The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties

Cellular Immunology 270 (2011) 207–216

Contents lists available at ScienceDirect

Cellular Immunology journal homepage: www.elsevier.com/locate/ycimm

The source of human mesenchymal stromal cells influences their TLR profile as well as their functional properties Gordana Raicevic a,b,⇑, Mehdi Najar a,b, Basile Stamatopoulos a,b, Cecile De Bruyn a,b, Nathalie Meuleman b, Dominique Bron a,b, Michel Toungouz b,c, Laurence Lagneaux a,b a b c

Laboratory of Clinical Cell Therapy, Université Libre de Bruxelles, Brussels, Belgium Laboratory of Experimental Hematology, Institut Jules Bordet, Université Libre de Bruxelles, Brussels, Belgium Department of Immunology–Hematology–Transfusion, Hôpital Erasme, Université Libre de Bruxelles, Brussels, Belgium

a r t i c l e

i n f o

Article history: Received 10 March 2011 Accepted 13 May 2011 Available online 30 May 2011 Keywords: Mesenchymal stromal cells Bone marrow Adipose tissue Wharton’s jelly Toll-like receptors (TLRs) Inflammation Hepatic growth factor (HGF)

a b s t r a c t Mesenchymal stromal cells (MSC) can be expanded from different sources. We compared the influence of inflammation and TLR ligation on the phenotype and function of MSC derived from bone marrow (BM), adipose tissue (AT), and Wharton’s jelly (WJ). WJ-MSC were featured by a lack of TLR4 expression. While inflammation upregulated TLR3 in all three MSC types, TLR4 upregulation was observed only on BM-MSC. TLR ligation increased the production of inflammatory cytokines in BM- and AT-MSC but not in WJ-MSC and augmented anti-inflammatory cytokines in AT-MSC. Although inflammation increased in all MSC types the secretion of inflammatory cytokines, additional TLR triggering did not have further effect on WJ-MSC. The immunosuppressive potential of WJ-MSC on MLR was affected neither by inflammation nor by TLR triggering. This resistance was related to an overproduction of HGF. These data indicate that MSC source could be of importance while designing immunomodulating cell therapy in transplantation. Ó 2011 Elsevier Inc. All rights reserved.

1. Introduction Mesenchymal stromal cells (MSC) are adherent, fibroblast-like, non-hematopoietic cells harboring several features which make them attractive candidates not only for cell based regenerative and repair therapy but also for immunotherapy. They are multipotent progenitor cells that can differentiate into various cell types of including osteoblasts, adipocytes, chondrocytes, tenocytes, skeletal myocytes, and cells of visceral mesoderm [1]. A remarkable feature of MSC is that they are considered to be immunoprivileged as they express low levels of cell-surface HLA class I molecules, whereas HLA class II and costimulatory molecules (i.e. CD40, CD80, and CD86) are not detectable [2,3]. Another important feature of MSC is that they can modify or attenuate the effector functions of different immune cells like T cells, B cells, natural killer cells, and subsets of dendritic cells [4–6]. MSC are able to inhibit lymphocyte proliferation by a mechanism that requires the release of soluble factors such as hepatocyte growth factor (HGF), prostanglandin-E2 (PGE2), transforming growth factor (TGF)-b1, indoleamine 2,3-dioxygenase (IDO), nitric oxide, and interleukin (IL)-10 [4,7-13]. Other studies have shown that MSC modulate T-cell phenotype resulting in ⇑ Corresponding author at: Institut Jules Bordet, 121 Boulevard de Waterloo, 1000 Bruxelles, Belgium. Fax: +32 2 54 134 53. E-mail address: [email protected] (G. Raicevic). 0008-8749/$ - see front matter Ó 2011 Elsevier Inc. All rights reserved. doi:10.1016/j.cellimm.2011.05.010

the generation of cells with regulatory activity [7,14-16]. In addition, MSC constitutively secrete cytokines pivotal for hematopoiesis and logically promote engraftment of hematopoietic stem cells in experimental animal models [17]. Up to now, MSC have been identified and propagated from many different sources including bone marrow (BM-MSC), adipose tissue (AT-MSC), peripheral blood, umbilical cord blood (UCBMSC), and Wharton jelly (WJ-MSC). However, BM-MSC is the type which has been studied the most extensively. MSC do not possess specific surface markers following their direct identification. They are defined according to the consensus criteria of the International Society for Cell Therapy (ISCT) requiring negativity for hematopoietic and endothelial markers such as CD11b, CD14, CD31, CD34, CD45, and HLA-DR, and positivity for other markers including CD105, CD73, CD29, and CD90 [18]. Although displaying some similarities, MSC from different sources present also differences. For instance, UCB-MSC and WJ-MSC have a poor ability to differentiate into adipocytes [19,20] and have a faster doubling time than BMMSC [19–21]. The latter feature is thought to reflect the relatively primitive nature of these MSC as compared to adult BM- or ATMSC. By expressing Toll-like receptors (TLRs) MSC are sensitive to microbial compounds. The TLR family is a family of germline-encoded pattern-recognition receptors (PRRs) evolved to detect different components of foreign pathogens, referred to as

208

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

pathogen-associated molecular patterns (PAMPs), and to promote the activation of immune cells [22]. So far, 10 functional TLR have been identified in humans and 12 in mice. These receptors are divided into two subgroups depending on their cellular localization and PAMP ligands. The first group is expressed on the cell surface and recognize mainly microbial membrane components such as lipoproteins and lipids (TLR1, TLR2, and TLR6), lipopolysaccharide (LPS) (TLR4), and flagellin (TLR5). The other group is expressed in the intracellular compartment where they recognize doublestranded RNA (dsRNA, TLR3), single-stranded viral RNA (TLR7 and TLR8) and unmethylated CpG DNA of bacteria and viruses (TLR9) [23]. Some of these receptors are functional on MSC and when triggered can modulate the proliferative, immunosuppressive, migratory, and differentiation potential of these cells [24–27]. Besides TLR engagement, inflammation is another biological parameter susceptible to influence MSC behavior. Inflammation occurs during any tissue injury and MSC are exposed to such stimuli in many clinical conditions. In a previous work, we showed that inflammation upregulates TLR3 and TLR4 leading to an increased responsiveness of MSC to LPS and poly(I:C) associated with a proinflammatory shift in their cytokine profile [28]. In the present work, we studied the influence of three different tissue sources (BM, AT, and WJ) on the biological properties of MSC. First, we defined their TLR profile paying special attention to TLR3 and TLR4. Then, we evaluated the role of an inflammatory environment and of TLR3 and TLR4 ligation on the pattern of TLR and cytokine expression as well as on their immunosuppressive properties. 2. Materials and methods 2.1. Ethics statement This study has been specifically approved by the Bordet Institute Ethics Committee and conducted according to the principles expressed in the Declaration of Helsinki. All samples were collected after written informed consent. 2.2. Isolation, culture, and expansion of MSC from BM, WJ, and AT 2.2.1. Bone marrow MSC Bone marrow was harvested from the sternum or iliac crest of healthy volunteers (n = 3). Mononuclear cells were isolated by density gradient centrifugation (LinfoSep, Biomedics, Madrid, Spain), washed in Hank’s buffered salt solution (HBSS, Lonza Europe, Verviers, Belgium) and seeded at 2  104 cells/cm2 in Dulbecco’s modified Eagle’s medium–low glucose (DMEM-LG, Lonza) supplemented with 15% of fetal bovine serum (FBS) (Sigma–Aldrich, Bornem, Belgium), 2 mM of L-glutamine, 50 U/ml of penicillin and 50 lg/ml of streptomycin (all from Lonza). Cells were incubated at 37 °C in a 5% CO2 and 95% humidified atmosphere. After 48 h, non-adherent cells were removed by washing and the medium was changed twice a week. 2.2.2. Wharton jelly’s MSC Umbilical cords from full-term deliveries were collected and processed as previously described (n = 3) [29]. Immediately after collection, umbilical cords were transferred to an aseptic saline buffer. The umbilical cord segments (5–10) were sectioned longitudinally to expose the WJ. Some incisions were made on the matrix with a sterile scalpel to expose a wider area of tissue contact with the plastic surface. MSC were isolated based on their migratory and adhesive properties. WJ matrix was completely immersed in DMEM-LG culture medium for 5 days to allow MSC to spread out and attach to the plastic surface. At the end of the culture period,

