The Proteinase-Activated Receptor-2 Mediates Phagocytosis in a Rho-Dependent Manner in Human Keratinocytes

ORIGINAL ARTICLE

The Proteinase-Activated Receptor-2 Mediates Phagocytosis in a Rho-Dependent Manner in Human Keratinocytes Glynis Scott, Sonya Leopardi, Lorelle Parker, Laura Babiarz, Miri Seiberg, and Rujiing Hanw

Department of  Dermatology and wPathology, University of Rochester, Rochester, New York, and Johnson and Johnson Skin Research Center, Skillman, New Jersey, USA

Recent work shows that the G-protein-coupled receptor proteinase activated receptor-2 activates signals that stimulate melanosome uptake in keratinocytes in vivo and in vitro. The Rho family of GTP-binding proteins is involved in cytoskeletal remodeling during phagocytosis. We show that proteinase-activated receptor-2 mediated phagocytosis in human keratinocytes is Rho dependent and that proteinase-activated receptor-2 signals to activate Rho. In contrast, Rho activity did not a¡ect either proteinase-activated receptor-2 activity or mRNA and protein levels. We explored the signaling mechanisms of proteinase-activated receptor-2 mediated Rho activation in human keratinocytes and show that activation of proteinase-activated receptor-2, either through speci¢c proteinase-activated receptor-2 activat-

ing peptides or through trypsinization, elevates cAMP in keratinocytes. Proteinase-activated receptor-2 mediated Rho activation was pertussis toxin insensitive and independent of the protein kinase A signaling pathway. These data are the ¢rst to show that proteinaseactivated receptor-2 mediated phagocytosis is Rho dependent and that proteinase-activated receptor-2 signals to Rho and cAMP in keratinocytes. Because phagocytosis of melanosomes is recognized as an important mechanism for melanosome transfer to keratinocytes, these results suggest that Rho is a critical signaling intermediate in melanosome uptake in keratinocytes. Key words: keratinocytes/melanosome/phagocytosis/ proteinase activated receptor. J Invest Dermatol 121:529 ^541, 2003

T

Melanosomes are organelles unique to melanocytes that contain the enzymes and structural proteins necessary for melanin synthesis. Melanosomes are transferred to keratinocytes in the epidermis and are then transported to the perinuclear region of the keratinocyte along microtubules where they act as a ‘‘cap’’ to protect the epidermis and dermis from ultraviolet light. It has long been recognized that a key mechanism in melanosome transfer to keratinocytes involves the process of phagocytosis (Wol¡ and Konrad, 1971; Wol¡, 1973; Okazaki et al, 1976; Yamamoto and Bhawan, 1994; Cario-Andre et al, 1999; Gibbs et al, 2000). The PAR-2 receptor has been shown to mediate melanosome uptake in human keratinocytes in vivo and in vitro. Seiberg et al (2000b) and Sharlow et al (2000) demonstrated that, in keratinocyte
melanocyte cocultures, PAR-2 activation induces melanosome transfer through increased keratinocytic phagocytosis of melanosomes. Electron micrographs of PAR-2-activated cells demonstrated complex membrane ru¥ing and plasma membrane extensions compared with control cells, and PAR-2 activation induced increased actin polymerization and a-actinin ¢lament organization beneath the plasma membrane (Sharlow et al, 2000). Activation of PAR-2 has also been demonstrated to alter pigmentation via modulation of melanosome uptake in vivo. Serine protease inhibitors that interfere with PAR-2 activation, such as soybean trypsin inhibitor, induced a concentration-dependent depigmentation of the skin of dark-skinned Yucatan swine. The inhibitors work by inhibiting melanosome transfer and distribution, which leads to skin lightening in vivo (Seiberg et al, 2000a). Moreover, inhibition of PAR-2 activation prevented ultraviolet-B-induced pigmentation both in vitro and in vivo (Seiberg et al, 2000a). We recently showed that PAR-2 receptor expression is increased in human skin and in cultured

he family of proteinase-activated receptors (PAR-1^ PAR- 4) are G-coupled transmembrane receptors that are activated by serine proteinases that cleave the extracellular amino terminal domain of the PAR and expose a tethered ligand that undergoes a conformational change with subsequent activation of the receptor (for review see Macfarlane et al, 2001). In HaCaT PAR-2 is activated by trypsin, mast cell tryptase, factor VIIa, or factor Xa, and by synthetic peptides that mimic the amino terminal portion of the receptor (Santulli et al, 1995; Schechter et al, 1998; Steinho¡ et al, 1999; Camerer et al, 2000). Like all G-coupled protein receptors, PAR have seven transmembrane domains and associate with heterotrimeric G-proteins. PAR-2 is involved in a broad spectrum of physiologic processes, including induction of cytokine and prostaglandin expression, mitogenesis, and in£ammatory responses (Mirza et al, 1997; Chi et al, 2001; Asokananthan et al, 2002). Northern blot analysis reveals that PAR-2 is expressed in the kidney, small intestine, stomach, and eye, skin, and vascular tissue (Nystedt et al, 1994; 1995; Smith-Swintosky et al, 1997; D’Andrea et al, 1998). PAR-2 activation stimulates mitogen-activated protein kinase in some cell types, resulting in proliferation, whereas in keratinocytes PAR-2 activation inhibits growth and di¡erentiation (Derian et al, 1997). Manuscript received February 17, 2003; revised March 26, 2003; accepted for publication April 7, 2003 Reprint requests to: Glynis Scott, Box 697, Department of Dermatology, University of Rochester School of Medicine, 601 Elmwood Avenue, Rochester, NY 14618, Email: [email protected] Abbreviations: GEF, guanine nucleotide exchange factor; PAR-2, proteinase-activated receptor-2.

0022-202X/03/$15.00 . Copyright r 2003 by The Society for Investigative Dermatology, Inc. 529

530

SCOTT ET AL

keratinocytes following ultraviolet irradiation (Scott et al, 2001). We also showed that ultraviolet-radiation-induced PAR-2 protein expression is attenuated in people who tan poorly (skin type I) compared with people who tan more easily (skin types II and III). Together these studies suggest that PAR-2 is a critical receptor involved in keratinocyte uptake of melanosomes. Phagocytosis is a receptor-mediated process in which large particles (40.5 mm) are taken into the cell and involves multiple complex signaling cascades that result in actin reorganization beneath the plasma membrane. Because of the central role of actin reorganization in phagocytosis, interest has recently focused on the Rho family of GTP-binding proteins in this process. The Rho family of GTP-binding proteins play a critical role in cytoskeletal organization, determination of cell polarity, cell
cell adhesion, cell cycle regulation, neurite outgrowth, apoptosis, exocytosis, and endocytosis (for review see Ridley, 2001). Similar to other small GTP-binding proteins, Rho proteins alternate between active (GTP-bound) and inactive (GDP-bound) forms, which are controlled by associated regulatory proteins. In most cell types RhoA mediates stress ¢ber formation (Ridley and Hall, 1992), Rac1 mediates membrane ru¥ing and lamellipodia formation (Ridley et al, 1992), and Cdc42 mediates ¢lopodia formation (Kozma et al, 1995). Accumulating evidence shows that Rho, Rac, and Cdc42 play critical roles in particle uptake in a variety of receptor-mediated phagocytic processes (Ahram et al, 2000; Chimini and Chavrier, 2000; Patel et al, 2000; Guzman-Verri et al, 2001; Linder et al, 2001; Beningo and Wang, 2002). Rac and Cdc42 control actin recruitment to the phagocytic cup during FcgR-mediated phagocytosis whereas Rho is required for actin assembly and phagocytosis mediated by activation of the C3 complement receptor (Olazabal et al, 2002; Patel et al, 2002). In the nonprofessional phagocytic Hela cell, Brucella internalization requires Rho GTP-binding proteins because inactivation of these proteins using clostridial toxins signi¢cantly reduced uptake of Brucella (Guzman-Verri et al, 2001). In this report we have studied the signaling mechanisms involved in PAR-2-dependent phagocytosis in human keratinocytes. We show that PAR-2-mediated phagocytosis is Rho dependent, because inhibition of Rho or its e¡ector Rho kinase inhibits PAR-2-induced phagocytosis in human keratinocytes. We also show that PAR-2 activates Rho following treatment with either PAR-2-activating peptides or trypsin in a pertussistoxin-independent manner. Finally, we examined the cellular second messenger signaling pathways of PAR-2-mediated Rho activation and show that PAR-2 signals downstream to elevate cAMP in a concentration- and time-dependent manner. Because protein kinase A (PKA) is a downstream target of cAMP we examined the e¡ect of PKA inhibition on PAR-2-dependent Rho activation and show that PAR-2-mediated Rho activation is independent of PKA. These studies shed new light on the mechanisms of PAR-2-mediated phagocytosis and point to Rho as a central signaling molecule in cutaneous pigmentation.

