The tripartite immunity system of phages P1 and P7

ELSEVIER

FEMS Microbiology Reviews 17 (1995) 121-126

MICROBIOLOGY REVIEWS

The tripartite immunity system of phages P1 and P7 Jochen Heinrich, Mathias Velleman, Heinz Schuster * Max-Planck-lnstitut fiir Molekulare Genetik~ lhnestrasse 73, D-14195 Berlin, Germany

Abstract Prophages P1 and P7 exist as unit copy D N A plasmids in the bacterial cell. Maintenance of the prophage state requires the continuous expression of two repressors: (i) C1 is a protein which negatively regulates the expression o f lytie genes including the CI inactivator gene col, and (ii) C4 is an antisense R N A which specifically inhibits the synthesis o f an anti-repressor Ant. In addition, C1 repression is strengthened by /xc encoding an auxiliary repressor protein. The reprcssors C1, C4 and Lxe are components of a tripartite immunity system of the two phages. Here, the mode of action of these regulatory components including their antagonists Col and Ant is described. Keywords: Repressor; Auxiliary repressor; Repressor inactivator protein; Antisense RNA

1. Introduction

P1 prophage is maintained as a unit copy, circular plasmid D N A in the bacterial cell. Lytic functions are repressed and the prophage confers to its bacterial host immunity to superinfection by the homologous phage. Before the advent of recombinant DNA technology, the P1 genome was studied mainly by genetic techniques. By that means evidence was presented that the immunity system of P1 consists of three regions well-separated in the genome. In recent years, due to the pioneering work of Sternberg [1] and Scott [2], almost all of the P1 genome has been cloned. Exploration of a large variety of clones allowed the immunity system to be dissected. Individual components of the systems were identified and characterized with the aid of appropriate P1 mutants. At least three major components were iso* Corresponding author. Tel.: +49 (30) 8413 1240; Fax: +49 (30) 8413 1393

lated and their functions studied by biochemical techniques: (i) A C1 primary repressor protein which negatively regulates a variety of known and unknown gene functions via operator- promoter elements; (ii) a C4 antisense R N A as a secondary repressor preventing the translation of an anti-repressor which would otherwise inactivate the C1 repressor; (iii) an auxiliary Lxc repressor protein (formerly called Bof) which modulates C1 repression by enhancing the binding of C1 repressor to the operator. The c l and c4 genes are located in regions which, by analogy with the bipartite immunity system of phage P22, are named immC and immI, respectively. Lxc is encoded in a tertiary immunity region called immT (Fig. 1). Here we describe the components of the immunity system of P1 and its close relative PT. W e will deal with the phage's (24

0168-6445/95/$29.00 © 1.995 Federation of European Microbiological Societies. All rights reserved SSDI 0 1 6 8 - 6 4 4 5 ( 9 4 ) 0 0 0 6 3 - 8

122

J, Heinrich et aL ~FEARS Microbiology R e v i e w s 17 (1995) 1 2 1 - 1 2 6

?

the comprehensive review by Yarmolinsky and Sternberg [3] for further details and references.

v ,o:

2. The primary repressor C1 and the CI inaetivatot protein Cot are the major components of the immC region

. . . . . . .

\

/"

"\.

~

" ~ - ............

/.,

E

I

....... .0 . . t

~

~'0.

"

Fig, 1. Location and organlzatioil of immunity regions in the P1 propbage genome [10], The circular P1 prophage DNA comprises about 100 kb and is divided into 100 map coordinates with the locus of site-specific recombination, loxP = 0 / 1 0 0 . The immunity regions immC, i m m T and immI are located at map coordinates 99, 9.5, and 51, respectively. Cl-controlled operators (Ops, marked with black triangles) are numbered on the basis of their map location. Those near the same map coordinate are designated with letter suffixes. With the exception of Op55 and Op99c, all operators are connected with a promoter. Operators (dots), promoters (open triangles), ribosome binding sites (black vertical bars), genes (grey bars), atttisense RNA (rectangle), and transcripts (wavy lines) are shown in the enlarged i m m C and immI regions. Two anti-repressor proteins, Ant 1 and Ant 2, are encoded by a single open reading frame, with Ant 2 initiating at an in-frame start codon (vertical broken line) [18,25,26]. The i m m T region encodes the /xc gone which is expressed constitutively. Genes controlled via Op21 and by the operators clustered at map coordinates 8 2 - 8 8 have not yet been identified.