umbilical cord fragments were removed from the wells, and cells were cultured until confluence. 2.2.3. Adipose tissue MSC Adipose tissue was obtained from patients undergoing liposuction procedure (n = 3). Fresh lipoaspirates used to isolate AT-MSC were processed according to a previous protocol [30]. Briefly, lipoaspirates were washed intensively with an equal volume of Dulbecco’s Phosphate-Buffered saline (DPBS, Lonza), and the extracellular matrix was digested with 0.075% collagenase A (Roche Applied Science, Vilvoorde, Belgium) at 37 °C for 30 min. The samples were centrifuged at 1200g for 10 min in complete culture medium. After discarding the supernatant containing oil, primary adipocytes, and collagenase solution, the stromal-vascular fraction pellet was cultured. 2.2.4. MSC culture and expansion For all sources, MSC were isolated using the classical adhesion method. When subconfluency (80–90%) was achieved, adherent cells were detached with TrypleSelect (Lonza) and expanded by replating at lower density (1000 cells/cm2). MSC were generally evaluated after two passages. To confirm the mesenchymal nature of cells, CFU-F assay, phenotype and differentiation assays were performed as described [28,31]. 2.3. MSC phenotyping by flow cytometry The MSC phenotype was defined using the following monoclonal antibodies: anti-CD166-FITC (DakoCytomation, Glostrup, Denmark), anti-CD45-CY5 (BD Biosciences Pharmingen, Erembodegem, Belgium), anti-HLA-DR-CY5 (Immunotech, Marseille, France), anti-CD34-PE, anti-CD73-PE (BD Biosciences Pharmingen), anti-CD31-PE, antiCD29-PE (Immunotech), antiCD105-FITC (R&D systems, Minneapolis, MN, USA), anti-CD40-PE (Miltenyi Biotec, Bergish-Gladbach, Germany), anti-CD80-FITC (Immunosource, Halle-Zoersel, Belgium), anti-CD86-APC (Miltenyi), and HLA-ABC-Cy5 (eBioscience, San Diego, CA). Additionally, TLR3 and TLR4 expression was assessed using anti-TLR3-PE and anti-TLR4-APC antibodies (eBioscience). As TLR3 is only intracellular, TLR3 staining was performed after cell fixation and permeabilization (Fix&Perm cell permeabilization kit, Imtec, Antwerp, Belgium). Data were acquired and analyzed on a MacsQuant analyzer (Miltenyi Biotec). 2.4. Assessment of TLR and cytokine transcription by real-time polymerase chain reaction (qPCR) Total mRNA was isolated from BM-, WJ-, and AT-MSC using the TriPure Isolation Reagent (Roche Applied Science, Vilvoorde, Belgium). cDNA was obtained by reverse transcription of 1 lg mRNA using qScript™ cDNA SuperMix (QUANTA bioscience, Gaithersburg, MD, USA) for 5 min at 25 °C, 30 min at 42 °C, and 5 min at 85 °C. qPCR was performed on an ABI PrismÒ 7900HT Sequence Detection System (Applied Biosystem). We used 25 ng of cDNA in a qPCR with SYBRÒ Green PCR Master Mix (Applied Biosystems, Rotterdam, The Netherlands) and 0.32 lM of gene-specific forward and reverse primers. Primers sequences specific for human TLR mRNA were used as previously described [32]. Primers specific for human cytokine mRNA were designed by using Primer Express 2.0 (Applied Biosystems) and were as follows (50 -30 forward and reverse, respectively): Il-1b, AGTGGTGTTCTCCATGTCCTTTGTA and GCCCAAGGCCA CAGGTATT; TNF-a, ATCTTCTCGAACCCCGAGTGA and AGCTGCCCCTCAGCT TGA;

