ROP1 signal sequence and pro region followed by only four amino acids of the mature protein (to preserve the area surrounding the pro-mature cleavage site) fused to the VSG reporter (Fig. 3A). Expression of this construct and localisation by IFA revealed that the VSG reporter is targeted to apical club-shaped structures consistent with rhoptry staining (Fig. 3B, arrow). Co-staining with anti-ROP2/3/4 demonstrated that the ROP1(1± 87)VSG fusion fully overlaps the staining for this protein, con®rming rhoptry localisation, although the VSG signal also extended into and was apparently more concentrated in the apical tips (or `necks') of the rhoptries. Endogenous ROP1 is not normally detected in the rhoptry necks (Saffer et al., 1992). To determine whether this

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

extended staining was in fact within the rhoptry necks or some other compartment distinct from the rhoptries, colocalisation was carried out with the rhoptry neck-staining antibody A3H9 (Morrissette et al., 1994). A3H9 co-localised with the most apical portion of the ROP1(1±87)VSG staining (Fig. 3C), con®rming that the fusion does indeed extend further into the rhoptry necks than does ROP2/3/4. We conclude from these results that the ROP1(1±87)VSG fusion is targeted to the entire length of the rhoptries and that mature ROP1 is not necessary for rhoptry targeting. One possible reason for this neck localisation could be that the pro region is not removed from the ROP1(1± 87)VSG fusion protein, even though the processing site (between residues 83 and 84) was deliberately ¯anked by four amino acids of mature ROP1 to avoid such a problem. To address whether processing is nevertheless signi®cantly affected, we prepared lysates from parasites stably expressing ROP1(1±87)VSG and a smaller fusion construct in which the entire processing site has been deleted along with a further 32 amino acids of the pro region (ROP1(1± 51)VSG) and analysed the mobility of the fusions by SDS± PAGE (Fig. 3D). Western blot analysis using anti-VSG polyclonal antibodies of the ROP1(1±51)VSG fusion shows a single band migrating at ,58 kDa, as expected for this fusion lacking the processing site (lane 1). This band lies in between the two bands seen in the ROP(1± 87)VSG lysate (lane 2), a major immunoreactive band at ,55 kDa and a minor band at ,62 kDa. The ,7 kDa difference in migration and relative abundance (compared with that seen for wt ROP1 processing (Soldati et al., 1998)) of the two forms of the ROP1(1±87)VSG protein is in good agreement with what would be expected from the removal of the 62-amino acid ROP1 pro region (calculated MW, 6700). The two forms also migrate the expected distance from the ROP1(1±51)VSG reference (3.6 kDa from the larger band and 3.1 kDa from the smaller band), further supporting that these proteins do represent unprocessed and processed ROP1(1±87)VSG. These results strongly argue that ROP1(1±87)VSG is processed by accurate removal of the ROP1 pro region, essentially excluding this as the explanation for localisation of ROP1(1± 87)VSG to the rhoptry necks. Other possible reasons for shifting of a signi®cant portion of the ROP1 signal to rhoptry necks are discussed below. 3.4. The ROP1 promoter and signal sequence are not necessary for rhoptry targeting (ROP28±87 is suf®cient for rhoptry targeting) To allow for the possibility that the timing of expression is critical for targeting (as reported for Plasmodium AMA1; Crewther et al., 1990), we deliberately made the expression constructs described above using the ROP1 promoter and UTRs. However, these regions might not only be necessary for ef®cient rhoptry targeting, but might actually be suf®cient for this process. To exclude a role of the ROP1 promo-