antisense RNA system in more detail. For reasons of limited space we will concentrate on the work done since about the year 1988. The reader is referred to

The immC region of P1 contains a cluster of operators and the genes for c l and the cl inactivator (Fig. 1). The repressor gone c l encodes a protein of 283 amino acids which does not contain any of the structural motifs commonly associated with repressor proteins. The c l nucleotide sequences of P1 and P7 differ at only 18 positions, all but two of which do not alter the amino acid sequence of the proteins [4,5]. This explains the fact that the cl genes of both phages are functionally identical, i.e. they can be exchanged without altering immunity specificity [3]. The P1 C1 repressor binds to at least 17 operators which are distributed widely over the P1 genome (Fig. 1) [3,6-9]. From these operators a 17-bp consensus sequence has been derived which is asymmetric and hence has directionality (Fig. 2). All operators are oriented in the same direction relative to associated promoters, although their locations relative to - 3 5 and - 1 0 promoter sequences vary considerably. A majority of operator regions contain a T tract downstream of the operator, suggesting structural implications in repressor-operator interaction (Fig. 2) ([6,11]; Velleman and Schuster, unpublished results). Two classes of operators have been identified: monovalent operators which consist of a single 17-bp repressor binding site, and bivalent operators which contain two overlapping repressor binding sites forming an incomplete palindrome [12]. Synthesis of C1 is autoregulated via the bivalent operator Op99a. b. The upstream regulatory region of cl additionally contains three operators and the cot (c one inactivator) gene (Fig. 1). Cot encodes a highly negatively charged protein of 69 amino acids AiT TSC T C T A A T A A A T T T,.,- ~,T T T T T~ operator consensus ssquence T tract Fig. 2. D N A consensus sequence in Cl-controlled operator regions of the Pl genome. The sequence contains the 17-bp operator consensus sequence followed by a T tract. From a total of 25 bases, 24 are conserved for at least 58%. Bases in bold-face are 100% conserved.

J. Heinrich et aL / FEMS Microbiology Reuiews 17 (1995) 121-126

[13,14]. Coi exerts its inactivating function by binding to the C1 repressors o f P1 and P7 non-covalently [15]. The existence o f a protein which antagonizes the action o f the C1 repressor suggests that Coi participates in the decision process for the lyric or lysogenic pathway. W e imagine that upon infection o f a bacterial cell b y P1, the o u t c o m e o f a ' r a c e ' b e t w e e n c l and c o i transcription and translation channels P I to one o f the two pathways.

3. The i m m T r e g i o n e n c o d e s t h e a u x i l i a r y r e p r e s sor Lxc Mutants o f P1 and PT, called bof, lxc, and c6, w h i c h affect the p h a g e ' s immunity system in different ways, w e r e f o u n d to be located in the i m m T

t73

region (Fig. 1). Most p r o b a b l y they belong to the same g e n e [3]. T h e b o f gene o f P1 w a s cloned and its gene product purified [11,16]. W h e n it b e c a m e clear that B o f lowers the expression o f C1 represser in r i v e and in vitro [12,17] the use o f / x c (for l o w e r s e x p r e s s i o n o f c l ) w a s suggested as an appropriate gene designation [12]. For reasons o f clarity we use only this designation here. The lxc g e n e encodes a small protein o f 82 a m i n o acids. Its calculated molecular mass o f 9664 D a (with a net charge o f + 4) r o u g h l y corresponds to the apparent molecular m a s s o f 7.5 k D a [11]. Lxc protein does not interact with C1 represser alone, but, as shown b y D N A mobility shift experiments, in the presence o f C1 represser L x c binds to all operators tested b y f o r m i n g a C1 • Lxc • operator D N A ternary c o m p l e x [12]. W e do not yet k n o w whether L x c