MATERIALS AND METHODS Reagents Rabbit polyclonal antibodies to RhoA were purchased from Santa Cruz Biotechnology (Santa Cruz, CA); rabbit polyclonal antibodies to Ga12 and Ga13 were purchased from Gramsch Laboratories (Schwabhausen, Germany); goat antibodies to human PAR-2 were purchased from Research Diagnostics (Flanders, NJ); horseradishperoxidase-conjugated antibodies against rabbit and goat immunoglobulins were purchased from Sigma (St Louis, MO). Pertussis toxin and H-89 were purchased from Sigma; Rp-8-C1-cAMPS were purchased from Biolog Life Science Institute (San Diego, CA). Full range rainbow molecular weight markers were purchased from Amersham Life Sciences (Arlington Heights, IL). Chamber slides were obtained from Nalge Nunc International (Naperville, IL). Vitrogen 100 was purchased from Cohesion (Palo Alto, CA); keratinocyte serum-free medium (SFM) was obtained from Gibco-BRL (Rockville, MD). Dulbecco’s modi¢ed Eagle’s medium (DMEM) and fetal bovine serum were purchased from CellGro

THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

(Herndon, VA). Toxin B and C3 exoenzyme were purchased from List Biologicals (Cambell, CA); Rho kinase inhibitor (Y27632) was purchased from Calbiochem (Darmstadt, Germany). Trizol was purchased from Gibco-BRL. Nile-Red-conjugated carboxylated microspheres (1 mM maximum dimension) were purchased from Molecular Probes (Eugene, OR). GST-Rhotekin conjugated to glutathione beads was purchased from Cytoskeleton (Denver, CO). The speci¢c PAR-2-activating peptide (SLIGRL-NH2) and its inactive control (ISLLRG-NH2) were synthesized by Research Genetics (Huntsville, AL). Peptide purity was greater than 95% as determined by high performance liquid chromatography. The cell growth determination kit (MTT based) was purchased from Sigma. The MTT cell proliferation assay is a colorimetric assay system that measures the reduction of a tetrazolium component (MTT) into an insoluble formazan product by the mitochondria of viable cells. After incubation of the cells with the MTT reagent for approximately 2^4 h, a detergent solution is added to lyze the cells and solubilize the colored crystals. The samples are read using an ELISA plate reader at a wavelength of 570 nm. The amount of color produced is directly proportional to the number of viable cells. Cells and cell culture Neonatal foreskins were obtained according to the University of Rochester Research Subjects Review Board guidelines and were the source of human keratinocytes. Epidermal suspensions were cultured in keratinocyte SFM as previously described (Scott and Haake, 1991). Human HaCaT (a gift from Dr N.E. Fusenig, Heidelberg, Germany) were maintained in DMEM in 10% fetal bovine serum. All cells were maintained at 371C in 5% CO2 (vol/vol). Adenoviral vectors Recombinant adenoviral vectors capable of expressing constitutively active Rho (V14Rho) and dominant negative Rho (N17Rho) were a generous gift of Dr James Bambara (University of Colorado, Denver, CO) and have been described previously (Brown et al, 2000). Each recombinant vector contains a cDNA for green £uorescence protein for monitoring infection e⁄ciency. Green £uorescence protein and Rho cDNAs were driven from separate CMV promoters. Quantitative microsphere-based phagocytosis assay Keratinocytes (105) cultured from white foreskins were subcultured onto vitrogen-100coated glass chamber slides, incubated overnight at 371C, and then treated with either daily doses of C3 exoenzyme for four consecutive days or Rho kinase inhibitor (Y27632) or Toxin B for 18 h. For experiments using C3 exoenzyme, carboxylate-modi¢ed £uorescent microspheres were added for the ¢nal 18 h of the incubation; for experiments using Y27632 and Toxin B, microspheres were added at the same time as the toxin inhibitor. Preliminary studies were performed to determine the optimum time point for phagocytosis of microspheres. We observed that in human keratinocytes and HaCaT approximately 40%^60% of cells had ingested beads at the end of an 18 h incubation period. This level of phagocytosis allowed us to evaluate changes in phagocytosis following treatment with toxins and adenoviruses (data not shown). In each case 100 microspheres per cell were added. Following the 18 h incubation the slides were washed three times with phosphate-bu¡ered saline, mounted with DAPIcontaining mounting medium (Vector Laboratories, Burlingame, CA), and analyzed on a Nikon immuno£uorescence E800 microscope equipped with a Spot digital camera (Diagnostics Instruments, Sterling Heights, MI). For experiments with adenoviral vectors expressing recombinant Rho proteins, cells were infected with a multiplicity of infection of 100 for 48 h. At this multiplicity of infection approximately 95% of cells are infected as determined by expression of green £uorescence protein. Microspheres were added for the last 18 h of the incubation and phagocytosis was assessed as described above. For quantitative analysis of microsphere uptake, 10 randomly chosen 60  ¢elds were analyzed for percentage of cells containing microspheres in a blinded manner. For each experiment duplicate wells were analyzed and the results were averaged. Each experiment was performed three times on keratinocyte cultures derived from Caucasian donors. A⁄nity precipitation of cellular GTP-Rho HaCaT were serum starved for 1 h prior to the addition of peptides or trypsin. Following treatment equal numbers of cells (approximately 2  107) were scraped into cold lysis bu¡er (50 mM Tris pH 7.5, 10 mM MgCl2, 0.2 M NaCl, 2% Nonidet P- 40, 10% sucrose) on ice and disrupted using a French Press. Lysates were precleared by incubation with glutathione beads. GSTRhotekin conjugated to glutathione beads (1 mg per ml) was added to the cleared lysates in binding bu¡er (50 mM Tris pH 7.5, 60 mM MgCl2, 80 mM NaCl, 1% Nonidet P- 40) for 30 min at 41C. GTP-bound proteins were pelleted, beads were washed with binding bu¡er, and GTP-bound protein was eluted with 2  Laemmli sample bu¡er. Samples were

VOL. 121, NO. 3 SEPTEMBER 2003

resolved on 15% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gels and blotted for Rho using standard procedures. To assess loading equality among di¡erent lysates a portion of each lysate was removed prior to the addition of GST-fusion protein and blotted for Rho. Visualization of the immunoreactive proteins was accomplished with an enhanced chemiluminescence reaction (Pierce, Rockford, IL). Densitometry analysis of blots was performed using NIH Image 1.62 software. Analysis of PAR-2 and Ga12/Ga13 protein expression For analysis of PAR-2 and Ga12/Ga13 expression, cells were lyzed in RIPA bu¡er (150 mM NaCl, 1% Nonidet P- 40, 0.5% deoxycholic acid (DOC), 0.1% SDS, 50 mM Tris
HCl) with protease inhibitors (Boehringer Mannheim, Germany). Protein was quantitated using bovine serum albumen as standard (Bio-Rad Laboratories, Hercules, CA) and protein was resolved on 10% SDS-PAGE gels and blotted using standard procedures with either goat polyclonal antibodies to human PAR-2 or rabbit polyclonal antibodies to Ga12 and Ga13. Visualization of the immunoreactive proteins was accomplished with an enhanced chemiluminescence reaction. Semiquantitative RT-PCR For analysis of PAR-2 mRNA content in HaCaT the OneSTEP RT-PCR kit (Qiagen Valencia, CA) was used on total RNA extracted with Trizol using the following primers: forward 50 TAGCAGCCTCTCTCTCCTGC 30; reverse 50 TGAAGATGGTCTGCTTGACG 30. These primers amplify a 606 kDa product. The program was 501C, 30 min; 951C, 15 min; 32 cycles of 941C for 50 s, 581C for 60 s, 721C for 90 s, 721C for 10 min, 41C. PCR products were resolved on a 1% agarose gel. Glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) message levels were used as a loading control. cAMP assay Cells (2.5 105 cells per well) were cultured in 12-well plates overnight and were serum starved for 1 h prior to treatment with peptides or trypsin. cAMP levels were measured using the Direct Cyclic AMP EIA kit (Assay Design, Ann Arbor, MI). The plate was read on a Finstrument microplate reader (MTX Laboratory, Vienna, VA) and the data were analyzed with Deltasoft 3 software (BioMetallics, Princeton, NJ) using a weighted four-parameter logistic curve-¢tting program. Protease and PAR-2 cleavage assay Total protease activity was measured using the EnzChek protease assay kit, following the manufacturer’s instructions (Molecular Probes). Samples were incubated with BODIPY £uorescent casein substrate at room temperature for 1 h and £uorescence was measured (excitation 485 nm/emission 530 nm) on a SpectraMax Gemini microtiter plate reader (Molecular Devices Corporation, Sunnyvale, CA) using Softmax Pro 3.0 software (Molecular Devices Corporation). Each experiment was performed in six replicates. The percent cleavage of the substrate by test samples was calculated and graphed using Microsoft Excel. A synthetic peptide comprising the cleavage site of the human PAR-2 (SKGRSLIGK), was labeled with the £uorophore pair Edans/Dabsyl (Advanced Bioconcept, Montreal, Canada), and was used as a substrate for PAR-2 serine protease activators. Cleavage of this peptide with PAR-2 activators such as trypsin could be detected £uorescently (excitation 335 nm/emission 515 nm). 100 mM peptide was incubated with test samples for 1 h at room temperature protected from light. Fluorescence was measured on a SpectraMax Gemini microtiter plate reader using Softmax Pro 3.0 software. Each experiment was performed in six replicates.