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

IL-12B (p40), TGCCCTGCAGTTAGGTTCTGAT and CATTTTGCT TAATATCTTCCACTTTTCC; IL-12A (p35), AAACATGCTGGCAGTTATTGATGA and TTTGTGGCACAGTCTCACTGTTG; IL-23p19, CAGTCAGTTCTGCTTGCAAAGG and TATCCGATCCTAGCAGCTTCTCA; IL-27p28, ATCTCACCTGCCAGGAGTGAAC and TGAAGCGTGGTG GAGATGAA; EBI-3, TGCCGCCTGCTCCAAA and AGCCTGTACGTGGCAATGAAG; CCL5, TCTGCGCTCCTGCATCTG and GGGCAATGTAGGCAAAGCA; and GAPDH, AATCCCATCACCATCTTCCA and TGGACTCCACGA CGTACTCA. We analyzed the data using the comparative threshold cycle method based on the relative expression of the target gene mRNA vs. GAPDH levels as a reference. Several housekeeping genes were tested (actin, 18S rRNA, HPRT) and GAPDH was chosen as its expression was not affected by our culture conditions. 2.5. TLR3 and TLR4 ligation and inflammatory condition To assess the influence of TLR3 and TLR4 ligation, MSC were activated for 18 h by polyriboinosinic polyribocytidylic acid [poly(I:C)] at 30 lg/ml (Sigma–Aldrich) and lipopolysaccharide (LPS) at 10 lg/ml (Sigma–Aldrich), respectively [24]. The inflammatory environment was mimicked by incubating MSC for 18 h in a cytokine cocktail combining IL-1b 25 ng/ml (Peprotech, Rocky Hill, NJ, USA), IFN-c 103 U/ml, TNF-a 50 ng/ml and INF-a 3  103 U/ ml (all from Prospec Inc, Rehovot, Israel) as previously described [33–35]. 2.6. Cytokine secretion After TLR ligation of MSC in non-inflammatory or inflammatory conditions, culture supernatants were collected and the levels of IL-6, IL-8, CCL5 and IL-1Ra were measured by ELISA (R&D Systems, Abingdon, United Kingdom). To identify the production of potential immune modulating factors produced by MSC alone or in the course of an allogeneic reaction, we also determined, by ELISA, HGF (RayBiotech, Norcross, GA, USA) and PGE2 (R&D Systems, Abingdon, United Kingdom) levels in culture supernatants. T cell activation was assessed by IFN-c release (R&D). 2.7. Immunomodulation We tested the immunomodulatory properties of MSC using the mixed lymphocyte reaction (MLR) as an in vitro model of the allogeneic response. PBMC from healthy donors isolated by Ficoll gradient separation from fresh blood were used as stimulator cells. Immunomagnetically purified (MiniMACS, Miltenyi Biotec) CD3+ T-cells were used as responder cells. 105 CD3+ T cells were cocultured with 20  103 allogeneic PBMC in a final volume of 300 ll in 96-well plates. Triplicates of these MLR were done in the absence or presence of 10  103 third party MSC from the three different sources with or without TLR triggering in the absence or presence of the inflammatory environment. PBMC and MSC were irradiated (25 Gy) before use knowing that such an irradiation does not alter cytokine production and functions of MSC [36,37]. After 4 days, 50 ll of fresh medium containing BrdU (50 lM final concentration) (Roche Applied Science, Mannheim, Germany) were added for 20 h. T cell proliferation was assessed by measuring BrdU incorporation using a colorimetric assay (Cell Proliferation ELISA, Roche Diagnostics). The sum of the optical density (OD) of T cells, PBMC, and MSC cultured alone was considered as background. T-cell proliferation in MLR was expressed by the proliferation index (PI) defined as the ratio between the OD of the MLR divided by the OD of the autologous T cells after subtracting the background.

209

2.8. Statistical analysis Statistical differences were evaluated by a two-tailed or, when applicable, one-tailed paired t-test and Wilcoxon signed rank test using GraphPad Prism version 5.00 for Windows (GraphPad Software, San Diego California USA, www.graphpad.com). p Values <0.05 were considered as statistically significant. 3. Results 3.1. Influence of the inflammatory environment and TLR ligation on the immunogenicity of MSC MSC derived from the three different sources expressed low levels of HLA class I, whereas HLA-DR, CD40, CD80, and CD86 were not detectable. Exposure to pro-inflammatory cytokines induced CD40 expression on all three MSC types (46 ± 5%, 42 ± 16%, and 82 ± 5% positive cells for BM-, WJ- and AT-MSC respectively, n = 3). TLR3 and TLR4 ligation (poly(I:C) and LPS) slightly induced CD40 expression (<30%) on BM- and AT-MSC but not on WJ-MSC. In inflammatory conditions, the upregulation of HLA class I was observed on all three MSC types. TLR ligation increased this expression on BM- and AT-MSC but not on WJ-MSC. HLA-DR expression was induced by inflammatory factors only in BM-MSC (27 ± 15%, n = 3) while AT-MSC and WJ-MSC remained negative. CD80 and CD86 were not detected on whatever MSC type in any culture condition (data not shown). 3.2. Influence of the inflammatory environment on the pattern of TLR expression by MSC The pattern of TLR gene expression by MSC isolated from the different sources was established by qPCR. As positive control, mRNA from dendritic cells was tested with the same set of primers. BM- and AT-MSC shared the same TLR pattern featured with the transcription of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6 and TLR9 and the absence of mRNA for TLR7, TLR8 and TLR10. The BM-MSC pattern of TLR expression was in agreement with our previous data [28]. Interestingly, WJ-MSC were characterized by a similar pattern with the notable lack of TLR4 transcription. After overnight incubation of the three MSC types in the presence of pro-inflammatory cytokines, this pattern did not change qualitatively but quantitatively. TLR3 was upregulated by all three MSC types. Inflammation did not induce TLR4 transcription by WJ-MSC while a significant upregulation by BM-MSC was observed. No modification was observed for AT-MSC (Fig. 1A). TLR3 and TLR4 expression by MSC was then assessed at the protein level by flow cytometry. Primary cultures of AT-, WJ- and BMMSC were positive for TLR3 while TLR4 was expressed by AT- and BM-MSC but not by WJ-MSC. Inflammation upregulated both TLR in BM-MSC. TLR3 was upregulated in WJ- and AT-MSC. WJ-MSC never expressed TLR4 (Fig. 1B). 3.3. Influence of the inflammatory environment and TLR ligation on cytokine transcription and secretion by MSC The cytokines studied included proinflammatory (IL-1b, IL-6, IL-12, and IL-23), anti-inflammatory (TGF-b; IL-1Ra), regulatory (IL-27) cytokines and chemokines (IL-8, CCL5). The cytokines constitutively expressed by all three MSC types at the mRNA level were TGF-b, IL-12 p40, IL-12p35 and the EBI-3 subunit of IL-27. IL-27p28 was expressed only by AT-MSC. IL-1b was expressed by AT- and WJ-MSC. Its expression was induced or upregulated by TLR engagement in BM- and AT-MSC but not in WJ-MSC. Inflammation by itself triggered the expression of IL-23p19 by BM- and

210

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

Fig. 1. Inflammation influences the TLR expression by AT-, WJ- and BM-MSC. (A) Different MSC were cultured for 18 h in an inflammatory environment (Inf+) induced by a cytokine cocktail consisting of IL-1b, TNF-a, IFN-a and IFN-c or not (Inf). After 18 h of incubation total RNA was extracted and the expression of mRNA specific for different TLR was evaluated by quantitative PCR and normalized for the housekeeping gene GAPDH. Mean values of relative quantity of mRNA ± SEM of seven independent experiments are represented, ⁄p < .05, ⁄⁄p < .008; (B) Protein expression of TLR3 and TLR4 was evaluated on different MSC in non-inflammatory (black lined histogram) and inflammatory (grey lined histogram) environment by flow cytometric analysis by using anti-TLR3-PE and ant-TLR4-APC monoclonal antibodies.