1183

ter and signal sequence in targeting, we made a construct in which the ROP1 promoter and signal sequences were replaced by those of the Toxoplasma surface antigen SAG1. The construct SAG1(1±33)ROP1(28±87)VSG contains the SAG1 promoter and 5 0 -UTR followed by the region encoding the SAG1 signal sequence (amino acids 1± 33), amino acids 28±87 of ROP1, and then, the VSG reporter (Fig. 4A). The construct was expressed in the ROP1 knock-out and localisation was assessed by staining for VSG and ROP2/3/4. The results (Fig. 4B) show that SAG1(1±33)ROP1(28±87)VSG localises to the rhoptries, with a concentration in the rhoptry necks just apical to ROP2/3/4 in a staining pattern indistinguishable from that seen for ROP1(1±87)VSG. We conclude, therefore, that the ROP1 pro region (plus four amino acids of the mature protein) is suf®cient for targeting VSG to the rhoptries and that neither the ROP1 promoter nor the ROP1 signal sequence are necessary for such targeting. 3.5. The ®rst 51 amino acids of ROP1 are not suf®cient for rhoptry targeting To determine whether smaller regions of the ROP1 pro sequence are suf®cient for targeting to the rhoptries, we constructed a further C-terminal deletion into the ROP1 pro region. Approximately half of the pro region (amino acids 52±87) has been removed in the construct ROP1(1± 51)VSG (Fig. 5A). IFA analysis of parasites transfected with this construct showed reticular localisation of VSG throughout the cytoplasm that is consistent with these proteins being arrested in the secretory pathway (Fig. 5B), similar to the result seen with ROP1(1±28)VSG (Fig. 1B). This pattern does not co-localise with ROP2/3/4 staining in the same parasites and indicates that the C-terminal half of the pro region is necessary for targeting. 4. Discussion The identi®cation of the protein constituents of the specialised secretory organelles involved in the invasion of T. gondii into its host has resulted in recent interest in determining the signals that target these proteins to their correct intracellular location (Dubremetz et al., 1998; Kaasch and Joiner, 2000; Liendo and Joiner, 2000; Ngo et al., 2000). Transmembrane-containing rhoptry proteins such as ROP2 have been shown to possess tyrosine-based rhoptry-targeting signals located in the cytoplasmic tail of these proteins (Hoppe et al., 2000). To determine regions of ROP1 that are necessary and suf®cient for rhoptry targeting, we constructed a fusion between full-length ROP1 and a portion of the trypanosome VSG protein and shown that this fusion is correctly targeted to the rhoptries. The fact that the C-terminal fusion of a reporter protein to ROP1 does not interfere with targeting is in agreement with studies in which the green ¯uorescent protein (GFP) has been fused to ROP1 and is successfully targeted to the rhoptries (Strie-

1184

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

pen et al., 1998). In addition, the ROP1VSG fusion appears to be secreted into the PV early during invasion, demonstrating that the VSG fusion does not signi®cantly interfere with this process. Intracellular staining of the rhoptries in parasites which have recently invaded host cells is consistent with published results demonstrating that not all of the contents of the rhoptries are secreted during a single invasion event (Saffer et al., 1992). Attempts to de®nitively demonstrate vacuolar localisation by saponin permeabilisation were unsuccessful due to failed selective permeabilisation in our experiments. We have previously shown that the pro-mature processing site is between E83 and A84 in the ROP1 protein (Bradley and Boothroyd, 1999). Knowing the exact limit of the pro region makes it possible to design constructs that address the role of this portion of the protein in rhoptry protein targeting, and ultimately, in ROP1 function. Although our previous results demonstrated that the ROP1 pro sequence is not necessary for rhoptry targeting (Soldati et al., 1998), we ®nd that, surprisingly, the pro region (plus four amino acids of the mature protein) is nevertheless suf®cient for this process. Combined with the results showing that a ROP1 deletion construct lacking the pro region is faithfully targeted (Soldati et al., 1998), we can conclude that there are at least two signals that can function in targeting of the ROP1 protein, one within the pro domain (shown here) and one within the mature portion of the protein (Soldati et al., 1998). It is possible that either (or both) of these signals function by interacting with another rhoptry protein that is itself targeted to the rhoptries, although no ROP1 interacting proteins have been identi®ed by immunoaf®nity puri®cation of ROP1 (Bradley and Boothroyd, 1999). Examples where one protein containing a targeting signal is responsible for targeting interacting proteins have been identi®ed in rhoptry-targeted proteins in Plasmodium (Baldi et al., 2000) and microneme-targeted proteins in Toxoplasma (Reiss et al., 2001). Note, however, that since the constructs described here are expressed in a ROP1 knock-out strain, we can exclude the possibility that targeting is mediated by interaction with endogenous ROP1. It is interesting that the localisation of VSG fusion proteins targeted by just the ROP1 pro domain (ROP1(1± 87)VSG and SAG1(1±33)ROP1(28±87)VSG) localise to both the body of the rhoptries and (more prominently) to the rhoptry necks. Although EM reveals no obvious physical barrier between the mottled rhoptry body and electrondense rhoptry neck, proteins that localise speci®cally to the rhoptry necks have been reported in both Toxoplasma (Morrissette et al., 1994) and Plasmodium (Crewther et al., 1990; Sam-Yellowe et al., 1995). Rhoptry neck localisation in constructs lacking mature ROP1 may be a consequence of the loss of mature ROP1 (e.g. if the mature portion of ROP1 normally gets held up in the bulb through binding to other components in this compartment), the exposure of a positive targeting signal to the rhoptry necks in the absence of mature ROP1, an active neck-targeting function for the