RESULTS PAR-2-mediated phagocytosis is Rho dependent in normal human keratinocytes To examine the role of Rho proteins in phagocytosis in keratinocytes we utilized bacterial toxins and a speci¢c inhibitor of the Rho downstream e¡ector Rho kinase and analyzed their e¡ects on phagocytosis of £uorescently coupled microspheres (1 mM in size). We also utilized adenoviral vectors expressing constitutively active or dominant negative inhibitors of Rho. We utilized microspheres as a model system because previous studies have established that keratinocytes phagocytize puri¢ed melanosomes and latex beads with the same kinetics (Virador et al, 2002). In these studies extent of latex bead and melanosome uptake was dictated by size alone. Further, electron micrographs of keratinocytes containing phagocytized beads and melanosomes showed that both are present within phagosomes. The experiments described below were performed

PAR-2-MEDIATED PHAGOCYTOSIS IN KERATINOCYTES

531

in both primary Caucasian keratinocytes (second and third passage) and in HaCaT with similar results. Data are shown for human keratinocytes. Bacterial toxins have been useful in elucidating the role of Rho family proteins in a variety of cellular processes. Toxins A and B, major virulence factors of Clostridium di⁄cile, inactivate all Rho family members (Rho, Cdc42, and Rac) through glycosylation of the protein (Just et al, 1995a; 1995b; 2000; 2001; Just and Boquet, 2000). Clostridium botulinum types C and D produce an ADP-ribosyltransferase, termed C3, that selectively inactivates Rho (Han et al, 2001). C3 exoenzyme speci¢cally recognizes Rho, but not Cdc42 or Rac, through six residues (Arg(5), Lys(6), Glu(40), Val(43), Glu(47), and Glu(54)) distributed over the N-terminal part of the protein (Wilde et al, 2000), which are involved in the correct binding of Rho to C3. Toxin B was added to keratinocytes cultured on chamber slides in the presence of £uorescently labeled microspheres for 18 h (Fig 1a). At a dose of 1.0 ng per ml Toxin B treatment resulted in a 1.20-fold decrease in microsphere uptake compared with control cells; treatment with 10 ng per ml Toxin B inhibited microsphere uptake by 1.7-fold. Because C3 exoenzyme is relatively impermeable to cell membranes (Borbiev et al, 2000), cells were treated for a more prolonged period of time (4d) to ensure adequate penetration of the toxin into the cells (Fig 1b). Fluorescently labeled microspheres were added for the ¢nal 18 h. C3 exoenzyme treatment resulted in a concentration-dependent inhibition of microsphere uptake by keratinocytes. Fifty-three percent of untreated cells had phagocytized microspheres at the end of the 18 h incubation period. C3 exoenzyme treatment inhibited phagocytosis (1.3 fold) at a dose of 0.1 ng per ml and at a dose of 10 ng per ml (1.45-fold). p160ROCK (Rho kinase) is a direct Rho target, which mediates Rho-induced assembly of focal adhesions and stress ¢bers (Kimura et al, 1996). Treatment of keratinocytes with the speci¢c p160ROCK inhibitor Y27632 (Uehata et al, 1997) for 18 h (0.5 mM) in the presence of microspheres inhibited uptake of microspheres by 0.9-fold and by 2-fold at a dose of 5 mM (Fig 1c). Y27632 inhibits both ROCKI and ROCKII by binding to the catalytic site of the enzyme and is speci¢c at a dose of 10 mM (Ishizaki et al, 2000). Similar results were seen in cells incubated with inhibitor for only 4 h (data not shown). Photographs of representative ¢elds of keratinocytes treated with either Y27632 (5.0 mM), C3 exoenzyme (1.0 ng per ml), or control cells are shown in Fig 1(d). In control cells microspheres are clearly intracellular as shown by their clustered distribution around the nucleus. In cells treated with either Y27632 or C3 exoenzyme fewer cells contain microspheres and those that do exhibit fewer microspheres per cell. To further verify the role of Rho in phagocytosis in keratinocytes, adenoviral vectors expressing constitutively active or dominant negative Rho proteins were tested for their ability to alter phagocytosis (Fig 1e). At a multiplicity of infection of 100 approximately 95% of cells are infected as monitored by green £uorescence protein. Expression of constitutively active Rho (V12Rho) increased microsphere uptake 16% compared with cells expressing empty vector. In contrast, cells expressing dominant negative Rho (N17Rho) resulted in a 26% decrease in microsphere uptake compared with empty vector expressing cells. To determine if PAR-2mediated phagocytosis is Rho dependent, keratinocytes were treated with Y27632 (5 mM) for 1 h and were then treated with SLIGRL-NH2 or ISLLRG-NH2 (50 mM) for 5 min. The medium was changed and fresh Y27632 was added along with microspheres (50 microspheres per cell). Four hours later slides were washed and microsphere uptake was quantitated (Fig 1f). Thirty-four percent of keratinocytes treated with the control ISLLRG-NH2 peptide had ingested Nile Red microspheres; in cells treated with SLIGRL-NH2, 48% of cells contained ingested beads. In keratinocytes treated with Y27632, however, the increase in phagocytosis induced by PAR-2 activation by SLIGRL-NH2 peptides was completely eliminated compared with non-Y27632-treated cells.

532

SCOTT ET AL

To exclude the possibility that the decrease in phagocytosis observed was due to toxicity e¡ects, keratinocytes were treated with either C3 exoenzyme for four consecutive days or with Y27632 or Toxin B for 18 h, and cell growth was determined using an MTT assay (Fig 2a
c). No decrease in cell viability was found following treatment with Toxin B (Fig 2a), C3

THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

exoenzyme (Fig 2b), or Y27632 (Fig 2c). Cell viability actually increased following treatment with Y27632 at all three doses tested, and following C3 exoenzyme with the highest dose tested. Based on these data we conclude that inhibition of Rho activity results in decreased phagocytosis in keratinocytes and that PAR-2-mediated phagocytosis is Rho dependent.

VOL. 121, NO. 3 SEPTEMBER 2003

Figure 2. Toxin B, C3 exoenzyme, and Y27632 do not diminish keratinocyte viability. Human keratinocytes were treated with Toxin B (18 h; A), C3 exoenzyme (4 d; B) or Y27632 (18 h; C), and cell viability was analyzed using an MTT assay. There was no decrease in cell viability following treatment with toxins or Y27632. Each bar represents the averaged results of triplicate wells 7SEM.

PAR-2-MEDIATED PHAGOCYTOSIS IN KERATINOCYTES

533

Activation of PAR-2 results in Rho activation Because inhibition of Rho abrogated the ability of PAR-2 activation to induce phagocytosis, we hypothesized that PAR-2 might signal downstream to activate Rho. It is known that receptors that transmit signals through heterotrimeric G-proteins activate Rho-dependent pathways through a variety of signaling intermediates (Fukuhara et al, 1999). Further, PAR-1 receptor signaling has been linked to Rho through the pertussis-toxininsensitive Ga12 family of proteins (Majumdar et al, 1998; Martin et al, 2001). Because the state of con£uence of epithelial cells determines Rho activity (Noren et al, 2001), for all experiments in which levels of Rho were analyzed cells were used at the same con£uence (approximately 80%). HaCaT were serum starved for 1 h and were treated with the speci¢c PAR-2 activating peptide SLIGRL-NH2 or its negative control peptide ISLLRG-NH2 at 50 mM for various time points (Fig 3a, b). GTPbound Rho was a⁄nity puri¢ed from cell lysates with GSTRhotekin. Although the degree of Rho activation varied between individual experiments, in all cases we observed an increase in GTP-Rho following treatment with activating peptides. Figure 3(a) shows a representative blot of HaCaT treated with activating peptides or negative control peptides for 5, 10, and 15 min. Densitometry analysis, normalized for loading, from the averaged results of two experiments showed a 1.2-fold increase in levels of GTP-bound Rho at 5 min of peptide treatment. At 10 min of PAR-2 stimulation GTP-Rho had increased 1.3 -fold over control levels and by 15 min GTP-Rho was increased 1.6 -fold over cells treated with inactive peptide. Activation of PAR-2 by trypsin involves the unmasking of the tethered peptide sequence S(37)LIGRL(42) that activates PAR-2 (Al-Ani et al, 2002). Serum-starved HaCaT cells were treated with trypsin (500 units per ml) in serum-free medium and GTP-bound Rho was analyzed (Fig 3b). Densitometry on blots, normalized for loading, from two experiments showed that GTPbound Rho was increased 1.8-fold at 2 min and 1.9-fold at 5 min compared with untreated cells. By 10 min GTP-Rho had returned to near control levels. We also examined the e¡ect of long-term exposure of HaCaT to PAR-2-activating peptides on Rho activation (Fig 3c). Serumstarved HaCaT incubated with activating peptides for 5 min and 30 min showed an increase in levels of GTP-Rho (1.6 -fold and 1.4 -fold, respectively) compared with ISLLRG-NH2-treated cells. By 1 h levels of GTP-Rho were equivalent in SLIGRLNH2- and ISLLRG-NH2-treated cells, but following 24 h of continuous exposure to activating peptides GTP-Rho was reduced (2.2-fold) compared with cells treated with ISLLRGNH2. After 72 h of exposure to PAR-2-activating peptides, GTP-Rho had returned to control levels. Inhibition of Rho does not alter PAR-2 message, protein, or activity levels We next determined whether Rho activity