AT-MSC as well as upregulated IL-1b, EBI-3, and IL-12p35 mRNA transcription in all three MSC types. In this setting, TLR ligation was able to further increase the expression IL-23p19, IL-27p28, and IL-12p40 in BM-MSC and p35, EBI-3 in AT-MSC. WJ-MSC never expressed either IL-23p19 or IL-27p28 (Fig. 2). At the protein level, all three MSC types constitutively secreted IL-6 while IL-8 was highly produced by WJ- and to a lesser extent by AT-MSC. IL-1Ra was constitutively secreted only by AT-MSC. As far as TLR ligation is concerned, WJ-MSC behaved differently from AT and BM MSC. Indeed, their IL-6, IL-8, and CCL5 production was not modified by poly(I:C) and LPS stimulation while the secretion of these cytokines/chemokine by AT and BM-MSC was clearly increased. Inflammation upregulated the secretion of IL-6 and IL-8 and triggered the secretion of CCL5 by all three MSC types while IL-Ra was only upregulated by AT and BM-MSC (Fig. 3). 3.4. Influence of the inflammatory environment and TLR ligation on the immunomodulatory properties of MSC As MSC expressed TLR the triggering of which modify their cytokine profile, we evaluated the influence of TLR ligation and/or inflammation on the immunomodulatory properties of BM-, WJ- and AT-MSC using the MLR as a model of the

allogeneic reaction. In these experiments, we confirmed the significant suppression of T-cell allogeneic proliferation by all three MSC types. Overnight incubation of BM-MSC in the inflammatory cytokine cocktail in the presence or absence of poly(I:C) or LPS, affected the immunosuppressive potential of BM-MSC. Both TLR ligands in inflammatory conditions as well as inflammation by itself reduced the ability of BM-MSC to suppress T cell alloactivation. Remarkably, the immunosuppressive potential of WJand AT-MSC was not affected by any of these conditions (Fig. 4A). MSC also had an inhibitory effect on IFN-c release by alloactivated T cells. In the presence of each untreated MSC type, IFN-c level in MLR supernatants was reduced. However, IFN-c release was partially restored when BM-MSC were preincubated in the inflammatory condition. To a lesser extent, TLR activation of BM-MSC had the same effect. This partial neutralization of the immunosuppressive effect of MSC on IFN-c release was not observed when pretreated AT- or WJ-MSC were added (Fig. 4B). 3.5. Production of HGF and PGE2 by MSC As HGF and PGE2 are factors known to be involved in MSC mediated immunomodulation, we measured their production during

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

211

Fig. 2. Cytokine expression by BM-, WJ- and AT-MSC. Different MSC were pre-treated with TLR-ligands poly(I:C)(PIC) and LPS in the inflammatory environment or not for 18 h and then cytokine mRNA expression was assessed by qPCR , n = 3.

MLR. BM-, WJ- and AT-MSC constitutively produced low levels of HGF while PBMC did not (data not shown). HGF levels in MLR supernatants was clearly increased when MSC were added whatever the MSC type. Interestingly, HGF production was 10 times higher in MLR involving WJ-MSC as compared to AT- or BM-MSC. The secretion of HGF by BM-MSC was significantly decreased when MSC were precultured in the inflammatory environment. AT-MSC produced less HGF when they were preactivated by LPS alone or in the inflammatory setting. Pretreatment of WJ-MSC by poly(I:C) or LPS and/or inflammation did not modify their HGF secretion (Fig. 5A). PGE2 was constitutively secreted at low levels by all three MSC types. As for HGF, this secretion was increased during the MLR. No significant modification of PGE2 production was observed for any MSC type in any culture condition (Fig. 5B).

4. Discussion In the present work, we show that, according to the source from which they are derived, human MSC display disparities that affect their functional properties. Among the three MSC types investigated, WJ-MSC are those differing the most from BM-MSC which we considered as a reference because they are the most extensively studied. Particularly, WJ-MSC displayed a low immunogenic phenotype even after activation by inflammation or TLR featuring an absence of HLA-DR and TLR4 expression and an immunosuppressive potential resistant to these factors probably thanks to a high capacity to produce HGF. The TLR profile of WJ MSC is not yet described. We observed that these cells do not express TLR4 and consequently do not respond to LPS activation. WJ-MSC expressed TLR3 but this receptor

212

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

Fig. 3. Cytokine production by BM-, WJ- and AT-MSC. Different MSC were pretreated with TLR-ligands poly(I:C)(PIC) and LPS in the inflammatory environment or not for 18 h and supernatants were collected for the determination of cytokine production by ELISA method. Mean values ± SEM of three independent experiments are shown, n = 3, ⁄ p < .05, ⁄⁄p < .009, and ⁄⁄⁄p < .001.

appeared to be non functional as its ligation did not trigger either the transcription or the secretion of the different cytokines tested including IL-1b, IL-6, IL-12, IL-27, IL-23, IL-8, CCL5, and IL-1Ra. These data are reminiscent of those recently described by Smythies et al. studying intestinal macrophages. Even though these cells expressed TLR they did not release TLR-inducible cytokines, implicating an ineffective downstream signaling as the mechanism involved in the inflammatory anergy [38]. Earlier, Sun et al. also showed that N-linked glycolysation of TLR3 is required for the bioactivity of this receptor as mutations in two of these predicted glycolysation sites impaired TLR3 signaling without affecting the expression of the protein [39]. AT-MSC were closer to BM-MSC sharing a similar pattern of TLR expression. Contrary to WJ-MSC, TLR3 and TLR4 expressed by AT-MSC were active upon ligation as seen by a significant upregulation and/or triggering of cytokine transcription and release, a behavior comparable to the one of BMMSC [25,27,28] These data support the concept that WJ MSC are more resistant to the effect of TLR ligation through two main mechanisms: (a) lack of expression of some TLR and (b) expression of non functional TLR. In other cell types like dendritic cells, TLR engagement results in an increased production of inflammatory mediators [23]. WJ-, ATand BM-MSC constitutively produced IL-6 and this production was not upregulated by TLR3 and TLR4 stimulation in WJ-MSC contrary to AT- and BM-MSC as reported by our group and others [25,28]. All three MSC types studied transcribed IL-1b. Only AT-MSC were found to constitutively produce IL1Ra. IL-1Ra has been claimed to be important as an anti-inflammatory agent released by MSC [40]. IL-1Ra is a naturally occurring inhibitory cytokine involved in the negative feed-back loop controlling the pro-inflammatory action of IL-1b. When IL-1Ra binds to the IL-1b receptor, the binding of IL-1b is blocked preventing downstream proinflammatory signaling. TLR3 and TLR4 ligation slightly upregulated IL-1Ra production by AT-MSC while they were not able to trigger this secretion in WJ-MSC confirming their non responsiveness to the engagement of these TLR. Our data further extend the conclusion