TC .3s A -lO AATGCTCTAATAAATTT6TATTTTTAAGTCGCGAAT6 CTATCTTTTCGCATC~ATA 0p51 promoter P51a al bl -3s -!o G +,1 S~ / ~ G TTGACCTTTTAATCGTTCAGGCTTATAGTTCCACCGT CGTAGCAMTTCTGCGACCG(~TTCi"GA ~I~CCTGAA'r~]T/~GTGQGGACAACC promoter P51b target RNA 1 A A~ A F " GCA~ATTT~C~ATA-~G~TATT~TrGT6TCCGTAAAC~C~TTAC~CCGAATrAT~-GTG6~GCGT~A~GGG~AGGCTTc~6CCT6CT b'

a'

a2

b2

c GGT~CCAG~CCTGTCACGTCCTGCCAC~-II'G~GGGTAGCAGGTTGTTAAACC~6CCG l . J J UAagGAGGu CA RNA . T wr'suppressor A wr. = target RNA 2 ~osomeur~g s~te [ G A C TAAC~]AT~6TTAAT6~AAT£CTT6CACAC~CCCA~AATTCATCT6~c6TTTCTATTCCT6TAAAAAACACCACTATCACTTC6TTATC6

l

1cO A

A

•A6•AA•T6AA6AC•AA6•A¢6•T•TCAATT6CCT•AT•••••CT6CATTTTTA¢T••CC•TTTTTCTACTAA•TC6•••AATTCA•TTA

GTTACTGGAACCTCCCCTI'CTCTGCCGACGTTCAEGGGGGTTT~TG/~CCTCTCGTCACCCGTAATGA~ATA ......

[

- -

ant

Fig. 3. DNA sequence of the imm[ regulatory region of P1 and P7. The sequence of the P1 imml opvron from the operator OpS1 down to the beginning of the anti-represser gene ant is shown. For P7, only differences from PI are displayed above the sequence. The only insertion relative to P1 is indicated by Ai. Pl mutations are indicated by arrows below the sequence [19]. The c4 gene encoding the processed (]4 antisense RNA is represented by the 77-base nucleotide sequence in brackets [21]. Interaction of CA and target RNAs depends on the complementary, sequences a" versus al and a2 and b' versus bl and b2 (boxed grey areas). The consensus sequence of the E. coli ribosome binding site is indicated below the P1 sequence; the positions where the PI sequence is identical to or divergent from the consensus sequence are indicated by uppercase and lowercase letters, respectively. The translationally coupled genes icd and ant are framed.

124

,I. Heinrich et aL / FEMS Microbiology Reuiews 17 (1995) 121-126

'hooks onto' the operator-bound C1 repressor protein or contacts the operator DNA region and the C1 represser simultaneously. In the ternary complex, the autoregulated cl mRNA synthesis is further downregulated in vitro [12]. Furthermore, the ability of Coi protein to dissociate the C l . o p e r a t o r DNA complex is strongly inhibited in the presence of Lxc [12]. The degree to which the multitude of Cl-controlled genes of P1 arc repressed is influenced by a variation of the operator base sequence a n d / o r th;~ operator position relative to the - 10 and - 35 promoter sequences. The Lxc co-represser protein may serve as an additional clement for a fine-tuning of repression. Moreover, Lxc may be instrumental in establishing P1 as a prophage by preventing the inactivating action of Coi on the C1 represser.

4. Anti.repressor synthesis is controlled by a C4 antisense RNA of the immI region The cluster of genes and regulatory elements in the i m m l region represent a single operon which is under the dual control of the C1 and C4 repressors (Figs. 1 and 3) [18]. C1 controls transcription from promoter P51a via the operator Op51. P51a is shut off in a lysogen.The C4 repressors of P1 and P7 are antisense RNAs that inhibit anti-repressor (Ant) synthesis. This antisense inhibition is unusual in that the prophage (24 repressor and the repressed genes lad and a n t are co-transcribed in that order from the same constitutive promoter P51b, and C4 RNA is processed from a precursor RNA [19-21]. C4 RNA directly represses translation of the icd gene encoding a small polypeptide (Figs, 1 and 3) [22-24]. Repression depends on the interaction of two pairs of short sequences a'/a2 and b ' / b 2 encompassing the ribosome binding site in front of the icd gene [20]. Because of a translational coupling of i c d and a n t 1 [23,24], this ribosome binding site is used for the expression of icd and a n t 1, A second ribosome binding site is found in front of ant 2 (Fig. 1). The C4 antisense-target RNA 2 interaction is indicated schematically in Fig. 4. If the interaction is disturbed, as is the case in a P1 vir s mutant, anti-repressor synthesis is constitutive. The latter can be repressed again when the C4 RNA contains a vir s suppressor mutation [20]. The translational repres-

ee.