Figure 1. PAR-2-mediated phagocytosis is Rho dependent in human keratinocytes. (A)
(C) Human keratinocytes were treated with Toxin B (18 h; A), C3 exoenzyme (4 d; B), or Y27632 (18 h; C), and uptake of Nile-Red-conjugated microspheres was analyzed following incubation with the microspheres for 18 h. There is a concentration-dependent decrease in phagocytosis under all three conditions. Asterisks indicate a statistically signi¢cant decrease (po0.002) determined using the Student’s t test. Results represent the average of three experiments performed in duplicate 7 SEM. (D) Representative photograph of keratinocytes treated with Y27632 (18 h), C3 exoenzyme (4 d), or vehicle control following an 18 h incubation with Nile-Red-conjugated microspheres. Approximately 50% of the untreated (control) cells contain clusters of phagocytized beads in a perinuclear distribution (arrow). In contrast, Y27632- and C3 -treated cells show many cells with no ingested microspheres, and a reduction in the number of microspheres in positive cells. Bar: 15 mm. (E) Keratinocytes were infected with adenovirus vectors expressing either constitutively active (V12Rho) or dominant negative (N17Rho) Rho recombinant proteins for 48 h. During the last 18 h cells were incubated with Nile-Red-conjugated microspheres. Sixty-eight percent of cells expressing V12Rho had ingested microspheres compared with empty vector expressing cells; cells expressing N17Rho had reduced (26%) phagocytosis of beads compared with empty vector expressing cells. Asterisks indicate a statistically signi¢cant change (po0.002) determined using the Student’s t test. Results represent the average of three experiments performed in duplicate 7SEM. (F) Keratinocytes were treated with either ISLLRG-NH2 or SLIGRL-NH2 (50 mM) for 5 min in the presence or absence of Y27632 (5 mM). Nile Red microspheres were added for a 4 h incubation in the presence of Y27632. Stimulation of PAR-2 by SLIGRL-NH2 resulted in an increase in microsphere uptake that was abrogated by the presence of the Rho kinase inhibitor Y27632. Results represent the average of four experiments, each performed in duplicate, 7SEM.

534

SCOTT ET AL

a¡ected either PAR-2 expression or activity level. HaCaT were treated with either Toxin B (1 ng per ml and 10 ng per ml) or Y27632 (1 mM and 5 mM) for 18 h and cell lysates were analyzed for levels of PAR-2 protein by western blot. In identical experiments semiquantitative RT-PCR was performed on total RNA extracted from treated cells for detection of PAR-2 mRNA. Western blots with antihuman PAR-2 antibodies showed no change in PAR-2 protein following treatment with Toxin B or Y27632; similarly, mRNA levels remained unaltered

THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

compared with nontreated cells (data not shown). Although a slight increase in total protease activity (maximal of 0.14 -fold; Fig 4a) and PAR-2-speci¢c protease activity (maximal of 0.13 fold; Fig 4b) was seen in cells treated with Y27632 (1 mM) these changes were not interpreted to be signi¢cant. PAR-2 signals through cAMP in HaCaT cells We next addressed the role of the cAMP second messenger pathway in PAR-2-mediated Rho activation. PAR-2 stimulation, through

VOL. 121, NO. 3 SEPTEMBER 2003

PAR-2-MEDIATED PHAGOCYTOSIS IN KERATINOCYTES

535

Figure 4. Rho activation has no e¡ect on PAR-2 activity levels. Total protease activity (A) and PAR-2 speci¢c protease activity (B) were analyzed from culture supernatants of HaCaT treated with Y27632 (1 mM or 5 mM) or Toxin B (1 ng per ml or 10 ng per ml) for 18 h. There was a slight (0.13 -fold) increase in PAR-2-speci¢c protease activity at the 1 mM and 5 mM dose of Y27632 compared with untreated cells, which was not interpreted to be signi¢cant. Each bar represents the averaged results of six wells 7SD. Shown are the averaged results of two experiments.

activating peptides or through trypsinization, resulted in a concentration- and time-dependent increase in cAMP (Fig 5a, b). Treatment of HaCaT with SLIGLR-NH2 at 50 mM resulted in an increase in cAMP at 1 min (4.5-fold); 100 mM of activating peptide resulted in a 9.2-fold increase in cAMP, and 200 mM of activating peptide resulted in a 35-fold increase in cAMP (Fig 5a). To determine the time course of the cAMP response,

HaCaT were treated with 50 mM SLIGRL-NH2 or the negative control peptide ISLLRG-NH2 and cAMP was assessed from 15 s to 10 min following treatment (Fig 5b). As early as 15 s there was a 1.8-fold increase in cAMP, which peaked at 1 min (4.6 -fold increase). cAMP levels were still elevated at 10 min (1.6 -fold). Changes in cAMP levels in HaCaT in response to trypsin treatment showed a similar trend (data not shown). At a dose of

Figure 3. PAR-2 stimulation activates Rho in HaCaT. (A) HaCaT were serum starved and treated with the inactive peptide ISLLRG-NH2 (I) or the PAR-2-speci¢c activating peptide SLIGRL-NH2 (S) at 50 mM, and activated Rho was a⁄nity puri¢ed from lysates using GST-Rhotekin and resolved by 15% SDS-PAGE. The total amount of Rho protein is shown in the lower gel. Densitometry normalized for sample loading shows a rapid induction of Rho activation at 5 min (1.2-fold) and 10 min (1.3 -fold), which increased to 1.6 -fold over control cells by 15 min. The blot is representative of two experiments; densitometry data are the average results of two experiments. (B) Serum-starved HaCaT were treated with trypsin (500 units per ml) and GTP-Rho was a⁄nity puri¢ed from cell lysates with GST-Rhotekin and resolved by 15% SDS-PAGE. The total amount of Rho protein is shown in the lower gel. Densitometry normalized for sample loading shows an increase in GTP-Rho at 2 min by 1.8-fold over control levels with a peak at 5 min (1.9-fold over control levels). The blot is representative of two experiments; densitometry data are the average results of two experiments. (C) Serum-starved HaCaT were treated with activating peptide SLIGRL-NH2 (S) or inactive peptide ISLLRG-NH2 (I) for up to 72 h and GTP-Rho was a⁄nity puri¢ed from cell lysates. The total amount of Rho protein is shown in the lower gel. Densitometry normalized for sample loading shows an increase in GTP-Rho with PAR-2 activation at 5 min and 30 min (1.6 -fold and 1.4 -fold, respectively). GTP-Rho returned to control levels at 1 h. Prolonged exposure of cells to activating peptides (24 h) resulted in a PAR-2-mediated decrease in GTP-Rho (2.2-fold). The blot is representative of two experiments; densitometry data are the average results of two experiments.

536

SCOTT ET AL

THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

Figure 5. PAR-2 increases cAMP in HaCaT. (A) Serum-starved HaCaT were treated with ISLLRG-NH2 or SLIGRL-NH2 at the indicated concentrations for 1 min, and cAMP levels were analyzed in cell lysates. cAMP was increased 4.5-fold in cells treated with activating peptides (50 mM) compared with control cells. At 100 mM and 200 mM of SLIGRL-NH2, cAMP increased 9.2-fold and 35-fold, respectively, compared with ISLLRG-NH2-treated cells. Asterisks indicate a statistically signi¢cant increase (p-value between 0.05 and 0.002) determined using the Student’s t test. Results represent the averaged results of three experiments 7 SEM. (B) To assess the time course of the cAMP response serum-starved HaCaT were treated with 50 mM ISLLRG-NH2 or SLIGRL-NH2 and cAMP levels were analyzed in cell lysates. At 15 s a 1.8-fold increase in cAMP was seen in cells treated with SLIGRL-NH2. cAMP levels peaked at 1 min (4.6 -fold increase) and were still elevated at 10 min (1.6 -fold over control levels). Asterisks indicate a statistically signi¢cant increase (p-value between 0.05 and 0.002). Results represent the averaged results of three experiments 7SEM.