of the work of Ortiz et al. reporting the existence of IL-1Ra-expressing MSC isolated from human bone marrow. By describing a subpopulation of BM-MSC that secrete IL-1Ra, this group came to the conclusion that subpopulations of BM-MSC may provide a novel cellular vector for treating chronic inflammatory diseases in humans. Our work extends this concept to subpopulations of MSC derived from different human tissues. MSC are known to be poor producers of chemokines but cytokines such as IFN-c and TNF-a are able to induce their expression [41]. In our work, we show that TLR ligation is able to trigger CCL5 release by AT-MSC as already described for BM-MSC [32] but not by WJ-MSC. CCL5 is found at the sites of many inflammatory reactions [42]. CCL5 was initially considered as a T-cell specific protein but has been found later to be produced by many other cells including macrophages, eosinophils and fibroblasts [43]. We also observed that AT-MSC [44] and WJ-MSC constitutively produce IL-8. IL-8 is a member of the CXC chemokine family that plays an important role in autoimmune, inflammatory, and infectious diseases [45,46]. Upon TLR ligation, IL-8 was produced by BM-MSC. IL-8 was upregulated in AT-MSC but not in WJ-MSC. Our data are in agreement with those of Romieu-Mourez showing that TLR stimulation in BM-MSC results in the formation of an inflammatory site attracting innate immune cells [32] as far as AT-MSC are concerned. Indeed, WJ-MSC were resistant to TLR ligands suggesting a lower reactivity in the context of bacterial or viral infections. Preliminary works show that MSC are sensitive to inflammation [28,47–49]. The development of an inflammatory environment follows any tissue injury and MSC are exposed to such stimuli in many clinical conditions. In order to mimic inflammation, we cultured the different MSC types in a medium supplemented with IL1b, TNF-a, IFN-a, and IFN-c. This model was chosen by our group and others because these cytokines are those mostly present at inflammatory sites where they promote Th-1 type immune responses. In our experiments, inflammation caused a quantitative, but not qualitative, change in the pattern of TLR expression by the different MSC. Inflammation significantly upregulated TLR2

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

213

Fig. 4. Inflammation and/or TLR ligation influence the inhibitory activity of BM-MSC but not AT- or WJ-MSC on allogeneic T-cell proliferation. (A) Purified CD3+ T-cells were stimulated by irradiated allogeneic PBMC (MLR) in the absence or presence of different MSC (MSC/CD3+ ratio of 1/10). The MSC used in the experiments were pre-treated (Inf+) or not (Inf) by the inflammatory cocktail and/or TLR ligands PIC and LPS. After 4 days of co-culture BrdU was added for additional 20 h, and then the CD3+ proliferation was evaluated by BrdU immunoassay. Data are expressed as the mean ± SEM PI of four independent experiment; (B) The production of INF-c in the MLR and MLR + MSC cocultures, where MSC were originating from different sources and were pre-treated (+) or not () by the inflammatory cocktail and/or different TLR ligands was measured by ELISA Data represent mean ± SEM of four independent experiments, ⁄p < .05.

and TLR3 in all three MSC types, while TLR4 was upregulated only in BM-MSC. TLR4 was never expressed by WJ-MSC. The transcription and production of proinflammatory cytokines and chemokines was highly upregulated in all MSC in the inflammatory setting with the exception of IL-23p19 and IL-27p28 which were not triggered in WJ-MSC as opposed to AT- and BM-MSC. IL-23 and IL-27 are members of the IL-12 family. IL-23 is a pivotal component of the inflammatory response against infection. This cytokine stimulates naïve T-cells to differentiate into the Th17 T-cell subset. The function of IL-27 is diverse. It is considered as an initiator of early Th1 differentiation [50] as well as an attenuator of inflammatory cytokine production [51]. The anti-inflammatory cytokine, IL-1Ra was not triggered by inflammation in WJ-MSC but was expressed well in AT- and BM-MSC. WJ-MSC were thus globally less sensitive to inflammation induced activation in term of both pro and antiinflammatory cytokine production. Data about the effect of TLR ligation on the immunosuppressive properties of human BM-MSC are somehow conflicting. We and others reported that overnight pre-activation of BM-MSC with

poly(I:C) and LPS significantly reduced their immunosuppressive potential [25,28] while Opitz et al. reported that TLR ligation enhanced the immunosuppressive capacity of BM-MSC [52]. Concerning AT-MSC, Lombardo et al. reported that TLR ligation does not interfere with the capacity of AT-MSC to modulate immune responses [53] while Crop et al. reported that the culture of AT-MSC with pro-inflammatory cytokines affects gene expression of cytokines and chemokines leading to an increased immunosuppressive capacity via IDO upregulation [48]. These apparent paradoxical results could be related to differences in the experimental procedures including the duration of MSC activation, concentrations of cytokines or TLR ligands and the way the immunosuppressive capacity is assessed, i.e. polyconal activation vs. MLR involving purified T cells as responder or PBMC [44]. There is no consensus on these parameters which also depends on the field the models refers to. As we were concerned by the transplantation field, our functional study was based on MLR refined by using purified CD3+ responder T cells in order to control more precisely responder/stimulators ratios.

214

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

Fig. 5. TLR ligation and inflammation pre-treatment of BM-, WJ- and AT-MSC differentially altered secretion of HGF in MLR + MSC co-cultures. Different MSC were preactivated (+) or not () by PIC or LPS in the presence of pro-inflamamtory cytokine cocktail (+) or not () overnight, and then they were added to the culture of allo-activated CD3+. After 5 days the supernatants were collected and the presence of (A) HGF and (B) PGE2 was measured by ELISA. Columns represent mean value ± SEM of three independent experiments for three independent donors. ⁄p < .05.

WJ-MSC were as immunosuppressive as the other MSC types on the allogeneic reaction [54,55]. We showed that TLR engagement did not affect this immunosuppressive property. Recently, it was described that priming of BM and WJ-MSC with IFN-c and TNF-a modulates their immunosuppressive capacity. Primed BM-MSC were not better in suppressing MLR than unprimed BM-MSC while IFN-c primed WJ-MSC seemed to have an enhanced capacity to inhibit the MLR [47]. In our experiments confirming that an inflammatory milieu decrease the suppressive activity of BM-MSC, we unveiled the resistance of WJ-MSC to the neutralizing effect of inflammation or TLR ligation on their immunosuppressive properties. In order to identify possible mechanisms of this resistance, we paid attention to HGF and PGE2. These molecules are known to be involved in the immune suppression mediated by MSC. While the production of PGE2 in our MLR involving all three MSC types was comparable, the production of HGF was almost 10 times higher in MLR involving WJ-MSC as compared to those involving AT- or BM-MSC. These data together with the lack of TLR4 expression by WJ-MSC are reminiscent of those recently reported by Wang

et al. showing in a murine model that MSC isolated from TLR4knockout (TLR4KO) mice produced significantly more HGF than MSC isolated from WT mice [56]. The ability of WJ-MSC to overproduce HGF even in the presence of inflammation or TLR3 and TLR4 ligation could contribute to explain the resistance of their immunosuppressive activity to these factors. The properties of WJ-MSC could be related to some degree of immaturity as compared to AT or BM-MSC. Recently, we have shown that WJ-MSC constitutively produce more leukemia inhibitory factor (LIF) than AT- and BM-MSC [55]. LIF is a cytokine belonging to the IL-6 family described by Nasef et al. contributing to the BM-MSC mediated inhibition of T-cell activation [57]. Cordblood (CB) MSC also express high levels of LIF. The fact that MSC, isolated from CB and WJ can differentiate into neurons suggest that these cells are closer to embryonic stem cells than to adult stem cells [58]. Interestingly human embryonic stem cells (hESC) disclose no immune response associated with bacterial TLR activation even after differentiation for up to 4 months [59]. Along this line, Zampetaki et al. reported a lack of responsiveness of