pro region which might normally be removed too quickly to produce this effect and/or a peculiarity of the ROP1(1± 87)VSG fusion. The possibility that endogenous ROP1 is normally within the necks but just not detectable with antiROP1 reagents is argued against by the fact that the fulllength ROP1VSG fusion shows little or no staining of the necks using the same anti-VSG antibodies that strongly see the necks when staining for the ROP1(1±87)VSG fusion. Failure to remove the pro region also seems unlikely to play a role in this localisation as ROP1(1±87)VSG is apparently correctly processed, although altered localisation due to subtle changes in processing rate or ef®ciency cannot be excluded. Identi®cation of the mechanism by which endogenous rhoptry neck proteins are properly targeted to the correct intraorganellar location will help choose between the possible explanations for rhoptry neck localisation of ROP1(1±87)VSG. AMA1 has been reported to be a rhoptry protein in Plasmodium falciparum (Crewther et al., 1990). Correct targeting of AMA1 has been shown to be dependent on the promoter that drives its expression, suggesting that the timing of expression of rhoptry proteins is essential to targeting (Kocken et al., 1998). In Toxoplasma, rhoptry biosynthesis is believed to occur largely during daughter cell development which represents only a small fraction of the 6±8 h long endodyogeny cycle (Dubremetz, 1995). Thus, expression at inappropriate times might well result in mis-targeting because the cell is not set up for traf®cking proteins to this particular compartment. Speci®c signal sequences have also been suggested to play a role in targeting to different intracellular locations (Wiser et al., 1997; Martoglio and Dobberstein, 1998). To exclude the possibility that promoter or signal sequence plays a role in rhoptry targeting in the ROP1 protein of Toxoplasma, we replaced the ROP1 promoter and signal sequence with those of a cell surface (and non-rhoptry) protein, SAG1. Similar localisation could be seen regardless of promoter and signal sequence, demonstrating that these regions are not necessary and that the pro region (plus residues 84±87 of the mature protein) is suf®cient for targeting to the rhoptries. Further deletions into the ROP1 pro region using the constructs ROP1(1±51)VSG and ROP1(1±28)VSG resulted in fusion proteins that were not targeted to the rhoptries, but appeared to be arrested in the secretory pathway. These results could be due to deletion or disruption of the rhoptry-targeting signal within the ROP1 pro region, however, we cannot rule out that misfolding of these fusions results in hiding a targeting signal within the remaining pro sequence. While this manuscript was in preparation, similar studies were described by Striepen et al. using GFP as the reporter (Striepen et al., 2001). They also reached the overall conclusion that the pro region of ROP1 comprises a second rhoptry-targeting signal. They were not, however, able to exclude a role for the pre sequence which, for all relevant constructs was from ROP1. No GFP staining was seen in the rhoptry necks when fused to ROP1(1±85). This contrasts

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

with the results reported here and could re¯ect a difference in sensitivity of detection and/or in the reporter used. Our efforts to use other reporters (GFP and alkaline phosphatase) gave no useful results (either no detection of the fusion or failure to pass through the ER) and so we cannot currently explain this minor discrepancy. Further exploration of the common conclusion reached by both groups, that two targeting signals exist on ROP1, will await a better understanding of the molecules with which ROP1 interacts, both as regards the traf®cking machinery per se and the other components of the rhoptries with which it may interact en route to its ®nal destination. Acknowledgements The authors gratefully acknowledge Jean-Francois Dubremetz for the anti-ROP2/3/4 monoclonal antibody 4A7 and for help with the interpretation of the data, Naomi Morrisette and David Roos for the monoclonal antibody A3H9, Richard Sutton for polyclonal anti-VSG antibodies, and members of the Boothroyd lab for helpful comments and advice. This work was supported by grants from the NIH to J.C.B. (#RO1-AI 21423) and P.J.B. (#T32AI07328-10) and from the American Cancer Society (PF99-018-01-MBC) to P.J.B. References Baldi, D.L., Andrews, K.T., Waller, R.F., Roos, D.S., Howard, R.F., Crabb, B.S., Cowman, A.F., 2000. RAP1 controls rhoptry targeting of RAP2 in the malaria parasite Plasmodium falciparum. EMBO J. 19 (11), 2435± 43. Bangs, J.D., Uyetake, L., Brickman, M.J., Balber, A.E., Boothroyd, J.C., 1993. Molecular cloning and cellular localization of a BiP homologue in Trypanosoma brucei. Divergent ER retention signals in a lower eukaryote. J. Cell. Sci. 105 (Pt. 4), 1101±13. Bangs, J.D., Brouch, E.M., Ransom, D.M., Roggy, J.L., 1996. A soluble secretory reporter system in Trypanosoma brucei. Studies on endoplasmic reticulum targeting. J. Biol. Chem. 271 (31), 18387±93. Black, M., Seeber, F., Soldati, D., Kim, K., Boothroyd, J.C., 1995. Restriction enzyme-mediated integration elevates transformation frequency and enables co-transfection of Toxoplasma gondii. Mol. Biochem. Parasitol. 74 (1), 55±63. Bradley, P.J., Boothroyd, J.C., 1999. Identi®cation of the pro-mature processing site of Toxoplasma ROP1 by mass spectrometry. Mol. Biochem. Parasitol. 100 (1), 103±9. Carruthers, V.B., Sibley, L.D., 1997. Sequential protein secretion from three distinct organelles of Toxoplasma gondii accompanies invasion of human ®broblasts. Eur. J. Cell Biol. 73 (2), 114±23. Crewther, P.E., Culvenor, J.G., Silva, A., Cooper, J.A., Anders, R.F., 1990. Plasmodium falciparum: two antigens of similar size are located in different compartments of the rhoptry. Exp. Parasitol. 70 (2), 193±206. Dobrowolski, J.M., Sibley, L.D., 1996. Toxoplasma invasion of mammalian cells is powered by the actin cytoskeleton of the parasite. Cell 84 (6), 933±9. Dobrowolski, J.M., Carruthers, V.B., Sibley, L.D., 1997. Participation of myosin in gliding motility and host cell invasion by Toxoplasma gondii. Mol. Microbiol. 26 (1), 163±73. Donald, R.G., Carter, D., Ullman, B., Roos, D.S., 1996. Insertional tagging, cloning, and expression of the Toxoplasma gondii hypoxanthine±