target RNA 1

,,,

GUU

at

C CU G A A

uc

04 RNA

uC.GG GC GC AU

I~GUGGGGCGUG AUuGGGG ACCG U CC U GCACUG C C C

Oy"

C

: U ~ GC.UG.G:~U" h, " ~ U G A C C G . ~ ~'~

¢}

U v/r" suppressor

• • • i s l e : CilG! ~

targetRNA2

m

uGu

b2

CGGGUAG b2j •

UA G A UU Fig. 4. C4 antisense and target RNAs of the immI operon of P1 and P7. The C4 R N A of P l is folded into a secondary structure with three loops and three stems [20]. Regions of hypothetical target RNAs of P1 with short sequences complementary to the a' and b' sequences of C4 are folded correspondingly to indicate their presumptive mode of interaction. For P7, only differences from P1 are displayed by circled bases. Base substitutions in P1 mutants are indicated. Numbers indicate the length of the nonprocessed precursor mRNA transcribed from the promoter P51b (1 = + 1 nucleotide position of P51b, Fig. 3). Dark and L;ght grey areas correspond to the boxed sequences shown in Fig. 3 and the region of extended complementarity between C4 and target R N A 2, respectively.

sion exerted by C4 RNA in rum blocks transcription of a n t via a r h o - d e p e n d e n t terminator (Fig. 1)[22]. As a consequence, only C4 RNA but no intact a n t mRNA is found in P1 lysogens [19]. The immunity difference between P1 and P7, which enables one phage to grow on the lysogen of the other was mapped to the region of c4 and v i r s [3]. A sequence comparison reveals that in each of the complementary regions determined for Pl, two bases are substituted in P7, resulting in the same pattern of complementary elements as found for P1 (Figs. 3 and 4). Thus, heteroimmunity of P1 and P7 is due to just four base exchanges that lead to the genome specificity of the phages" CA and target R N A s [20].

J. Heinrich et al. / FEM$ Microbiology Reviews 17 (199.~) 121-126

The fact that C4 and target RNA 2 share the same promoter and that transcription of C4 always precedes ant expression raises the question of how anti-repressor synthesis is ever accomplished. The sequence elements of target RNA 2 of P1 and P7 are also present in a target RNA 1 upstream of c4 (containing a single mismatch in b l ) (Figs. 3 and 4). It is therefore tempting to speculate that a switch to ant expression may involve a flip-flop from an a ' / a 2 and b ' / b 2 to an a ' / a l and b ' / b l base pairing, thereby unmasking the ribosome binding site. This model requires an as yet unknown trigger that would activate target RNA1 to compete with target RNA 2 for base pairing with C4 RNA in a lysogen [20]. The following experimental results support the flip-flop model: during a P1 or P7 wild-type infection cycle both 124 RNA and ant m R N A are synthesized [25,26]. However, only C4 but no ant m R N A is made in bacteria infected by a PT:P1 hybrid phage in which the C4 and target RNA 2 originate from P7 and target RNA 1 originates from P1. This P7:P1 hybrid phage is phenotypicaily A n t - , i.e. it is able to form a stable lysogen and plaques p o o r l y [3] (J. Heinrich and H. Schuster, unpublished results). The existence of the operator Op51-promoter PSla element as part of a dual control of the i m m I operon indicates a 'communication" between i m m C and i m m l . However, the reason why C1 repressor participates in this control is not yet understood. Surprisingly, in the absence of an active 124 RHA, synthesis o f anti-repressor is stimulated when C1 repressor is bound to Op51 [26]. Therefore, C1 control via Op51 cannot be simply considered as a second repression system superimposed over the negative control exerted by C4 RNA.