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

undifferentiated mouse ESC to LPS probably due to epigenic modulation of the TLR4 gene promoter [60]. It is well established that TLR activation and IFN-c stimulation can modulate the immunogenicity through the expression of costimulatory molecules by immune cells. MSC from the three different sources tested expressed low levels of MHC class I but did not express HLA-DR, CD40, CD80, and CD86. After treatment with inflammatory stimuli, the expression of HLA-class I was upregulated in all MSC sources but HLA-DR was only detected in BMand AT-MSC [47,53]. Activation by TLR ligands has not been reported to modulate the immunogenic phenotype of MSC [44]. In our culture conditions, we observed an increase of HLA class I expression on BM- and AT-MSC after TLR activation with or without inflammation. On WJ-MSC, HLA class I and CD40 expression was only increased in the presence of proinflammatory cytokines but to a lesser extent than observed in other sources. The upregulation of HLA molecules on some MSC makes them potentially more immunogenic and could have consequences for their clinical use especially if allogeneic MSC are chosen. In that context, WJMSC look more promising as they never expressed HLA-DR even after TLR ligation. In conclusion, MSC are promising candidates for the modulation of immune responses in autoimmune diseases as well as in solid organ and hematopoietic stem cell transplantation. The present work provides evidence that the source from which MSC are derived is of importance for the design of MSC based immunointervention. Particularly, it underlines the fact that WJ-MSC could be the most attractive cell when an immunosuppressive action is required in an inflammatory or infectious context. Disclosure statement No competing financial interests exist. Acknowledgments G. Raicevic and M. Najar are Télévie research fellows of the Fonds National de la Recherche Scientifique (FRS-FNRS 3.4.532.07F – 7.4.524.08F). They were supported by BRUSTEM an impulse program of the Institute for the encouragement of Scientific Research and Innovation of Brussels (ISRIB). We wish to express our thanks to the team of the obstetric department of Edith Cavell Clinic for providing human umbilical cord samples. References [1] M.F. Pittenger, A.M. Mackay, S.C. Beck, R.K. Jaiswal, R. Douglas, J.D. Mosca, M.A. Moorman, D.W. Simonetti, S. Craig, D.R. Marshak, Multilineage potential of adult human mesenchymal stem cells, Science 284 (1999) 143–147. [2] K. Le Blanc, C. Tammik, K. Rosendahl, E. Zetterberg, O. Ringden, HLA expression and immunologic properties of differentiated and undifferentiated mesenchymal stem cells, Exp. Hematol. 31 (2003) 890–896. [3] K. Le Blanc, L. Tammik, B. Sundberg, S.E. Haynesworth, O. Ringden, Mesenchymal stem cells inhibit and stimulate mixed lymphocyte cultures and mitogenic responses independently of the major histocompatibility complex, Scand. J. Immunol. 57 (2003) 11–20. [4] S. Aggarwal, M.F. Pittenger, Human mesenchymal stem cells modulate allogeneic immune cell responses, Blood 105 (2005) 1815–1822. [5] A. Uccelli, L. Moretta, V. Pistoia, Immunoregulatory function of mesenchymal stem cells, Eur. J. Immunol. 36 (2006) 2566–2573. [6] A. Corcione, F. Benvenuto, E. Ferretti, D. Giunti, V. Cappiello, F. Cazzanti, M. Risso, F. Gualandi, G.L. Mancardi, V. Pistoia, A. Uccelli, Human mesenchymal stem cells modulate B-cell functions, Blood 107 (2006) 367–372. [7] M. Krampera, S. Glennie, J. Dyson, D. Scott, R. Laylor, E. Simpson, F. Dazzi, Bone marrow mesenchymal stem cells inhibit the response of naive and memory antigen-specific T cells to their cognate peptide, Blood 101 (2003) 3722–3729. [8] M. Najar, R. Rouas, G. Raicevic, B.H. Id, P. Lewalle, N. Meuleman, D. Bron, M. Toungouz, P. Martiat, L. Lagneaux, Mesenchymal stromal cells promote or suppress the proliferation of T lymphocytes from cord blood and peripheral blood: the importance of low cell ratio and role of interleukin-6, Cytotherapy (2009) 1–14.