1185

xanthine±guanine phosphoribosyltransferase gene. Use as a selectable marker for stable transformation. J. Biol. Chem. 271 (24), 14010±9. Dubremetz, J.F., 1995. Toxoplasma gondii: cell biology update. In: Boothroyd, J.C., Komuniecki, R. (Eds.), Molecular Approaches to Parasitology, Vol. 12. Wiley±Liss, New York, pp. 345±58. Dubremetz, J.F., Schwartzman, J.D., 1993. Subcellular organelles of Toxoplasma gondii and host cell invasion. Res. Immunol. 144 (1), 31±33. Dubremetz, J.F., Garcia-Reguet, N., Conseil, V., Fourmaux, M.N., 1998. Apical organelles and host-cell invasion by Apicomplexa. Int. J. Parasitol. 28 (7), 1007±13. Frenkel, J.K., 1973. Toxoplasmosis: parasite life cycle, pathology and immunology. In: Hammond, D.M., Long, P.L. (Eds.), The Coccidia. University Park Press, Baltimore, MD, pp. 343±410. Hoppe, H.C., Ngo, H.M., Yang, M., Joiner, K.A., 2000. Targeting to rhoptry organelles of Toxoplasma gondii involves evolutionarily conserved mechanisms. Nat. Cell Biol. 2 (7), 449±56. Hsia, R., Beals, T., Boothroyd, J.C., 1996. Use of chimeric recombinant polypeptides to analyse conformational, surface epitopes on trypanosome variant surface glycoproteins. Mol. Microbiol. 19 (1), 53±63. Joiner, K.A., Dubremetz, J.F., 1993. Toxoplasma gondii: a protozoan for the nineties. Infect. Immun. 61 (4), 1169±72. Jones, T.C., Hirsch, J.G., 1972. The interaction between Toxoplasma gondii and mammalian cells. II. The absence of lysosomal fusion with phagocytic vacuoles containing living parasites. J. Exp. Med. 136 (5), 1173± 94. Kaasch, A.J., Joiner, K.A., 2000. Protein-targeting determinants in the secretory pathway of apicomplexan parasites. Curr. Opin. Microbiol. 3 (4), 422±8. Karsten, V., Qi, H., Beckers, C.J., Joiner, K.A., 1997. Targeting the secretory pathway of Toxoplasma gondii. Methods 13 (2), 103±11. Kim, K., Bulow, R., Kampmeier, J., Boothroyd, J.C., 1994. Conformationally appropriate expression of the Toxoplasma antigen SAG1 (p30) in CHO cells. Infect. Immun. 62 (1), 203±9. Kocken, C.H., van der Wel, A.M., Dubbeld, M.A., Narum, D.L., van de Rijke, F.M., van Gemert, G.J., van der Linde, X., Bannister, L.H., Janse, C., Waters, A.P., Thomas, A.W., 1998. Precise timing of expression of a Plasmodium falciparum-derived transgene in Plasmodium berghei is a critical determinant of subsequent subcellular localization. J. Biol. Chem. 273 (24), 15119±24. Liendo, A., Joiner, K.A., 2000. Toxoplasma gondii: conserved protein machinery in an unusual secretory pathway? Microbes Infect. 2 (2), 137±44. Marks, M.S., Ohno, H., Kirchhausen, T., Bonifacino, J.S., 1997. Protein sorting by tyrosine-based signals: adapting the Y's and wherefores. Trends Cell Biol. 7 (3), 124±8. Martoglio, B., Dobberstein, B., 1998. Signal sequences: more than just greasy peptides. Trends Cell Biol. 8 (10), 410±5. Morrissette, N.S., Bedian, V., Webster, P., Roos, D.S., 1994. Characterization of extreme apical antigens from Toxoplasma gondii. Exp. Parasitol. 79 (3), 445±59. Ngo, H.M., Hoppe, H.C., Joiner, K.A., 2000. Differential sorting and postsecretory targeting of proteins in parasitic invasion. Trends Cell Biol. 10 (2), 67±72. Ossorio, P.N., Schwartzman, J.D., Boothroyd, J.C., 1992. A Toxoplasma gondii rhoptry protein associated with host cell penetration has unusual charge asymmetry. Mol. Biochem. Parasitol. 50 (1), 1±15. Reiss, M., Viebig, N., Brecht, S., Fourmaux, M., Soete, M., Di Cristina, M.M., Dubremetz, J., Soldati, D., 2001. Identi®cation and characterization of an escorter for two secretory adhesins in Toxoplasma gondii. J. Cell Biol. 152 (3), 563±78. Sadak, A., Taghy, Z., Fortier, B., Dubremetz, J.F., 1988. Characterization of a family of rhoptry proteins of Toxoplasma gondii. Mol. Biochem. Parasitol. 29 (2±3), 203±11. Saffer, L.D., Mercereau-Puijalon, O., Dubremetz, J.F., Schwartzman, J.D., 1992. Localization of a Toxoplasma gondii rhoptry protein by immunoelectron microscopy during and after host cell penetration. J. Protozool. 39 (4), 526±30.