trypsin of 50 units per ml, cAMP was elevated 3.7-fold over control levels, and the peak cAMP response occurred at a dose of 100 units per ml when cAMP levels were increased more than 5-fold compared with nontreated cells. PAR-2-mediated Rho activation is independent of PKA To determine if PAR-2-dependent Rho activation is mediated through PKA, serum-starved HaCaT were treated with the PKA inhibitors H-89 or Rp-8-Cl-cAMPS (15 mM and 4.5 nM, respectively) for 1 h prior to the addition of SLIGLR-NH2 or ISLLRG-NH2 (100 mM) for 5 min (Fig 6). Densitometry, normalized for loading, from two experiments showed a 2.8fold increase in GTP-Rho in SLIGRL-NH2-treated samples compared with ISLLRG-NH2-treated samples. Treatment with Rp-8-Cl-cAMPS or H-89 in the presence of inactive peptide

resulted in Rho activation by 1.5- and 2.7-fold, respectively, indicating that the PKA pathway is inhibitory to Rho activation in HaCaT. Pretreatment of cells with PKA inhibitors did not eliminate PAR-2-dependent Rho activation. From these data we conclude that PAR-2 signals downstream to stimulate cAMP production but that PAR-2-dependent Rho activation is independent of PKA in HaCaT cells. PAR-2-mediated Rho activation is pertussis toxin insensitive The family of Ga12 heterotrimeric G-proteins is ubiquitously expressed and consists of Ga12 and Ga13. They are known to be activated by a variety of di¡erent receptors such as PAR-1, thromboxane A2 receptor, and lysophosphatidic acid receptor (O¡ermanns et al, 1994; Gohla et al, 1998; Majumdar et al, 1999). It was shown that a guanine nucleotide exchange

VOL. 121, NO. 3 SEPTEMBER 2003

PAR-2-MEDIATED PHAGOCYTOSIS IN KERATINOCYTES

537

Figure 6. PAR-2-dependent Rho activation is independent of PKA. HaCaT were serum starved for 1 h in the presence or absence of the PKA inhibitors Rp-8 -Cl-cAMPS (Rp8) or H-89 and were treated with either ISLLRG-NH2 or SLIGRL-NH2 (100 mM) for 5 min; GTP-Rho was a⁄nity puri¢ed from cell lysates and resolved by 15% SDS-PAGE. Densitometry normalized for sample loading showed a 2.8-fold increase in GTP-Rho in SLIGRL-NH2-treated samples compared with ISLLRG-NH2-treated samples. Treatment with Rp-8-Cl-cAMPS or H-89 in the presence of inactive peptide resulted in Rho activation by 1.5- and 2.7-fold, respectively, indicating that the PKA pathway is inhibitory to Rho activation in HaCaT. Pretreatment of cells with PKA inhibitors did not eliminate PAR-2-dependent Rho activation.

factor (GEF) for Rho (p115 Rho GEF) is directly regulated by Ga13 in a pertussis-toxin-insensitive manner (Kozasa et al, 1998; Hart et al, 2000). We con¢rmed that HaCaT express both Ga12 and Ga13 by western blotting (data not shown). Steady state levels of Ga13 were higher than Ga12. We next determined whether PAR-2-dependent Rho activation was pertussis toxin sensitive. HaCaT were pretreated with pertussis toxin (100 ng per ml) overnight and were then serum starved for 1 h. Cells were treated with activating peptides (or inactive control peptides) at a concentration of 100 mM in the presence or absence of pertussis toxin for 5 min and GTP-bound Rho was isolated from cell lysates (Fig 7a). Cells treated with SLIGLR-NH2 showed the expected increase in GTP-Rho compared with ISLLRG-NH2treated cells (2.5-fold). Stimulation of PAR-2 by activating peptides in cells pretreated with pertussis toxin resulted in a 2.5fold increase in levels of Rho-GTP indicating that pertussis toxin did not abolish PAR-2-dependent Rho activation. Similar results were obtained in cells in which PAR-2 was activated with trypsin (Fig 7b). Treatment of HaCaT with trypsin (500 units per ml) for 2 min and 5 min resulted in a marked increase in levels of RhoGTP (2.2-fold) compared with untreated cells. Pretreatment of cells with pertussis toxin had no e¡ect on levels of trypsininduced Rho-GTP. From these data we conclude that PAR- 2mediated Rho activation is pertussis toxin insensitive. DISCUSSION

The PAR-2 receptor is important in skin pigmentation because PAR-2 activation results in increased uptake of melanosomes in vivo and in vitro through phagocytosis (Seiberg et al, 2000a; 2000b; Sharlow et al, 2000; Seiberg, 2001). Further evidence of

the importance of PAR-2 in skin pigmentation comes from studies in which PAR-2 receptor expression has been shown to be regulated by ultraviolet irradiation in vivo and in vitro (Scott et al, 2001). Melanosome phagocytosis by keratinocytes is recognized as an important mechanism of melanosome transfer in monolayer cultures and in three-dimensional skin constructs (Wol¡ and Konrad, 1971; Wol¡, 1973; Okazaki et al, 1976; Yamamoto and Bhawan, 1994; Cario-Andre et al, 1999; Gibbs et al, 2000). In this report we have examined the signaling mechanisms underlying PAR-2-mediated phagocytosis and show that Rho is a downstream mediator of PAR-2-stimulated phagocytosis in keratinocytes. Treatment of keratinocytes with Toxin B, C3 exoenzyme, or the Rho kinase inhibitor Y27632 inhibited phagocytosis of £uorescently coupled microspheres. The role of Rho in phagocytosis was further demonstrated by the use of adenoviral vectors expressing dominant negative or constitutively active Rho protein. Expression of dominant negative Rho protein inhibited microsphere uptake, whereas expression of constitutively active Rho protein stimulated microsphere uptake. Treatment of PAR-2-stimulated cells with Rho kinase inhibitor completely abrogated the increase in phagocytosis induced by PAR-2 activation. We used GST-conjugated Rhotekin to selectively isolate GTP-Rho from PAR-2-activated cells and show that PAR-2 activation induces a rapid increase in GTP-Rho.We also show that PAR-2 activation results in a rapid and concentration-dependent elevation in cAMP but that PAR-2-mediated Rho activation is not linked to the PKA signaling pathway because two PKA inhibitors did not eliminate PAR-2-mediated Rho activation. Finally, we show that PAR-2-dependent Rho activation is pertussis toxin insensitive. Rho is a central signaling molecule for cadherin junction formation in epithelial cells (Braga et al, 1997; Takaishi et al, 1997; Braga, 2000) and we have now demonstrated a role for Rho in

538

SCOTT ET AL

THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

Figure 7. PAR-2-mediated Rho activation is pertussis toxin insensitive. (A) HaCaT were treated with pertussis toxin (PT) for 18 h (100 ng per ml), serum starved for 1 h, and treated with either ISLLRGNH2 or SLIGRL-NH2 (100 mM) for 5 min; GTP-Rho was a⁄nity puri¢ed from cell lysates and resolved by 15% SDS-PAGE. Densitometry normalized for sample loading showed a 2.5-fold increase in GTP-Rho in cells treated with SLIGRL-NH2 (S) compared with cells treated with ISLLRG-NH2 (I). In cells pretreated with pertussis toxin prior to the addition of SLIGRL-NH2, a 3 -fold increase in GTP-Rho was seen indicating that PAR-2-dependent Rho activation is pertussis toxin insensitive. (B) HaCaT were treated with pertussis toxin for 18 h (100 ng per ml), serum starved for 1 h, and treated with trypsin (500 units per ml) for 2 min or 5 min; GTP-Rho was a⁄nity puri¢ed from cell lysates and resolved by 15% SDS-PAGE. Densitometry normalized for sample loading showed a 3 -fold increase in GTP-Rho in cells treated with trypsin for 2 min and 5 min compared with control cells. Pretreatment with pertussis toxin did not diminish Rho activation induced by trypsin.

PAR-2-mediated phagocytosis in human keratinocytes. Taken together these data suggest an important role for Rho in epidermal homeostasis and pigmentation. A role for Rho, Rac, and Cdc42 has emerged for several different receptor-mediated phagocytosis processes in both professional and nonprofessional phagocytes (Damke et al, 1995; Caron and Hall, 1998; Merri¢eld et al, 1999; Michaely et al, 1999; Chimini and Chavrier, 2000; Wiedemann et al, 2001). We analyzed phagocytosis of Nile-Red-conjugated microspheres in human keratinocytes in the presence of toxins that inhibit all Rho family members (Toxin B), selective inhibitors of Rho or the downstream Rho e¡ector Rho kinase (C3 exoenzyme and Y27632), or dominant negative Rho recombinant protein. Each of these treatments resulted in signi¢cant inhibition of microsphere uptake by keratinocytes and HaCaT. There is a large body of

work showing that the downstream e¡ects of G-protein-coupled receptors are dependent upon activation of Rho proteins (Seasholtz et al, 1999).We directly linked PAR-2-mediated phagocytosis with Rho by abrogating the ability of PAR-2 activation to stimulate microsphere uptake by pretreatment with Rho kinase inhibitor. These data demonstrate an important and speci¢c role for Rho in PAR-2-mediated phagocytosis in human keratinocytes and are consistent with observations of subplasma membrane actin remodeling in keratinocytes following PAR-2 stimulation (Sharlow et al, 2000). Cdc42 and Rac have both been implicated in phagocytosis (Caron and Hall, 1998; Patel et al, 2002) and PAR-2 activation has been shown to induce membrane ru¥ing in treated keratinocytes (Sharlow et al, 2000). Membrane ru¥ing is Rac dependent (Ridley et al, 1992) so it is possible that Rac or Cdc42 may also play a role in PAR-2-mediated

VOL. 121, NO. 3 SEPTEMBER 2003

phagocytosis. Such studies are beyond the scope of this report and will be the subject of future investigations. To directly determine whether Rho is a downstream target of PAR-2, we a⁄nity puri¢ed GTP-Rho from HaCaT treated with PAR-2-stimulating peptides or with trypsin. In both cases we observed a rapid increase in levels of activated Rho following treatment. Our results are similar to those of Klarenbach et al (2003) who recently showed that in endothelial cells stimulation of PAR-2 activates RhoA. Trypsin treatment stimulated a more robust activation of Rho than activating peptides, similar to its e¡ects on intracellular Ca2 þ , in which trypsin has been shown to be more potent than activating peptides (Bohm et al, 1996). Others have shown that prolonged exposure of PAR-2-expressing cells to trypsin reduces surface expression of PAR-2 to 50% of control levels after 10 min (Bohm et al, 1996), which could account for the diminution of Rho activation observed following treatment of HaCaT with trypsin for 10 min. Trypsin-induced activation of Rho probably occurs through PAR-2-dependent and PAR-2-independent pathways. Noren et al (2001) have shown that Rho activation is decreased in epithelial cells during adherins junction formation. It is possible that some of the trypsin-induced Rho activation observed in our experiments may be due to release of a Rho inhibitory factor during dissolution of adherins junctions by the action of trypsin. Prolonged exposure of cells (424 h) to activating peptides resulted in decreased Rho activation compared with control cells, which could also be due to receptor desensitization. This may be physiologically relevant because during in£ammation and wound healing keratinocytes would be exposed to mast cell tryptase for prolonged periods of time, which could downregulate cell surface PAR-2 expression. This could result in impaired melanosome uptake by keratinocytes and could contribute to postin£ammatory pigmentary abnormalities.We also determined whether the state of Rho activation a¡ected PAR-2 expression or activity. Cells in which Rho activation was blocked by Toxin B or C3 exoenzyme or with the Rho kinase inhibitor Y27632 showed no change in PAR-2 message or protein. Similarly, total protease activity and PAR-2-speci¢c protease activity were minimally altered in culture supernatants of cells in which Rho activity was inhibited. We have also observed that overexpression of constitutively active Rho has no e¡ect on PAR-2-speci¢c protease activity in HaCaT (unpublished observations). These data point to a unidirectional signaling from the PAR-2 receptor to Rho. The mechanisms by which PAR-2 activation signals to Rho are unclear and require further studies to de¢ne. The G-protein subunits linking G-protein receptors to Rho activation include Ga12/Ga13 and Gaq. Ga12 and its closely related family member Ga13 have been shown to act upstream of Rho GEF (Hart et al, 1998; Booden et al, 2002). Activated Ga13 binds to and activates Rho GEF p115. Gaq, Ga12, and Ga13 proteins induce the formation of stress ¢bers and activate serum response factor and apoptosis in ¢broblasts through activation of Rho (Buhl et al, 1995; Althoefer et al, 1997; Ponimaskin et al, 2000; Zohn et al, 2000). PAR-1-induced Rho activation has been linked to Ga12 (Majumdar et al, 1999). We demonstrate that keratinocytes express the Ga12 and Ga13 subunits and we show that PAR-2-mediated Rho activation is pertussis toxin insensitive. It is therefore possible that PAR-2-mediated Rho activation occurs through the pertussis-toxin-insensitive Ga12/Ga13 family of proteins, but further experiments using dominant negative inhibitors of Ga12/ Ga13 will be required to prove this. Analyses of the cellular signaling pathways that regulate PAR2-mediated e¡ects are limited. It is known that stimulation of PAR-2 induces inositol triphosphate generation and intracellular Ca2 þ mobilization through phospholipase C activation (Bohm et al, 1996). In human keratinocytes PAR-2 stimulates stress-activated protein kinase and inhibitory kB kinases in a protein-kinase-C-dependent manner (Santulli et al, 1995; Kanke et al, 2001). Because the cAMP/PKA pathway has been linked to modulation of Rho activation in several cell types (Laudanna et al, 1997; Dong

PAR-2-MEDIATED PHAGOCYTOSIS IN KERATINOCYTES

539

et al, 1998), we sought to determine if PAR-2 signals through cAMP, and if so whether Rho activation is PKA dependent. Experiments using PAR-2-activating peptides and trypsin show that PAR-2 signaling results in signi¢cant elevation of cAMP in a concentration- and time-dependent manner. This is in direct contrast with PAR-1, which has been shown to decrease cAMP levels through coupling to the pertussis-toxin-sensitive Gi2 protein (Kanthou et al, 1992; 1996). HaCaT have functional Gs because they respond to cholera toxin with a rapid elevation in cAMP (unpublished observations) suggesting that PAR-2 might couple to Gs to stimulate cAMP. Although further experiments will be required to identify the G-proteins that couple PAR-2, our preliminary studies suggest that the PAR-2-mediated increase in cAMP is pertussis toxin sensitive (unpublished observations). Epidermal cells express Gi-a proteins (Takahashi et al, 1990) and because PAR-2 is linked to Gi in other cell types, it is possible that the cAMP response is mediated by a pertussis-toxinsensitive bg e¡ect acting on bg-sensitive adenylate cyclase isoforms that stimulate adenylate cyclase (Gao and Gilman, 1991; Tang and Gilman, 1991). The role of cAMP in PAR-2-mediated e¡ects will require more study to de¢ne. In epidermal cells PAR-2 inhibits cellular proliferation and di¡erentiation and mediates cytokine release through mechanisms that are just now being de¢ned (Derian and Eckardt, 1997; Derian et al, 1997). In many cell types elevation of cAMP levels results in growth inhibition (Stork and Schmitt, 2002). Because of the central role of the cAMP second messenger pathway in diverse cellular processes, PAR-2-dependent changes in keratinocyte growth and di¡erentiation may be linked to its e¡ects on cAMP levels. Activation of PKA is a major downstream e¡ect of elevated cAMP. To determine if the PKA system plays a role in PAR-2mediated Rho activation we stimulated PAR-2 in the presence or absence of two di¡erent PKA inhibitors and analyzed levels of Rho GTP. The data show that inhibition of PKA in control cells activates Rho, suggesting that in HaCaT the PKA pathway is inhibitory to Rho activation. A recent report shows that PKA directly phosphorylates Ga13 in the switch 1 region of the protein, resulting in Rho inactivation (Manganello et al, 2002). It is possible that in HaCaT PKA phosphorylates and inactivates Ga13 with subsequent Rho inactivation. The PKA inhibitors did not suppress PAR-2-dependent Rho activation, however, which suggests that PAR-2 activates a parallel and distinct pathway that results in Rho activation. Because our data show PAR-2 signals to increase cAMP, we conclude that PAR-2 activates pathways that are both inhibitory (cAMP/PKA) and stimulatory to Rho activation and that the dominant pathway is Rho stimulatory. The ability of PAR-2 to activate distinct signaling pathways that are inhibitory and stimulatory to Rho activation may represent a mechanism to regulate PAR-2-mediated Rho activity in epidermal cells. Previous studies have shown that Rho plays a critical role in melanosome dendrite extension (Busca et al, 1998; Scott and Leopardi, 2003) and we have now shown that Rho mediates PAR-2-dependent phagocytosis. These data suggest that Rho plays an important role in cutaneous pigmentation. This work was supported by 5 RO1 AR45427-04 (GS).We gratefully acknowledge the useful discussion and critical comments by Dr Raymond Konger, Indiana University.