215

[9] S. Beyth, Z. Borovsky, D. Mevorach, M. Liebergall, Z. Gazit, H. Aslan, E. Galun, J. Rachmilewitz, Human mesenchymal stem cells alter antigen-presenting cell maturation and induce T-cell unresponsiveness, Blood 105 (2005) 2214–2219. [10] B. Puissant, C. Barreau, P. Bourin, C. Clavel, J. Corre, C. Bousquet, C. Taureau, B. Cousin, M. Abbal, P. Laharrague, L. Penicaud, L. Casteilla, A. Blancher, Immunomodulatory effect of human adipose tissue-derived adult stem cells: comparison with bone marrow mesenchymal stem cells, Br. J. Haematol. 129 (2005) 118–129. [11] R. Yanez, M.L. Lamana, J. Garcia-Castro, I. Colmenero, M. Ramirez, J.A. Bueren, Adipose tissue-derived mesenchymal stem cells have in vivo immunosuppressive properties applicable for the control of the graft-versushost disease, Stem Cells 24 (2006) 2582–2591. [12] K. Sato, K. Ozaki, I. Oh, A. Meguro, K. Hatanaka, T. Nagai, K. Muroi, K. Ozawa, Nitric oxide plays a critical role in suppression of T-cell proliferation by mesenchymal stem cells, Blood 109 (2007) 228–234. [13] W.T. Tse, J.D. Pendleton, W.M. Beyer, M.C. Egalka, E.C. Guinan, Suppression of allogeneic T-cell proliferation by human marrow stromal cells: implications in transplantation, Transplantation 75 (2003) 389–397. [14] W. Zhang, W. Ge, C. Li, S. You, L. Liao, Q. Han, W. Deng, R.C. Zhao, Effects of mesenchymal stem cells on differentiation, maturation, and function of human monocyte-derived dendritic cells, Stem Cells Dev. 13 (2004) 263–271. [15] A.J. Nauta, A.B. Kruisselbrink, E. Lurvink, R. Willemze, W.E. Fibbe, Mesenchymal stem cells inhibit generation and function of both CD34+derived and monocyte-derived dendritic cells, J. Immunol. 177 (2006) 2080– 2087. [16] E. Gonzalez-Rey, M.A. Gonzalez, N. Varela, F. O’Valle, P. Hernandez-Cortes, L. Rico, D. Buscher, M. Delgado, Human adipose-derived mesenchymal stem cells reduce inflammatory and T cell responses and induce regulatory T cells in vitro in rheumatoid arthritis, Ann. Rheum. Dis. 69 (2010) 241–248. [17] P.S. in ‘t Anker, W.A. Noort, A.B. Kruisselbrink, S.A. Scherjon, W. Beekhuizen, R. Willemze, H.H. Kanhai, W.E. Fibbe, Nonexpanded primary lung and bone marrow-derived mesenchymal cells promote the engraftment of umbilical cord blood-derived CD34(+) cells in NOD/SCID mice, Exp. Hematol. 31 (2003) 881–889. [18] M. Dominici, K. Le Blanc, I. Mueller, I. Slaper-Cortenbach, F. Marini, D. Krause, R. Deans, A. Keating, D. Prockop, E. Horwitz, Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement, Cytotherapy 8 (2006) 315–317. [19] K. Bieback, S. Kern, H. Kluter, H. Eichler, Critical parameters for the isolation of mesenchymal stem cells from umbilical cord blood, Stem Cells 22 (2004) 625– 634. [20] S. Kern, H. Eichler, J. Stoeve, H. Kluter, K. Bieback, Comparative analysis of mesenchymal stem cells from bone marrow, umbilical cord blood, or adipose tissue, Stem Cells 24 (2006) 1294–1301. [21] D. Baksh, R. Yao, R.S. Tuan, Comparison of proliferative and multilineage differentiation potential of human mesenchymal stem cells derived from umbilical cord and bone marrow, Stem Cells 25 (2007) 1384–1392. [22] T. Kawai, S. Akira, The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors, Nat. Immunol. 11 (2010) 373–384. [23] A. Iwasaki, R. Medzhitov, Toll-like receptor control of the adaptive immune responses, Nat. Immunol. 5 (2004) 987–995. [24] C.H. Hwa, Y.C. Bae, J.S. Jung, Role of toll-like receptors on human adiposederived stromal cells, Stem Cells 24 (2006) 2744–2752. [25] F. Liotta, R. Angeli, L. Cosmi, L. Fili, C. Manuelli, F. Frosali, B. Mazzinghi, L. Maggi, A. Pasini, V. Lisi, V. Santarlasci, L. Consoloni, M.L. Angelotti, P. Romagnani, P. Parronchi, M. Krampera, E. Maggi, S. Romagnani, F. Annunziato, Toll-like receptors 3 and 4 are expressed by human bone marrow-derived mesenchymal stem cells and can inhibit their T-cell modulatory activity by impairing Notch signalling, Stem cells 26 (2008) 279–289. [26] L.C. van den Berk, B.J. Jansen, K.G. Siebers-Vermeulen, M.G. Netea, T. Latuhihin, S. Bergevoet, R.A. Raymakers, G. Kogler, C.C. Figdor, G.J. Adema, R. Torensma, Toll-like receptor triggering in cord blood mesenchymal stem cells, J. Cell Mol. Med. 13 (9B) (2009) 3415–3426. [27] S.L. Tomchuck, K.J. Zwezdaryk, S.B. Coffelt, R.S. Waterman, E.S. Danka, A.B. Scandurro, Toll-like receptors on human mesenchymal stem cells drive their migration and immunomodulating responses, Stem cells 26 (2008) 99–107. [28] G. Raicevic, R. Rouas, M. Najar, P. Stordeur, H.I. Boufker, D. Bron, P. Martiat, M. Goldman, M.T. Nevessignsky, L. Lagneaux, Inflammation modifies the pattern and the function of Toll-like receptors expressed by human mesenchymal stromal cells, Hum. Immunol. 71 (2010) 235–244. [29] C. De Bruyn, M. Najar, G. Raicevic, N. Meuleman, K. Pieters, B. Stamatopoulos, A. Delforge, D. Bron, L. Lagneaux, A rapid, simple and reproducible method for the isolation of mesenchymal stromal cells from Wharton’s jelly without enzymatic treatment, Stem Cells Dev. 20 (3) (2011) 547–557. [30] P.A. Zuk, M. Zhu, H. Mizuno, J. Huang, J.W. Futrell, A.J. Katz, P. Benhaim, H.P. Lorenz, M.H. Hedrick, Multilineage cells from human adipose tissue: implications for cell-based therapies, Tissue Eng. 7 (2001) 211–228. [31] G. La Rocca, R. Anzalone, S. Corrao, F. Magno, T. Loria, I.M. Lo, A. Di Stefano, P. Giannuzzi, L. Marasa, F. Cappello, G. Zummo, F. Farina, Isolation and characterization of Oct-4+/HLA-G+ mesenchymal stem cells from human umbilical cord matrix: differentiation potential and detection of new markers, Histochem. Cell Biol. 131 (2009) 267–282. [32] R. Romieu-Mourez, M. Francois, M.N. Boivin, M. Bouchentouf, D.E. Spaner, J. Galipeau, Cytokine modulation of TLR expression and activation in mesenchymal stromal cells leads to a proinflammatory phenotype, J. Immunol. 182 (2009) 7963–7973.

216

G. Raicevic et al. / Cellular Immunology 270 (2011) 207–216

[33] M. St Onge, A. Dumas, A. Michaud, C. Laflamme, A.A. Dussault, M. Pouliot, Impact of anti-inflammatory agents on the gene expression profile of stimulated human neutrophils: unraveling endogenous resolution pathways, PLoS ONE 4 (2009) e4902. [34] R.B. Mailliard, A. Wankowicz-Kalinska, Q. Cai, A. Wesa, C.M. Hilkens, M.L. Kapsenberg, J.M. Kirkwood, W.J. Storkus, P. Kalinski, Alpha-type-1 polarized dendritic cells: a novel immunization tool with optimized CTL-inducing activity, Cancer Res. 64 (2004) 5934–5937. [35] H. Daxecker, M. Raab, S. Markovic, A. Karimi, A. Griesmacher, M.M. Mueller, Endothelial adhesion molecule expression in an in vitro model of inflammation, Clin. Chim. Acta. 325 (2002) 171–175. [36] A. Umezawa, K. Harigaya, H. Abe, Y. Watanabe, Gap-junctional communication of bone marrow stromal cells is resistant to irradiation in vitro, Exp. Hematol. 18 (1990) 1002–1007. [37] P. Bruhl, H.G. Mergenthaler, P. Dormer, Haemopoietic inductive capacity of irradiated stromal cell layers in human micro long-term bone marrow cultures, Cell Tissue Kinet. 21 (1988) 411–417. [38] L.E. Smythies, R. Shen, D. Bimczok, L. Novak, R.H. Clements, D.E. Eckhoff, P. Bouchard, M.D. George, W.K. Hu, S. Dandekar, P.D. Smith, Inflammation anergy in human intestinal macrophages is due to Smad-induced IkappaBalpha expression and NF-kappaB inactivation, J. Biol. Chem. 285 (2010) 19593– 19604. [39] J. Sun, K.E. Duffy, C.T. Ranjith-Kumar, J. Xiong, R.J. Lamb, J. Santos, H. Masarapu, M. Cunningham, A. Holzenburg, R.T. Sarisky, M.L. Mbow, C. Kao, Structural and functional analyses of the human Toll-like receptor 3. Role of glycosylation, J. Biol. Chem. 281 (2006) 11144–11151. [40] L.A. Ortiz, M. Dutreil, C. Fattman, A.C. Pandey, G. Torres, K. Go, D.G. Phinney, Interleukin 1 receptor antagonist mediates the antiinflammatory and antifibrotic effect of mesenchymal stem cells during lung injury, Proc. Natl. Acad. Sci. USA 104 (2007) 11002–11007. [41] G. Ren, L. Zhang, X. Zhao, G. Xu, Y. Zhang, A.I. Roberts, R.C. Zhao, Y. Shi, Mesenchymal stem cell-mediated immunosuppression occurs via concerted action of chemokines and nitric oxide, Cell Stem Cell 2 (2008) 141–150. [42] V. Appay, P.R. Dunbar, V. Cerundolo, A. McMichael, L. Czaplewski, S. RowlandJones, RANTES activates antigen-specific cytotoxic T lymphocytes in a mitogen-like manner through cell surface aggregation, Int. Immunol. 12 (2000) 1173–1182. [43] V. Appay, S.L. Rowland-Jones, RANTES: a versatile and controversial chemokine, Trends Immunol. 22 (2001) 83–87. [44] O. DelaRosa, E. Lombardo, Modulation of adult mesenchymal stem cells activity by toll-like receptors: implications on therapeutic potential, Mediators Inflamm. 2010 (2010) 865601. [45] A. Harada, N. Sekido, T. Akahoshi, T. Wada, N. Mukaida, K. Matsushima, Essential involvement of interleukin-8 (IL-8) in acute inflammation, J. Leukoc. Biol. 56 (1994) 559–564. [46] A.E. Koch, P.J. Polverini, S.L. Kunkel, L.A. Harlow, L.A. DiPietro, V.M. Elner, S.G. Elner, R.M. Strieter, Interleukin-8 as a macrophage-derived mediator of angiogenesis, Science 258 (1992) 1798–1801. [47] S.J. Prasanna, D. Gopalakrishnan, S.R. Shankar, A.B. Vasandan, Proinflammatory cytokines, IFNgamma and TNFalpha, influence immune properties of human bone marrow and Wharton jelly mesenchymal stem cells differentially, PLoS ONE 5 (2) (2010) e9016. [48] M.J. Crop, C.C. Baan, S.S. Korevaar, J.N. Ijzermans, M. Pescatori, A.P. Stubbs, W.F. Van Ijcken, M.H. Dahlke, E. Eggenhofer, W. Weimar, M.J. Hoogduijn,

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

Inflammatory conditions affect gene expression and function of human adipose tissue-derived mesenchymal stem cells, Clin. Exp. Immunol. 162 (3) (2010) 474–486. H. Hemeda, M. Jakob, A.K. Ludwig, B. Giebel, S. Lang, S. Brandau, Interferongamma and tumor necrosis factor-alpha differentially affect cytokine expression and migration properties of mesenchymal stem cells, Stem Cells Dev. 19 (2010) 693–706. A. Takeda, S. Hamano, A. Yamanaka, T. Hanada, T. Ishibashi, T.W. Mak, A. Yoshimura, H. Yoshida, Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment, J. Immunol. 170 (2003) 4886–4890. T. Yoshimura, A. Takeda, S. Hamano, Y. Miyazaki, I. Kinjyo, T. Ishibashi, A. Yoshimura, H. Yoshida, Two-sided roles of IL-27: induction of Th1 differentiation on naive CD4+ T cells versus suppression of proinflammatory cytokine production including IL-23-induced IL-17 on activated CD4+ T cells partially through STAT3-dependent mechanism, J. Immunol. 177 (2006) 5377– 5385. C.A. Opitz, U.M. Litzenburger, C. Lutz, T.V. Lanz, I. Tritschler, A. Koppel, E. Tolosa, M. Hoberg, J. Anderl, W.K. Aicher, M. Weller, W. Wick, M. Platten, Tolllike receptor engagement enhances the immunosuppressive properties of human bone marrow-derived mesenchymal stem cells by inducing indoleamine-2, 3-dioxygenase-1 via interferon-beta and protein kinase R, Stem cells 27 (2009) 909–919. E. Lombardo, O. DelaRosa, P. Mancheno-Corvo, R. Menta, C. Ramirez, D. Buscher, Toll-like receptor-mediated signaling in human adipose-derived stem cells: implications for immunogenicity and immunosuppressive potential, Tissue Eng. Part A 15 (2009) 1579–1589. K.H. Yoo, I.K. Jang, M.W. Lee, H.E. Kim, M.S. Yang, Y. Eom, J.E. Lee, Y.J. Kim, S.K. Yang, H.L. Jung, K.W. Sung, C.W. Kim, H.H. Koo, Comparison of immunomodulatory properties of mesenchymal stem cells derived from adult human tissues, Cell Immunol. 259 (2009) 150–156. M. Najar, G. Raicevic, H.I. Boufker, K.H. Fayyad, C. De Bruyn, N. Meuleman, D. Bron, M. Toungouz, L. Lagneaux, Mesenchymal stromal cells use PGE2 to modulate activation and proliferation of lymphocyte subsets: Combined comparison of adipose tissue, Wharton’s Jelly and bone marrow sources, Cell Immunol. 264 (2010) 171–179. Y. Wang, A.M. Abarbanell, J.L. Herrman, B.R. Weil, M.C. Manukyan, J.A. Poynter, D.R. Meldrum, TLR4 inhibits mesenchymal stem cells (MSC) STAT3 activation and thereby exerts deleterious effects on MSC-mediated cardioprotection, PLoS ONE 5 (2010) e14206. A. Nasef, C. Mazurier, S. Bouchet, S. Francois, A. Chapel, D. Thierry, N.C. Gorin, L. Fouillard, Leukemia inhibitory factor: Role in human mesenchymal stem cells mediated immunosuppression, Cell Immunol. 253 (2008) 16–22. S. Greschat, J. Schira, P. Kury, C. Rosenbaum, M.A. Souza Silva, G. Kogler, P. Wernet, H.W. Muller, Unrestricted somatic stem cells from human umbilical cord blood can be differentiated into neurons with a dopaminergic phenotype, Stem Cells Dev. 17 (2008) 221–232. G. Foldes, A. Liu, R. Badiger, M. Paul-Clark, L. Moreno, Z. Lendvai, J.S. Wright, N.N. Ali, S.E. Harding, J.A. Mitchell, Innate immunity in human embryonic stem cells: comparison with adult human endothelial cells, PLoS ONE 5 (2010) e10501. A. Zampetaki, Q. Xiao, L. Zeng, Y. Hu, Q. Xu, TLR4 expression in mouse embryonic stem cells and in stem cell-derived vascular cells is regulated by epigenetic modifications, Biochem. Biophys. Res.Commun. 347 (2006) 89–99.