125

immunity systems, which negatively regulate synthesis of an anti-repressor [28]. However, an auxiliary repressor as a third immunity element is encoded solely by P1 and P7. The complex regulatory circuitt~y may reflect the peculiarity that in the prophage state P1 and P7, unlike phage A and P22, exist as extrachromosomal plasmids. The CA antisense RNA system confers two great advantages to P1 and P7: (i) interaction of only a very limited number of complementary bases of antisense and target RNA is sufficient to repress the led-ant genes (and possibly to reverse repression quickly if necessary); (ii) new immunity specificities are generated by a very small number o f base substitutions in the complementary regions of the RNAs. Compared with this it would be much more difficult to alter the sequence specificity of the C1 repressor if the mumtude of operators had to be additionally modified.

Acknowledgements Part of the work described here came from the continuous efforts of both present and the former members A. Biere, M. Citron, B. Dreiseikelmann, T. Heinzel, M. Heirieh, A. Heisig, and H.-D. Riedel, of our laboratory during the past years. We enjoyed the cooperation with members of the laboratories of W. Arher, Basel, B. Baumstark, Atlanta, and J.B. Hays, Corvallis, during that time. We thank J. Scott, N. Steinberg, and M. Yarmolinsky for the P1 and P7 phage mutants used in this work. We are grateful to D. Vogt for the preparation of plasmid DNA and to F. Bl[ising, S. Freier, A. Giinther and A.-K. Seefluth for expert technical assistance. We thank R. Brimacombe for suggestions to improve writing of the manuscript.

5, Concluding remarks Among the temperate phages, P1 and P7 encode the most complex immunity system. The C1 reptessots of P1 and P7 can be considered to be analogous to the CI and C2 repressors of phage A and P22, respectively. Likewise, the P1 C1 inactivator protein Coi is the counterpart of the Cro protein of A and P22, although the mode of action of Coi and Cro are different [15,27]. In addition to these primary immunity systems, P1, P7 and also P22 encode secondary

References [1] Steinberg, N. (1979) A characterization of bacteriophage P1 DNA fragments cloned in a A vector. Virology 96, 129-142. [2] Mural, RJ., Chesney, R.H., Vapnek, D., Kropf, M.M. and Scott, J.R. (1979) Isolation and characterization of cloned fragments of bacteriophage P1 DNA. Virology 93, 387-397. [3] Yarmolinsky, M.B. and Steinberg, N. (1988) Bacteriophage PI. In: The Bacteriophages (Calendar, R., Ed.), Vol. 1, pp. 291-438, Plenum Press, New York, lqY.

126

J. Heinrich et aL / FEMS Microbiology Reviews 17 ~1095J 121-126

[4] Osborne, F.A., Stovall, S.R. and Baumstark, B.R. (1989) The c l genes of Pl and PT. Nucleic Acids Res. 17, 7671-7680. [5] Heinrich, J., Riedel, H.-D., Banmstark, B.R., Kimnra, M. and Schuster, H. (1989) The c l rcpressor of bacteriophage PI: Operator-repressor interaction of wild-type and mutant rep r e s e t proteins. N,.:cleic Acids Res. 17, 7681-7692. [6] Velleman, M. (1989) Characterization of P1 c t repressorcontrolled operators in the genome of bacteriophage PI. Ph.D. thesis. Freie Universit~t Berlin, Berlin. [7] Citron, M., Velleman, M. and Schuster, H. (1989) Three additional operators, Op21, Op68, and Op88, of bacteriophage P1. J. Biol. Chem. 264, 3611-3617. [8] Lehnherr, H., Velleman, M., Guidolin, A. and Arber, W. (1992) Bacteriophage Pl gone 10 is expressed from a promoter-operator sequence controlled by C1 and Bof proteins. J. Bacteriol, 174, 6138-6144. [9] Heinzel, T., Velleman, M. and Schuster, H. (1989) ban operon of bacteriophage Pl. Mutational analysis of the c l repressor-controlled operator. J. Mol. Biol. 20~, 127-135. [10] Yarmolinsky, M.B. and Lobocka, M.B. (1993) Bacteriophage P1. In: Genetic Maps, book 1, 6th edn. (O'Brian, S,J., Ed.) pp. 1.50-1.61, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. [11] Velleman, M., Heirich, M., Giinther, A. and Schuster, H. (1990) A bacteriophage Pl-encoded modulator protein affects the P1 c l repression system. J. Biol. Chem. 265, 18511-18517. [12] Velleman, M., Heinzei, T. and Schuster, H. (1992) The Bof protein of bacteriophage P1 exerts its modulating function by formation of a ternary complex with operator DNA and C1 repressor. J. Biol. Chem. 267, 12174-12181. [13] Baumstark, B.R., Stovall, S.R. and Bralley, P. (1990) The immC region of phage P t codes for a gone whose product promotes lyric growth. Virology 179, 217-227. [14] Heinzei, T., Velleman, M. and Schuster, H. (1990) The c l repressor inactivator protein col of bacteriophage P1.3. Biol. Chem. 265, 17928-17934. [15] Heinz.el, T., Velleman, M. and Schuster, H. (1992) C1 repressor of phage P1 is inactivated by non-covalent binding of Pl Col protein. 3. Biol. Chem. 267, 4183-4188. [16] Schaefer, T.S. and Hays, J.B. (].990) The bof gene of bacteriophage PI: DNA sequence and evidence for roles in regulation of phage cl and ref genes. J. Bacteriol. 172, 3269-3277. [17] Schaefer, T.S. and Hays, J. (1991) Bacteriophage P1 Bof