REFERENCES Ahram M, Sameni M, Qiu RG, Linebaugh B, Kirn D, Sloane BF: Rac1-induced endocytosis is associated with intracellular proteolysis during migration through a three dimensional matrix. Exp Cell Res 260:292^303, 2000 Al-Ani B, Wijesuriya SJ, Hollenberg MD: Proteinase-activated receptor 2: Di¡erential activation of the receptor by tethered ligand and soluble peptide analogs. J Pharmacol ExpTher 302:1046^1054, 2002 Althoefer H, Eversole-Cire P, Simon MI: Constitutively active Gaq and Ga13 trigger apoptosis through di¡erent pathways. J Biol Chem 272:24380^24386, 1997

540

SCOTT ET AL

Asokananthan N, Graham PT, Fink J, et al: Activation of protease-activated receptor (PAR)-1, PAR-2, and PAR- 4 stimulates IL- 6, IL-8, and prostaglandin E2 release from human respiratory epithelial cells. J Immunol 168:3577^3585, 2002 Beningo KA, Wang YL: Fc-receptor-mediated phagocytosis is regulated by mechanical properties of the target. J Cell Sci 115:849^856, 2002 Bohm SK, Khitin LM, Grady EF, Aponte G, Payan DG, Bunnett NW: Mechanisms of desensitization and resensitization of proteinase-activated receptor-2. J Biol Chem 271:22003^22016, 1996 Booden MA, Siderovski DP, Der CJ: Leukemia-associated Rho guanine nucleotide exchange factor promotes Gaq-coupled activation of RhoA. Mol Cell Biol 22:4053^4061, 2002 Borbiev T, Nurmukhambetova S, Liu F, Verin AD, Garcia JG: Introduction of C3 exoenzyme into cultured endothelium by lipofectamine. Anal Biochem 285:260^264, 2000 Braga V: Epithelial cell shape: Cadherins and small GTPases. Exp Cell Res 261:83^90, 2000 Braga VM, Machesky LM, Hall A, Hotchin NA: The small GTPases Rho and Rac are required for the establishment of cadherin-dependent cell
cell contacts. J Cell Biol 137:1421^1431, 1997 Brown MD, Cornejo BJ, Kuhn TB, Bamburg JR: Cdc42 stimulates neurite outgrowth and formation of growth cone ¢lopodia and lamellipoda. J Neurobiol 43:352^364, 2000 Buhl AM, Johnson NL, Dhanasekaran N, Johnson GL: Ga12 and Ga13 stimulate Rho-dependent stress ¢ber formation and focal adhesion assembly. J Biol Chem 270:24631^24634, 1995 Busca R, Bertolotto C, Abbe P, et al: Inhibition of Rho is required for cAMP-induced melanoma cell di¡erentiation. Mol Biol Cell 9:1367^1378, 1998 Camerer E, Huang W, Coughlin SR: Tissue factor- and factor X-dependent activation of protease-activated receptor 2 by factor VIIa. Proc Natl Acad Sci USA 97:5255^5260, 2000 Cario-Andre M, Bessou S, Gontier E, Maresca V, Picardo M, Taieb A: The reconstructed epidermis with melanocytes: A new tool to study pigmentation and photoprotection. Cell Mol Biol (Noisy-le-Grand) 45:931^942, 1999 Caron E, Hall A: Identi¢cation of two distinct mechanisms of phagocytosis controlled by di¡erent Rho GTPases. Science 282:1717^1721, 1998 Chi L, Li Y, Stehno- Bittel L, Gao J, Morrison DC, Stechschulte DJ, Dileepan KN: Interleukin- 6 production by endothelial cells via stimulation of protease-activated receptors is ampli¢ed by endotoxin and tumor necrosis factor-a. J Interferon Cytokine Res 21:231^240, 2001 Chimini G, Chavrier P: Function of Rho family proteins in actin dynamics during phagocytosis and engulfment. Nat Cell Biol 2:E191^E196, 2000 Damke H, Baba T, van der Bliek AM, Schmid SL: Clathrin-independent pinocytosis is induced in cells overexpressing a temperature-sensitive mutant of dynamin. J Cell Biol 131:69^80, 1995 D’Andrea MR, Derian CK, Leturcq D, et al: Characterization of protease-activated receptor-2 immunoreactivity in normal human tissues. J Histochem Cytochem 46:157^164, 1998 Derian CK, Eckardt AJ: Thrombin receptor-dependent prostaglandin E2 synthesis in hamster ¢broblasts: Synergistic interactions with interleukin-1b. Exp Cell Res 232:1^7, 1997 Derian CK, Eckardt AJ, Andrade-Gordon P: Di¡erential regulation of human keratinocyte growth and di¡erentiation by a novel family of protease-activated receptors. Cell Growth Di¡er 8:743^749, 1997 Dong JM, Leung T, Manser E, Lim L: cAMP-induced morphological changes are counteracted by the activated RhoA small GTPase and the Rho kinase ROKa. J Biol Chem 273:22554^22562, 1998 Fukuhara S, Murga C, Zohar M, Igishi T, Gutkind JS: A novel PDZ domain containing guanine nucleotide exchange factor links heterotrimeric G proteins to Rho. J Biol Chem 274:5868^5879, 1999 Gao BN, Gilman AG: Cloning and expression of a widely distributed (type IV) adenylyl cyclase. Proc Natl Acad Sci USA 88:10178^10182, 1991 Gibbs S, Murli S, De Boer G, Mulder A, Mommaas AM, Ponec M: Melanosome capping of keratinocytes in pigmented reconstructed epidermis ^ e¡ect of ultraviolet radiation and 3 -isobutyl-1-methyl-xanthine on melanogenesis. Pigment Cell Res 13:458^466, 2000 Gohla A, Harhammer R, Schultz G: The G-protein G13 but not G12 mediates signaling from lysophosphatidic acid receptor via epidermal growth factor receptor to Rho. J Biol Chem 273:4653^4659, 1998 Guzman-Verri C, Chaves-Olarte E, von Eichel-Streiber C, et al: GTPases of the Rho subfamily are required for Brucella abortus internalization in nonprofessional phagocytes: Direct activation of Cdc42. J Biol Chem 276:44435^44443, 2001 Han S, Arvai AS, Clancy SB,Tainer JA: Crystal structure and novel recognition motif of rho ADP-ribosylating C3 exoenzyme from Clostridium botulinum: Structural insights for recognition speci¢city and catalysis. J Mol Biol 305:95^107, 2001 Hart MJ, Jiang X, Kozasa T, et al: Direct stimulation of the guanine nucleotide exchange activity of p115 RhoGEF by Ga13. Science 280:2112^2114, 1998 Hart MJ, Roscoe W, Bollag G: Activation of Rho GEF activity by Ga13. Meth Enzymol 325:61^71, 2000 Ishizaki T, Uehata M, Tamechika I, Keel J, Nonomura K, Maekawa M, Narumiya S: Pharmacological properties of Y-27632, a speci¢c inhibitor of rho-associated kinases. Mol Pharmacol 57:976^983, 2000

THE JOURNAL OF INVESTIGATIVE DERMATOLOGY

Just I, Boquet P: Large clostridial cytotoxins as tools in cell biology. CurrTop Microbiol Immunol 250:97^107, 2000 Just I, Selzer J, Wilm M, von Eichel-Streiber C, Mann M, Aktories K: Glucosylation of Rho proteins by Clostridium di⁄cile toxin B. Nature 375:500^503, 1995a Just I, Wilm M, Selzer J, Rex G, von Eichel-Streiber C, Mann M, Aktories K: The enterotoxin from Clostridium di⁄cile (ToxA) monoglucosylates the Rho proteins. J Biol Chem 270:13932^13936, 1995b Just I, Hofmann F, Aktories K: Molecular mode of action of the large clostridial cytotoxins. CurrTop Microbiol Immunol 250:55^83, 2000 Just I, Hofmann F, Genth H, Gerhard R: Bacterial protein toxins inhibiting lowmolecular-mass GTP-binding proteins. Int J Med Microbiol 291:243^250, 2001 Kanke T, Macfarlane SR, Seatter MJ, Davenport E, Paul A, McKenzie RC, Plevin R: Proteinase-activated receptor-2-mediated activation of stress-activated protein kinases and inhibitory kB kinases in NCTC 2544 keratinocytes. J Biol Chem 276:31657^31666, 2001 Kanthou C, Parry G, Wijelath E, Kakkar VV, Demoliou-Mason C: Thrombin-induced proliferation and expression of platelet-derived growth factor-A chain gene in human vascular smooth muscle cells. FEBS Lett 314:143^148, 1992 Kanthou C, Kanse SM, Kakkar VV, Benzakour O: Involvement of pertussis toxinsensitive and -insensitive G proteins in a-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal 8:59^66, 1996 Kimura K, Ito M, Amano M, et al: Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273:245^248, 1996 Klarenbach SW, Chipiuk A, Nelson RC, Hollenberg MD, Murray AG: Di¡erential actions of PAR2 and PAR1 in stimulating human endothelial cell exocytosis and permeability: The role of Rho-GTPases. Circ Res 92:272^278, 2003 Kozasa T, Jiang X, Hart MJ, et al: p115 RhoGEF, a GTPase activating protein for Ga12 and Ga13. Science 280:2109^2111, 1998 Kozma R, Ahmed S, Best A, Lim L: The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and ¢lopodia in Swiss 3T3 ¢broblasts. Mol Cell Biol 15:1942^1952, 1995 Laudanna C, Campbell JJ, Butcher EC: Elevation of intracellular cAMP inhibits RhoA activation and integrin-dependent leukocyte adhesion induced by chemoattractants. J Biol Chem 272:24141^24144, 1997 Linder S, Heimerl C, Fingerle V, Aepfelbacher M, Wilske B: Coiling phagocytosis of Borrelia burgdorferi by primary human macrophages is controlled by CDC42Hs and Rac1 and involves recruitment of Wiskott^Aldrich syndrome protein and Arp2/3 complex. Infect Immun 69:1739^1746, 2001 Macfarlane SR, Seatter MJ, Kanke T, Hunter GD, Plevin R: Proteinase-activated receptors. Pharmacol Rev 53:245^282, 2001 Majumdar M, Seasholtz TM, de Goldstein D, Lanerolle P, Brown JH: Requirement for Rho-mediated myosin light chain phosphorylation in thrombin stimulated cell rounding and its dissociation from mitogenesis. J Biol Chem 273: 10099^10106, 1998 Majumdar M, Seasholtz TM, Buckmaster C, Toksoz D, Brown JH: A rho exchange factor mediates thrombin and Ga(12)-induced cytoskeletal responses. J Biol Chem 274:26815^26821, 1999 Manganello JM, Huang JS, Kozasa T, Voyno-Yasenetskaya TA, Le Breton GC: PKAmediated phosphorylation of Ga13 switch I region alters the Ga bg13 -GPCR complex and inhibits Rho activation. J Biol Chem 278:124^130, 2003 Martin CB, Mahon GM, Klinger MB, Kay RJ, Symons M, Der CJ, Whitehead IP: The thrombin receptor, PAR-1, causes transformation by activation of Rhomediated signaling pathways. Oncogene 20:1953^1963, 2001 Merri¢eld CJ, Moss SE, Ballestrem C, Imhof BA, Giese G, Wunderlich I, Almers W: Endocytic vesicles move at the tips of actin tails in cultured mast cells. Nat Cell Biol 1:72^74, 1999 Michaely PA, Mineo C, Ying YS, Anderson RG: Polarized distribution of endogenous Rac1 and RhoA at the cell surface. J Biol Chem 274:21430^21436, 1999 Mirza H, Schmidt VA, Derian CK, Jesty J, Bahou WF: Mitogenic responses mediated through the proteinase-activated receptor-2 are induced by expressed forms of mast cell a- or b-tryptases. Blood 90:3914^3922, 1997 Noren NK, Niessen CM, Gumbiner BM, Burridge K: Cadherin engagement regulates Rho family GTPases. J Biol Chem 276:33305^33308, 2001 Nystedt S, Emilsson K, Wahlestedt C, Sundelin J: Molecular cloning of a potential proteinase activated receptor. Proc Natl Acad Sci USA 91:9208^9212, 1994 Nystedt S, Emilsson K, Larsson AK, Strombeck B, Sundelin J: Molecular cloning and functional expression of the gene encoding the human proteinase-activated receptor 2. Eur J Biochem 232:84^89, 1995 O¡ermanns S, Laugwitz KL, Spicher K, Schultz G: G proteins of the G12 family are activated via thromboxane A2 and thrombin receptors in human platelets. Proc Natl Acad Sci USA 91:504^508, 1994 Okazaki K, Uzuka M, Morikawa F,Toda K, Seiji M: Transfer mechanism of melanosomes in epidermal cell culture. J Invest Dermatol 67:541^547, 1976 Olazabal I, Caron E, May R, Schilling K, Knecht D, Machesky L: Rho-kinase and myosin II control phagocytic cup formation during CR, but not FcgR, phagocytosis. Curr Biol 12:1413, 2002 Patel JC, Hall A, Caron E: Rho GTPases and macrophage phagocytosis. Meth Enzymol 325:462^473, 2000 Patel JC, Hall A, Caron E: Vav regulates activation of Rac but not Cdc42 during FcgR-mediated phagocytosis. Mol Biol Cell 13:1215^1226, 2002

VOL. 121, NO. 3 SEPTEMBER 2003

Ponimaskin E, Behn H, Adarichev V, Voyno-Yasenetskaya TA, O¡ermanns S, Schmidt MF: Acylation of Ga (13) is important for its interaction with thrombin receptor, transforming activity and actin stress ¢ber formation. FEBS Lett 478:173^177, 2000 Ridley AJ: Rho family proteins: Coordinating cell responses. Trends Cell Biol 11: 471^477, 2001 Ridley AJ, Hall A: The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress ¢bers in response to growth factors. Cell 70:389^399, 1992 Ridley AJ, Paterson HF, Johnston CL, Diekmann D, Hall A: The small GTPbinding protein rac regulates growth factor-induced membrane ru¥ing. Cell 70: 401^410, 1992 Santulli RJ, Derian CK, Darrow AL, et al: Evidence for the presence of a proteaseactivated receptor distinct from the thrombin receptor in human keratinocytes. Proc Natl Acad Sci USA 92:9151^9155, 1995 Schechter NM, Brass LF, Lavker RM, Jensen PJ: Reaction of mast cell proteases tryptase and chymase with protease activated receptors (PARs) on keratinocytes and ¢broblasts. J Cell Physiol 176:365^373, 1998 Scott GA, Haake AR: Keratinocytes regulate melanocyte number in human fetal and neonatal skin equivalents. J Invest Dermatol 97:776^781, 1991 Scott G, Leopardi S: The cAMP signaling pathway has opposing e¡ects on Rac and Rho in B16F10 cells: Implications for dendrite formation in melanocytic cells. Pigment Cell Res 16:139^148, 2003 Scott G, Deng A, Rodriguez-Burford C, et al: Protease-activated receptor 2, a receptor involved in melanosome transfer, is upregulated in human skin by ultraviolet irradiation. J Invest Dermatol 117:1412^1420, 2001 Seasholtz TM, Majumdar M, Brown JH: Rho as a mediator of G protein-coupled receptor signaling. Mol Pharmacol 55:949^956, 1999 Seiberg M: Keratinocyte^melanocyte interactions during melanosome transfer. Pigment Cell Res 14:236^242, 2001 Seiberg M, Paine C, Sharlow E, Andrade-Gordon P, Costanzo M, Eisinger M, Shapiro SS: Inhibition of melanosome transfer results in skin lightening. J Invest Dermatol 115:162^167, 2000a Seiberg M, Paine C, Sharlow E, Andrade-Gordon P, Costanzo M, Eisinger M, Shapiro SS: The protease-activated receptor 2 regulates pigmentation via keratinocyte
melanocyte interactions. Exp Cell Res 254:25^32, 2000b Sharlow ER, Paine CS, Babiarz L, Eisinger M, Shapiro S, Seiberg M: The proteaseactivated receptor-2 upregulates keratinocyte phagocytosis. J Cell Sci 113: 3093^3101, 2000

PAR-2-MEDIATED PHAGOCYTOSIS IN KERATINOCYTES

541

Smith-Swintosky VL, Cheo-Isaacs CT, D’Andrea MR, Santulli RJ, Darrow AL, Andrade-Gordon P: Protease-activated receptor-2 (PAR-2) is present in the rat hippocampus and is associated with neurodegeneration. J Neurochem 69:1890^ 1896, 1997 Steinho¡ M, Corvera CU, Thoma MS, et al: Proteinase-activated receptor-2 in human skin: Tissue distribution and activation of keratinocytes by mast cell tryptase. Exp Dermatol 8:282^294, 1999 Stork PJ, Schmitt JM: Crosstalk between cAMP and MAP kinase signaling in the regulation of cell proliferation. Trends Cell Biol 12:258^266, 2002 Takahashi H, Tamura T, Tsutsui M, Iizuka H: Adenylate cyclase system in fetal rat keratinizing epidermal cells (FRSK cells) and SV40-transformed human keratinocytes. J Dermatol 17:457^464, 1990 Takaishi K, Sasaki T, Kotani H, Nishioka H, Takai Y: Regulation of cell
cell adhesion by rac and rho small G proteins in MDCK cells. J Cell Biol 139:1047^1059, 1997 Tang WJ, Gilman AG: Type-speci¢c regulation of adenylyl cyclase by G protein bg subunits. Science 254:1500^1503, 1991 Uehata M, Ishizaki T, Satoh H, et al: Calcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension. Nature 389:990^994, 1997 Virador VM, Muller J, Wu X, et al: In£uence of a melanocyte stimulating hormone and ultraviolet radiation on the transfer of melanosomes to keratinocytes. Faseb J 16:105^107, 2002 Wiedemann A, Linder S, Grassl G, Albert M, Autenrieth I, Aepfelbacher M: Yersinia enterocolitica invasin triggers phagocytosis via b1 integrins, CDC42Hs and WASp in macrophages. Cell Microbiol 3:693^702, 2001 Wilde C, Genth H, Aktories K, Just I: Recognition of RhoA by Clostridium botulinum C3 exoenzyme. J Biol Chem 275:16478^16483, 2000 Wol¡ K: Melanocyte^keratinocyte interactions in vivo: The fate of melanosomes. Yale J Biol Med 46:384^396, 1973 Wol¡ K, Konrad K: Melanin pigmentation: An in vivo model for studies of melanosome kinetics within keratinocytes. Science 174:1034^1035, 1971 Yamamoto O, Bhawan J: Three modes of melanosome transfers in Caucasian facial skin: Hypothesis based on an ultrastructural study. Pigment Cell Res 7:158^169, 1994 Zohn IE, Klinger M, Karp X, Kirk H, Symons M, Chrzanowska-Wodnicka MCJ, Kay RJ: G2A is an oncogenic G protein-coupled receptor. Oncogene 19:3866^ 3877, 2000