1186

P.J. Bradley, J.C. Boothroyd / International Journal for Parasitology 31 (2001) 1177±1186

Sam-Yellowe, T.Y., Fujioka, H., Aikawa, M., Messineo, D.G., 1995. Plasmodium falciparum rhoptry proteins of 140/130/110 kd (Rhop-H) are located in an electron lucent compartment in the neck of the rhoptries. J. Eukaryot. Microbiol. 42 (3), 224±31. Schwartzman, J.D., 1986. Inhibition of a penetration-enhancing factor of Toxoplasma gondii by monoclonal antibodies speci®c for rhoptries. Infect. Immun. 51 (3), 760±4. Sibley, L.D., Weidner, E., Krahenbuhl, J.L., 1985. Phagosome acidi®cation blocked by intracellular Toxoplasma gondii. Nature 315 (6018), 416±9. Soldati, D., Kim, K., Kampmeier, J., Dubremetz, J.F., Boothroyd, J.C., 1995. Complementation of a Toxoplasma gondii ROP1 knock-out mutant using phleomycin selection. Mol. Biochem. Parasitol. 74 (1), 87±97. Soldati, D., Lassen, A., Dubremetz, J.F., Boothroyd, J.C., 1998. Processing

of Toxoplasma ROP1 protein in nascent rhoptries. Mol. Biochem. Parasitol. 96 (1±2), 37±48. Striepen, B., He, C.Y., Matrajt, M., Soldati, D., Roos, D.S., 1998. Expression, selection, and organellar targeting of the green ¯uorescent protein in Toxoplasma gondii. Mol. Biochem. Parasitol. 92 (2), 325±38. Striepen, B., Soldati, D., Garcia-Reguet, N., Dubremetz, J., Roos, D.S., 2001. Targeting of soluble proteins to the rhoptries and micronemes in Toxoplasma gondii. Mol. Biochem. Parasitol. 113 (1), 45±53. Tomley, F.M., Soldati, D.S., 2001. Mix and match modules: structure and function of microneme proteins in apicomplexan parasites. Trends Parasitol. 17 (2), 81±88. Wiser, M.F., Lanners, H.N., Bafford, R.A., Favaloro, J.M., 1997. A novel alternate secretory pathway for the export of Plasmodium proteins into the host erythrocyte. Proc. Natl. Acad. Sci. USA 94 (17), 9108±13.