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

protein is an indirect positive effector of transcription of the phage bac-I ban gone in some circumstances and a direct negative effector in olher circumstances. J. Bacteriol. 173, 6469-6474. Hvisig, A., Riedel, H.-D., Dobfinski, B., Lurz, R. and Schuster, H. (1989) Organization of the immunity region imml of bacteriophage P1 and synthesis of the Pl antirepressor. J. Moi. Biol. 209, 525-538. Citron, M. (1990) Die c4 Repressoren der Bakteriophagen Pl und P7: Eiu ncuartiger Typ antisense RNA. Ph.D. thesis. Freie Universit~it Berlin, Berlin. Citron, M. and Schuster, H. (1990) The c4 repressors of bacteriophages P1 and P7 are antisense RNAs. Cell 62, 591-598. Citron, M. and Schuster, H. (1992) The c4 repressor of bacteriophage P1 is a processed 77 base antisense RNA. Nucleic Acids Res. 20, 3085-3090. Biere, A.L., Citron, M. and Schuster, H. (1992) Transcriptional control via translational repression by c4 antisense RNA of bacteriophages P1 and P7. Genes Dee. 6, 2409-2416. Riedel, H.-D., Heinrich, J. and Schuster, H. (1993) Cloning, expression, and characterization of the icd gone in the imml operon of bacteriophage Pl. J. Bacteriol. 175, 2833-2838. Heinrlch, J., Citron, M., Gilnther, A, and Schuster, H. (1994) Second-site suppressors of the bacteriophage PI vir s mutant reveal the interdependence of the c4, icd, and ant genes in the P1 immI operon. J. Bacteriol. 176, 4931-4936. Riedel, H.-D., Heinrich, J., Heisig, A., Choli, T. and Schuster, H. (1993) The antirepressor of phage P l - - Isolation and interaction with the C1 rcpressor of P1 and P7. FEBS Lett. 334, 165-169. Heinrieh, J. (1991) Der Antirepressor des Bakteriophagen Pl: Ch~akterisierung seiner Wechseiwirkung mit dem C1 Repressor in rico. Ph.D. thesis. Freie Universit~t Berlin, Berlin. Gussin, G., Johnson, A., Pabo, C. and Saner, R. (1983) Repressor and cro protein: structure, function, and role in lysogenization. In: LAMBDA II (Hendrix, R.W., Roberts, J.W., Staid, F.W. and Weisberg, R.A., Eds.) pp. 347-363. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. Susskind, M. and Youderian, P. (1983) Bacteriophage P22 antirepressor and its control. In: LAMBDA H (Hendrix, R.W., Roberts, J.W., Stnhl, F.W. and Weisberg, R.A., Eds.) pp. 93-121. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY.