- Email: [email protected]
The tropomyosin mRNAs of mouse striated muscles: Molecular cloning of β-tropomyosin
Biochimica et Biophysica Acta, 951 (1988) 117-122
117
Elsevier
BBA 91854
T h e tropomyosin m R N A s of m o u s e striated muscles: molecular cloning of fl-tropomyosin
Colin M c I n n e s * and David P. Leader Deportment o/Biochemistry. University of Glasgow, Glasgow (U.K.) (Received 9 May 1988)
Key words: cDNA; Tropomyosin mRNA; Myoblast; Differentiation; (Mouse muscle)
The nudeotide sequence corresponding to the complete coding region and much of the 5' and 3' untranslated regions of the skeletal muscle-specific mouse fl-tropomyosin mRNA was determined from overlapping cDNA clones isolated from a library of recombinants in pBR322. When one of these was used as a probe to detect tropomyosin mRNAs expressed after fusion of mouse myoblasts in culture, species were detected in addition to those corresponding to known tropomyosins of striated muscle. One of these was also detected in the leg muscle of 12 day-old mice. The identifies of these species are uncertain, but they may correspond to alternatively spliced products of the same RNA transcripts that give rise to the predominant tropomyosin isoforms of striated muscle.
Introduction Tropomyosin is a component of the contractile apparatus of muscle and of the microfilaments of non-muscle cells [1,2]. Different isoforms of tropomyosin are found in different tissues and, although there are known to be at least three distinct tropomyosin genes in mammals, the tissue specificity of the isoforms is generated predominantly through the alternative splicing of primary transcripts from these genes [2,3]. The exact number of alternatively spliced tropomyosin mRNAs is still uncertain.
* Present address: Moredun Research Institute, Edinburgh, U.K. The sequence data in this paper have been submitted to the EMBL/Genbank Data Libraries under the accession number 12650. Correspondence: D.P. Leader, Department of Biochemistry, University of Glasgow, Glasgow G12 8QQ, U.K.
In striated muscle, two types of tropomyosin were originally identified: a- and fl-tropomyosins. Both of these are found in skeletal muscle, but in cardiac muscle, fl-tropomyosin is absent [4]. The cDNAs corresponding to a-tropomyosin have been characterized, and it has been found that, in fact, two species exist: a form (a~) present in fast-twitch fibres of skeletal muscle (and which is particularly abundant in cardiac muscle) [5,6], and a second form (a2) present in the slow-twitch fibres of skeletal muscle (and relatively less abundantly in heart muscle) [6]. The fl-tropomyosin mRNA is less well characterized, and at the time that this work was initiated, the only corresponding mammalian cDNA clone was one from man, which lacked sequences corresponding to the 5' coding and non-coding regions of the mRNA [7]. We report here the isolation of a mouse fl-tropomyosin eDNA clone containing the complete coding region and substantial portions of the 5' and 3' non-coding regions of the mRNA. We have used this as a probe to investigate the expression of tropomyopsin mRNA during myoblast differenti-
0167-4781/88/$03.50 O 1988 Elsevier Science Publishers B.V. (Biomedical Division)
118
ation and have obtained results that suggest a transient phase in which multiple species of tropomyosin mRNAs are expressed before a state is achieved in which the forms found in mature striated muscle predominate.
complete sequence of pmTB2 and the sequence of parts of pmTB3 were determined by the chaintermination method [10] after subcloning into M 13 vectors, M l 3 m p l 8 and M13mpl9 [11]. Cell culture. The mouse mvoblast cell line, C2C12 [12], was maintained in l)ulbecco's minimal essential medium supplemented with 20S~ foctal calf serum and 0.5% chick-embryo extract [13]. Fusion was induced by replacing the medium bv one containing 2%. horse serum. RNA hrbridisation. Total RNA isolated from myoblasts or from mouse muscle tissues was subjected to agarose gel electrophoresis in the presence of formaldehyde [14]. The RNA was transferred to nitrocellulose and hybridised to the Pstl fragment of clone pmTB1, the final washing being at 4 2 ° C in the presence of 0.1 × SSC/0.1% sodium dodecyl sulphate.
Experimental procedures Screening of eDNA library. The construction of the mouse skeletal muscle cDNA library in plasmid vector pBR322 has been described previously [8]. It was differentially screened with .~2P-labelled single-stranded cDNA reverse-transcribed from mouse skeletal and cardiac muscle poly(A) + RNA, first by colony hybridisation and then by hybridisation to plasmid DNA immobilised on nitrocellulose. The final screening was with the .~2p_ labelled cloned plasmid DNA as a probe against immobilised poly(A) + RNA isolated from mouse skeletal muscle, cardiac muscle, liver and brain. The final washing of the nitrocellulose was at 5 5 ° C with 0.1 × SSC/0.1% sodium dodecyl sulphate (SSC is 0.15 M NaCI/0.015 M sodium citrate). Nucleotide sequence determination. The sequence of the insert of the initial clone isolated (subsequently named pmTB1) was determined by the chemical method [9]. Conceptual translation of this identified the clone as corresponding to fltropomyosin [4]. As the clone was incomplete, 32p-labelled pmTB1 DNA was used to rescreen the skeletal muscle cDNA-library, and two longer clones, pmTB2 and pmTB3, were obtained. The
Results and Discussion The fl-tropomyosin inserts in the cDNA clones isolated from the mouse skeletal muscle library and the strategy for the determination of their sequences arc shown diagrammatically in Fig. l, and the deduced nucleotide sequence in Fig. 2. The amino-acid sequence of mouse fl-tropomyosin predicted from this corresponds exactly to that determined directly for rabbit fl-tropomyosin [4]. The 1.1 kb of cDNA sequenced compares with an estimated 1.3 kb for the polyadenylated mRNA (Fig. 3B), indicating that only small portions arc lacking. Comparison with the results of primer
DmI~3 1 Dm TP,2
I I DnTB1
I
I
_
fl
..
~
~
500
1ooo
: .....
-
~
;
~-
',
~
-I
--I
I
I m,
~
7)0
I
mb
',
Fig. 1. Physical map and strategy for determination of the nucleotide sequence of cDNA corresponding to mouse /3-tropomyosin mRNA. Sequencing of the sense and anti-sense strands is indicated by arrows above and below the broken line. respectively.
Leu Lys Ser Leu Glu Ala TTG AAA TCC CTG G A A G C C
284 Set Leu TCC CTC
Lys Met Lys AAG ATG AAG
Tyr Lys A l a TAC A A G G C C
Glu Leu A s p Ash GAG CTG GAC AAC
270 Ile Ser G l u ATC A G C G A G
Tyr Ser Thr TAT TCC ACC
Glu Arg Ser Val G A A AGA TCT GTG
Lys AAG
Ala Glu Val Ala GCC G A G G T G GCT
Glu GAG
Phe A l a TTT G C T
240 Glu GAG
210 Gin A l a A s p CAA G C G G A C
Glu GAG
Ser Glu Arg GIy AGC G A G A G A GGA
End TGA G T C C C C A C T G T G G C C A T C G C A G G C C C C T T T C T C T C C T C T C T T T A C A T T C T C T C T G A G G G G A G G G G G C A G C C A G G A G G A G C A C C
260 lle A s p A s p Leu Glu Asp Glu Val ATT G A T GAT CTG G A A GAT G A A G T C
I ] O]
1033
923
833
743
653
563
473
383
293
203
113
Fig. 2. Nucleotide sequence of mouse ~-tropomyosin c D N A . The numbering of the amino acids conforms with that reported in Ref. 4, the amino-terminal Met being found in the mature protein.
AGCTAC~CCACGTTGCACAGCCAGCCTGAGGGCAGCCTGAGGAACACGTCTGCCACCCCTGCCACCCAC
280 Ala Leu Asn Asp ile Thr GCA CTC AAT GAC ATC ACT
Lys Thr AAA ACC
Tyr Ala Gln TAT G C A C A G
Thr Ash Ash ACC AAC A A C
120 Ala A s p Glu GCG G A T G A G
90 Arg A r g Ile Gln Leu Val CGC C G C A T T C A G CTC G T A
180 Ser Glu Glu Arg TCG GAA G A G A G A
250 Ala Lys Leu Glu GCA AAG TTG GAG
200 Glu Leu Lys Ile Val GAG CTG AAA ATT G T T
170 Lys Leu Val Ile Leu Glu GIy Glu Leu Glu Arg AAG C T G G T G ATC CTG G A A GGG GAG CTG GAG C G C
II0 Leu Gln Lys Leu Glu Glu Ala Glu Lys Ala TTG CAA AAG CTG GAG GAG GCT GAG A A A G C C
Lys Leu Lys Glu Ala Glu Thr A r g Ala AAG CTG A A A GAG GCT G A G ACC C G A G C A
Leu Glu Glu CTA GAG G A G
Ala Arg GCC A G G
Leu Ala Thr Ala CTG GCT A C A G C C
Asp Val Ala Ser Leu Ash GAT GTG GCC TCT CTG A A C
220 230 Lys Glu Asp Lys Tyr Glu Glu Glu Ile Lys Leu Leu Glu Glu AAA GAG GAC AAA TAC G A A G A A G A G ATC A A A CTT CTG G A G G A G
190 Glu Ser Lys Cys G ! y A s p GAG AGT AAA TGT GGG GAC
Glu Val GAG G T G
150 140 Arg Ala Met Lys Asp Glu GIu Lys Met Glu Leu Gln Glu Met Gin Leu Lys Glu A l a Lys His Ile Ala CGG GCC ATG AAG GAT GAG G A A A A G ATG GAG CTG CAG GAG ATG CAG C T G A A G G A A G C C A A G CAC ATC G C T
130 Met Lys Val Ile Glu Ash ATG AAG GTC ATT GAA A A C
160 Asp Ser Asp Arg Lys Tyr Glu GAC TCA GAC CGC AAA TAT GAG
Gln Glu Arg CAG GAG CGC
I00 GIu GIu Leu Asp Arg A l a GAG GAG TTG GAT CGG G C A
80 Lys Lys Ala Thr A s p Ala Glu Ala AAG A A G GCC ACC GAC GCT G A A G C A
Gln Ala Glu CAG GCT G A G
Ser Val Lys A s p TCC G T G AAG GAT
70 Ala Gin Glu Lys Leu Glu GCC CAG GAG AAA CTG G A G
60 Lys Tyr Ser Glu AAG TAT TCC G A G
50 Leu Gln Lys Lys Leu Lys Gly Thr Glu Asp Glu Val Glu CTC CAG AAG A A G C T G AAG GGG ACA GAG GAC GAG GTG G A A
Gln Gin Ala CAG CAG GCC
40 Lys Gln Leu Glu GIu Glu AAG CAG CTG GAG G A A G A G
Glu A s p Arq Cys GAA GAC CGA TGC
30 20 Glu Ash Ala Ile A s p Arg Ala Glu Gln Ala Glu Ala A s p Lys Lys G l n A l a GAG AAT GCC ATC G A C CGC GCG G A G CAG GCC G A A GCC G A C A A A AAG C A A G C T
I0 Lys Met Gin Met Leu Lys Leu Asp Lys AAG ATG CAG ATC CTG A A A CTG GAC AAG
CCTCCTGACCTGTCCCCTGTGCA•[CCAGAGCTCGCGCCTAGCCCAGTCTACCTACTCTTCACCGCTCTCCCGCCAGCCCACTCCCCACCGCAGCC
i Met A s p Ala lle Lys Lys A T G G A C GCC ATC A A G AAG
120
A
13
e o,, o
u2,4
~] .3 ~1.25
o 0 S
L
C
B
SLCB
Fig. 3. ttybridisation of cDNA clone pmTBl to poly(A)" RNA from different mouse tissues. (A) Hybridisation to "dot-blotted' R N A , the amounts of which, from the bottom to the top of the Fig. were 0.04, 0.08, 0.16, 0.32, 0.63, 0.125, 0.25, 0.5 and 1.0 p.g. (B) Hybridisation to RNA transferred to nitrocellulose after electrophoresis through an agarose gel containing formaldehyde. The RNA was from: S, skeletal muscle (2 p.g); L, liver (10 ttg); (', cardiac muscle (2 p,g); and B, brain (10 p.g). The numbers given are the lengths of the mRNAs in kb, as estimated from standards included in the gel. Note that there is no discrete hybridising band in lane 1,, but a nonspecific blemish in the 1.3 kb region.
extension reported recently for a shorter rat c D N A clone [15] suggests that only about 15 nucleotides are missing from the 5' end. The 3' end lacks approx. 80 nucleotides [15]. The specificity of the //-tropomyosin c D N A clone, pmTB], for skeletal muscle tissue was evident from its lack of hybridisation to poly(A) + R N A from other tissues immobilised by 'dot-blotting' onto nitrocellulose (Fig. 3A). When less "stringent' washing conditions were used, cross-hybridisation to cardiac muscle m R N A occurred (Fig. 3B). Careful inspection of Fig. 3B and Fig. 5 reveals that cardiac muscle tropomyosin m R N A is resolved into two species of 1.3 and 1.25 kb, whereas in skeletal muscle, only a 1.3 kb band can be seen. We assume that the 1.3 kb band in skeletal muscle RNA contains both the /3- and
~2-tropon3yosin mRNAs, whereas in cardiac muscle, it contains onl\' the ~2-~,pecies. It would seem most likely that the 1.25 kb band in cardiac muscle corresponds to ~l-tropomyosin m R N A , which has been shown to be absent from human leg muscle, and hence ma\, well also be absent from mouse muscle [61. In addition to the 1.3 kb tropomyosin m R N A in skeletal muscle, a minor but quite distinct species of 2.4 kb was also present (Fig. 3B). The only tropomyosin m R N A of this approximate size so far reported is the 2.5 kb human non-muscle m R N A derived from the same primary transcript that can alternatively give rise to the ~t,tropomyosin. Although this m R N A was not detected in human adult leg muscle, its occurrence in the leg muscle of 12-day-old mice might represent a residual persistence from an earlier stage of development, as it has been found to be present m human foetal leg muscle [61. Experiments were performed in which the fltropomyosin e D N A was used as a probe at low stringency to study the expression of tropomyosin m R N A s during the differentiation of the myoblast cell line, C2C12 (Fig. 4). In pre-fusion myoblasts, neither the 1.3 or 2.4 kb tropomyosin m R N A s of Fig. 3B were detectable, but both of these were induced following fusion (Fig. 5). The initial expression of the 2.4 kb m R N A appeared to precede somewhat that of the 1.3 kb rnRNA, and it was clear that its abundance relative to the latter was appreciably greater than in mouse leg muscle. This, also, is consistent with the presence of thi.,, m R N A in the latter situation representing persistence from an earlier developmental stage. It can also be seen that other tropomyosin m R N A species are expressed in fused myoblasts. As abundant as the 1.3 kb species is a 1.2 kb m R N A (Fig. 5) not detected in mouse leg muscle (Fig. 3B). Parallel electrophoresis showed unequivt~.'ally that this myoblast 1.2 kb m R N A species is distinct from the cardiac rnuscle 1.25 kb species. On the basis of comparison with tropomyosin species observed by others, this may possibly correspond to the rat 1.1 kb non-muscle m R N A derived from the same primary transcript that can alternatively give rise to /3-tropomyosin m R N A [15]. If these identifications should prove to be correct, they would imply that the initial induction of the
121 m R N A s for the m a j o r a 2- a n d ~ - t r o p o m y o s i n s of skeletal muscle is a c c o m p a n i e d b y transient expression of o t h e r m R N A s that can b e alternatively spliced from the s a m e p r i m a r y transcripts. This w o u l d resemble to a certain extent the co-expression of actin m R N A s in similar circumstances, but with the differences that, in the case of actin, the c o - e x p r e s s e d isoforms ( a - c a r d i a c and a-skeletal)
2.4
.6 .4
] .3 ] .25
.3 .2
I
S
C ] 23
45
Fig. 5. Expression of tropomyosin mRNAs during the differentiation of myoblasts. Electrophoresis of 2 ~g total RNA was as described for Fig. 3B. The different lanes of the gel contained RNA from S, skeletal muscle or C, cardiac muscle of 12-day-old mice, or from myoblasts: 1, 24 h; 2, 48 h; 3, 64 h; 4, 88 h; or 5, 112 h after sub-culturing. Fusion was initiated at 48 h. Some non-specific hybridisation to 18 S and 28 S rRNA may be apparent between the 1.3 and 2.4 kb marks, and above the 2.6 kb m~irk.
C
Fig. 4. Fusion of mouse C2C12 myoblasts. The photographs are of cells (A)24, (B)56 and (C)112 h after subculturing, with fusion initiated at 48 h by changing the serum content of the medium as described in Experimental Procedures.
are both specific for striated muscle, a n d that the m R N A s for the actin isoforms are t r a n s c r i b e d from s e p a r a t e genes [16]. A l t h o u g h we regard the a b o v e as the s i m p l e s t i n t e r p r e t a t i o n of our results, a recent p a p e r indicates that the multiplicity of t r o p o m y o s i n m R N A s p r o d u c e d by a l t e r n a t i v e splicing is greater than had been thought [17]. T h a t this c o m p l e x i t y m a y be relevant to d i f f e r e n t i a t i n g m y o b l a s t s is indic a t e d by an a d d i t i o n a l 2.6 kb t r o p o m y o s i n m R N A in Fig. 5, which does not a p p e a r to c o r r e s p o n d to a n y species previously described. It is clear that a b a t t e r y of isoform-specific p r o b e s will be required to elucidate the exact n a t u r e of the t r o p o m y o s i n m R N A s expressed d u r i n g the d i f f e r e n t i a t i o n of skeletal muscle.
Acknowledgements W e t h a n k Dr. R o s e m a r y A k h u r s t for the m o u s e m y o b l a s t cell line a n d a c k n o w l e d g e the s u p p o r t of
122
a grant from the Muscular Dystrophy Group of Great Britain to D.P.L. References 1 Smillie, L.B. (1979) Trends Biochem. Sci. 4, 151-155. 2 MacLeod, A.R. (1987) BioEssays 6, 208-212. 3 Nadal-Ginard. B., Breitbart, R., Strehler, E.. Ruiz-Opazo, N., Periasamy, M. and Mahdavi, V. (1986) in Molecular Biology of Muscle Development (Nadal-Ginard, B. and Siddiqui, M., eds.), pp. 387-410, Alan Liss, New York. 4 Mak, A.S., Snaillie, L.B. and Stewart, G.R. 11980) J. Biol. Chem. 255, 3647-3655. 5 Ruiz-Apazo, N. and NadaI-Ginard. B. (1987) J. Biol. ('hem. 262, 4755-4765. 6 MacLeod, A.R. and Gooding. C. (1988) Mol. (_:ell. Biol. 8. 433-440. 7 MacLeod, A.R., Houlker, C., Reinach. F.C., Smillie, L.B., Talbot. K., Modi, (;. and Walsh, F.S. (1985) Proc. Natl. Acad. Sci. USA 82. 7835-7839.
8 Leader, D.P., Gall, I., Campbell. P. and Frischauf. A.M. (1986) DNA 5, 235-238. 9 Maxam, A.M. and Gilbert, W. (1980) Methods Enzymol. 65, 499 560. 10 Sanger, 1:., Nicklen, S. and Coulson. A.R. ~1977) Prc~,'. Natl. Acad. Sci. USA 74, 5463- 5467. 11 Yanisch-Perron, C., Viera. J. and Messing, J. (1985) Gene 33, 103 119. 12 Blau, H.M., Chiu, C.-P. and Webster, (`'. (1983) ('ell 32, 1171 1180. 13 Yaffe, D. and Saxel, O. (1977) Nature 270, 725-727. 14 Lehrach, I1., Diamond, 1)., Wozney, J.M. and Boedtker, H. (1977) Biochemistry 16, 4743-4751. 15 Ilelfman, D.M., Cheley, S., Kuismanen, E., Finn, L.A. and Yamawaki-Kataoka, Y. (1986) Mol. (,'ell. Biol. 6, 3582- 3595. 16 Buckingham, M.I:,. (1985) Essays Biochem. 20. 77-109. 17 Wieczorek, D.F., Smith, C.WJ. and Nadal-Ginard, 13. (1988) Mol. ('ell. Biol. 8, 679-694.
117
Elsevier
BBA 91854
T h e tropomyosin m R N A s of m o u s e striated muscles: molecular cloning of fl-tropomyosin
Colin M c I n n e s * and David P. Leader Deportment o/Biochemistry. University of Glasgow, Glasgow (U.K.) (Received 9 May 1988)
Key words: cDNA; Tropomyosin mRNA; Myoblast; Differentiation; (Mouse muscle)
The nudeotide sequence corresponding to the complete coding region and much of the 5' and 3' untranslated regions of the skeletal muscle-specific mouse fl-tropomyosin mRNA was determined from overlapping cDNA clones isolated from a library of recombinants in pBR322. When one of these was used as a probe to detect tropomyosin mRNAs expressed after fusion of mouse myoblasts in culture, species were detected in addition to those corresponding to known tropomyosins of striated muscle. One of these was also detected in the leg muscle of 12 day-old mice. The identifies of these species are uncertain, but they may correspond to alternatively spliced products of the same RNA transcripts that give rise to the predominant tropomyosin isoforms of striated muscle.
Introduction Tropomyosin is a component of the contractile apparatus of muscle and of the microfilaments of non-muscle cells [1,2]. Different isoforms of tropomyosin are found in different tissues and, although there are known to be at least three distinct tropomyosin genes in mammals, the tissue specificity of the isoforms is generated predominantly through the alternative splicing of primary transcripts from these genes [2,3]. The exact number of alternatively spliced tropomyosin mRNAs is still uncertain.
* Present address: Moredun Research Institute, Edinburgh, U.K. The sequence data in this paper have been submitted to the EMBL/Genbank Data Libraries under the accession number 12650. Correspondence: D.P. Leader, Department of Biochemistry, University of Glasgow, Glasgow G12 8QQ, U.K.
In striated muscle, two types of tropomyosin were originally identified: a- and fl-tropomyosins. Both of these are found in skeletal muscle, but in cardiac muscle, fl-tropomyosin is absent [4]. The cDNAs corresponding to a-tropomyosin have been characterized, and it has been found that, in fact, two species exist: a form (a~) present in fast-twitch fibres of skeletal muscle (and which is particularly abundant in cardiac muscle) [5,6], and a second form (a2) present in the slow-twitch fibres of skeletal muscle (and relatively less abundantly in heart muscle) [6]. The fl-tropomyosin mRNA is less well characterized, and at the time that this work was initiated, the only corresponding mammalian cDNA clone was one from man, which lacked sequences corresponding to the 5' coding and non-coding regions of the mRNA [7]. We report here the isolation of a mouse fl-tropomyosin eDNA clone containing the complete coding region and substantial portions of the 5' and 3' non-coding regions of the mRNA. We have used this as a probe to investigate the expression of tropomyopsin mRNA during myoblast differenti-
0167-4781/88/$03.50 O 1988 Elsevier Science Publishers B.V. (Biomedical Division)
118
ation and have obtained results that suggest a transient phase in which multiple species of tropomyosin mRNAs are expressed before a state is achieved in which the forms found in mature striated muscle predominate.
complete sequence of pmTB2 and the sequence of parts of pmTB3 were determined by the chaintermination method [10] after subcloning into M 13 vectors, M l 3 m p l 8 and M13mpl9 [11]. Cell culture. The mouse mvoblast cell line, C2C12 [12], was maintained in l)ulbecco's minimal essential medium supplemented with 20S~ foctal calf serum and 0.5% chick-embryo extract [13]. Fusion was induced by replacing the medium bv one containing 2%. horse serum. RNA hrbridisation. Total RNA isolated from myoblasts or from mouse muscle tissues was subjected to agarose gel electrophoresis in the presence of formaldehyde [14]. The RNA was transferred to nitrocellulose and hybridised to the Pstl fragment of clone pmTB1, the final washing being at 4 2 ° C in the presence of 0.1 × SSC/0.1% sodium dodecyl sulphate.
Experimental procedures Screening of eDNA library. The construction of the mouse skeletal muscle cDNA library in plasmid vector pBR322 has been described previously [8]. It was differentially screened with .~2P-labelled single-stranded cDNA reverse-transcribed from mouse skeletal and cardiac muscle poly(A) + RNA, first by colony hybridisation and then by hybridisation to plasmid DNA immobilised on nitrocellulose. The final screening was with the .~2p_ labelled cloned plasmid DNA as a probe against immobilised poly(A) + RNA isolated from mouse skeletal muscle, cardiac muscle, liver and brain. The final washing of the nitrocellulose was at 5 5 ° C with 0.1 × SSC/0.1% sodium dodecyl sulphate (SSC is 0.15 M NaCI/0.015 M sodium citrate). Nucleotide sequence determination. The sequence of the insert of the initial clone isolated (subsequently named pmTB1) was determined by the chemical method [9]. Conceptual translation of this identified the clone as corresponding to fltropomyosin [4]. As the clone was incomplete, 32p-labelled pmTB1 DNA was used to rescreen the skeletal muscle cDNA-library, and two longer clones, pmTB2 and pmTB3, were obtained. The
Results and Discussion The fl-tropomyosin inserts in the cDNA clones isolated from the mouse skeletal muscle library and the strategy for the determination of their sequences arc shown diagrammatically in Fig. l, and the deduced nucleotide sequence in Fig. 2. The amino-acid sequence of mouse fl-tropomyosin predicted from this corresponds exactly to that determined directly for rabbit fl-tropomyosin [4]. The 1.1 kb of cDNA sequenced compares with an estimated 1.3 kb for the polyadenylated mRNA (Fig. 3B), indicating that only small portions arc lacking. Comparison with the results of primer
DmI~3 1 Dm TP,2
I I DnTB1
I
I
_
fl
..
~
~
500
1ooo
: .....
-
~
;
~-
',
~
-I
--I
I
I m,
~
7)0
I
mb
',
Fig. 1. Physical map and strategy for determination of the nucleotide sequence of cDNA corresponding to mouse /3-tropomyosin mRNA. Sequencing of the sense and anti-sense strands is indicated by arrows above and below the broken line. respectively.
Leu Lys Ser Leu Glu Ala TTG AAA TCC CTG G A A G C C
284 Set Leu TCC CTC
Lys Met Lys AAG ATG AAG
Tyr Lys A l a TAC A A G G C C
Glu Leu A s p Ash GAG CTG GAC AAC
270 Ile Ser G l u ATC A G C G A G
Tyr Ser Thr TAT TCC ACC
Glu Arg Ser Val G A A AGA TCT GTG
Lys AAG
Ala Glu Val Ala GCC G A G G T G GCT
Glu GAG
Phe A l a TTT G C T
240 Glu GAG
210 Gin A l a A s p CAA G C G G A C
Glu GAG
Ser Glu Arg GIy AGC G A G A G A GGA
End TGA G T C C C C A C T G T G G C C A T C G C A G G C C C C T T T C T C T C C T C T C T T T A C A T T C T C T C T G A G G G G A G G G G G C A G C C A G G A G G A G C A C C
260 lle A s p A s p Leu Glu Asp Glu Val ATT G A T GAT CTG G A A GAT G A A G T C
I ] O]
1033
923
833
743
653
563
473
383
293
203
113
Fig. 2. Nucleotide sequence of mouse ~-tropomyosin c D N A . The numbering of the amino acids conforms with that reported in Ref. 4, the amino-terminal Met being found in the mature protein.
AGCTAC~CCACGTTGCACAGCCAGCCTGAGGGCAGCCTGAGGAACACGTCTGCCACCCCTGCCACCCAC
280 Ala Leu Asn Asp ile Thr GCA CTC AAT GAC ATC ACT
Lys Thr AAA ACC
Tyr Ala Gln TAT G C A C A G
Thr Ash Ash ACC AAC A A C
120 Ala A s p Glu GCG G A T G A G
90 Arg A r g Ile Gln Leu Val CGC C G C A T T C A G CTC G T A
180 Ser Glu Glu Arg TCG GAA G A G A G A
250 Ala Lys Leu Glu GCA AAG TTG GAG
200 Glu Leu Lys Ile Val GAG CTG AAA ATT G T T
170 Lys Leu Val Ile Leu Glu GIy Glu Leu Glu Arg AAG C T G G T G ATC CTG G A A GGG GAG CTG GAG C G C
II0 Leu Gln Lys Leu Glu Glu Ala Glu Lys Ala TTG CAA AAG CTG GAG GAG GCT GAG A A A G C C
Lys Leu Lys Glu Ala Glu Thr A r g Ala AAG CTG A A A GAG GCT G A G ACC C G A G C A
Leu Glu Glu CTA GAG G A G
Ala Arg GCC A G G
Leu Ala Thr Ala CTG GCT A C A G C C
Asp Val Ala Ser Leu Ash GAT GTG GCC TCT CTG A A C
220 230 Lys Glu Asp Lys Tyr Glu Glu Glu Ile Lys Leu Leu Glu Glu AAA GAG GAC AAA TAC G A A G A A G A G ATC A A A CTT CTG G A G G A G
190 Glu Ser Lys Cys G ! y A s p GAG AGT AAA TGT GGG GAC
Glu Val GAG G T G
150 140 Arg Ala Met Lys Asp Glu GIu Lys Met Glu Leu Gln Glu Met Gin Leu Lys Glu A l a Lys His Ile Ala CGG GCC ATG AAG GAT GAG G A A A A G ATG GAG CTG CAG GAG ATG CAG C T G A A G G A A G C C A A G CAC ATC G C T
130 Met Lys Val Ile Glu Ash ATG AAG GTC ATT GAA A A C
160 Asp Ser Asp Arg Lys Tyr Glu GAC TCA GAC CGC AAA TAT GAG
Gln Glu Arg CAG GAG CGC
I00 GIu GIu Leu Asp Arg A l a GAG GAG TTG GAT CGG G C A
80 Lys Lys Ala Thr A s p Ala Glu Ala AAG A A G GCC ACC GAC GCT G A A G C A
Gln Ala Glu CAG GCT G A G
Ser Val Lys A s p TCC G T G AAG GAT
70 Ala Gin Glu Lys Leu Glu GCC CAG GAG AAA CTG G A G
60 Lys Tyr Ser Glu AAG TAT TCC G A G
50 Leu Gln Lys Lys Leu Lys Gly Thr Glu Asp Glu Val Glu CTC CAG AAG A A G C T G AAG GGG ACA GAG GAC GAG GTG G A A
Gln Gin Ala CAG CAG GCC
40 Lys Gln Leu Glu GIu Glu AAG CAG CTG GAG G A A G A G
Glu A s p Arq Cys GAA GAC CGA TGC
30 20 Glu Ash Ala Ile A s p Arg Ala Glu Gln Ala Glu Ala A s p Lys Lys G l n A l a GAG AAT GCC ATC G A C CGC GCG G A G CAG GCC G A A GCC G A C A A A AAG C A A G C T
I0 Lys Met Gin Met Leu Lys Leu Asp Lys AAG ATG CAG ATC CTG A A A CTG GAC AAG
CCTCCTGACCTGTCCCCTGTGCA•[CCAGAGCTCGCGCCTAGCCCAGTCTACCTACTCTTCACCGCTCTCCCGCCAGCCCACTCCCCACCGCAGCC
i Met A s p Ala lle Lys Lys A T G G A C GCC ATC A A G AAG
120
A
13
e o,, o
u2,4
~] .3 ~1.25
o 0 S
L
C
B
SLCB
Fig. 3. ttybridisation of cDNA clone pmTBl to poly(A)" RNA from different mouse tissues. (A) Hybridisation to "dot-blotted' R N A , the amounts of which, from the bottom to the top of the Fig. were 0.04, 0.08, 0.16, 0.32, 0.63, 0.125, 0.25, 0.5 and 1.0 p.g. (B) Hybridisation to RNA transferred to nitrocellulose after electrophoresis through an agarose gel containing formaldehyde. The RNA was from: S, skeletal muscle (2 p.g); L, liver (10 ttg); (', cardiac muscle (2 p,g); and B, brain (10 p.g). The numbers given are the lengths of the mRNAs in kb, as estimated from standards included in the gel. Note that there is no discrete hybridising band in lane 1,, but a nonspecific blemish in the 1.3 kb region.
extension reported recently for a shorter rat c D N A clone [15] suggests that only about 15 nucleotides are missing from the 5' end. The 3' end lacks approx. 80 nucleotides [15]. The specificity of the //-tropomyosin c D N A clone, pmTB], for skeletal muscle tissue was evident from its lack of hybridisation to poly(A) + R N A from other tissues immobilised by 'dot-blotting' onto nitrocellulose (Fig. 3A). When less "stringent' washing conditions were used, cross-hybridisation to cardiac muscle m R N A occurred (Fig. 3B). Careful inspection of Fig. 3B and Fig. 5 reveals that cardiac muscle tropomyosin m R N A is resolved into two species of 1.3 and 1.25 kb, whereas in skeletal muscle, only a 1.3 kb band can be seen. We assume that the 1.3 kb band in skeletal muscle RNA contains both the /3- and
~2-tropon3yosin mRNAs, whereas in cardiac muscle, it contains onl\' the ~2-~,pecies. It would seem most likely that the 1.25 kb band in cardiac muscle corresponds to ~l-tropomyosin m R N A , which has been shown to be absent from human leg muscle, and hence ma\, well also be absent from mouse muscle [61. In addition to the 1.3 kb tropomyosin m R N A in skeletal muscle, a minor but quite distinct species of 2.4 kb was also present (Fig. 3B). The only tropomyosin m R N A of this approximate size so far reported is the 2.5 kb human non-muscle m R N A derived from the same primary transcript that can alternatively give rise to the ~t,tropomyosin. Although this m R N A was not detected in human adult leg muscle, its occurrence in the leg muscle of 12-day-old mice might represent a residual persistence from an earlier stage of development, as it has been found to be present m human foetal leg muscle [61. Experiments were performed in which the fltropomyosin e D N A was used as a probe at low stringency to study the expression of tropomyosin m R N A s during the differentiation of the myoblast cell line, C2C12 (Fig. 4). In pre-fusion myoblasts, neither the 1.3 or 2.4 kb tropomyosin m R N A s of Fig. 3B were detectable, but both of these were induced following fusion (Fig. 5). The initial expression of the 2.4 kb m R N A appeared to precede somewhat that of the 1.3 kb rnRNA, and it was clear that its abundance relative to the latter was appreciably greater than in mouse leg muscle. This, also, is consistent with the presence of thi.,, m R N A in the latter situation representing persistence from an earlier developmental stage. It can also be seen that other tropomyosin m R N A species are expressed in fused myoblasts. As abundant as the 1.3 kb species is a 1.2 kb m R N A (Fig. 5) not detected in mouse leg muscle (Fig. 3B). Parallel electrophoresis showed unequivt~.'ally that this myoblast 1.2 kb m R N A species is distinct from the cardiac rnuscle 1.25 kb species. On the basis of comparison with tropomyosin species observed by others, this may possibly correspond to the rat 1.1 kb non-muscle m R N A derived from the same primary transcript that can alternatively give rise to /3-tropomyosin m R N A [15]. If these identifications should prove to be correct, they would imply that the initial induction of the
121 m R N A s for the m a j o r a 2- a n d ~ - t r o p o m y o s i n s of skeletal muscle is a c c o m p a n i e d b y transient expression of o t h e r m R N A s that can b e alternatively spliced from the s a m e p r i m a r y transcripts. This w o u l d resemble to a certain extent the co-expression of actin m R N A s in similar circumstances, but with the differences that, in the case of actin, the c o - e x p r e s s e d isoforms ( a - c a r d i a c and a-skeletal)
2.4
.6 .4
] .3 ] .25
.3 .2
I
S
C ] 23
45
Fig. 5. Expression of tropomyosin mRNAs during the differentiation of myoblasts. Electrophoresis of 2 ~g total RNA was as described for Fig. 3B. The different lanes of the gel contained RNA from S, skeletal muscle or C, cardiac muscle of 12-day-old mice, or from myoblasts: 1, 24 h; 2, 48 h; 3, 64 h; 4, 88 h; or 5, 112 h after sub-culturing. Fusion was initiated at 48 h. Some non-specific hybridisation to 18 S and 28 S rRNA may be apparent between the 1.3 and 2.4 kb marks, and above the 2.6 kb m~irk.
C
Fig. 4. Fusion of mouse C2C12 myoblasts. The photographs are of cells (A)24, (B)56 and (C)112 h after subculturing, with fusion initiated at 48 h by changing the serum content of the medium as described in Experimental Procedures.
are both specific for striated muscle, a n d that the m R N A s for the actin isoforms are t r a n s c r i b e d from s e p a r a t e genes [16]. A l t h o u g h we regard the a b o v e as the s i m p l e s t i n t e r p r e t a t i o n of our results, a recent p a p e r indicates that the multiplicity of t r o p o m y o s i n m R N A s p r o d u c e d by a l t e r n a t i v e splicing is greater than had been thought [17]. T h a t this c o m p l e x i t y m a y be relevant to d i f f e r e n t i a t i n g m y o b l a s t s is indic a t e d by an a d d i t i o n a l 2.6 kb t r o p o m y o s i n m R N A in Fig. 5, which does not a p p e a r to c o r r e s p o n d to a n y species previously described. It is clear that a b a t t e r y of isoform-specific p r o b e s will be required to elucidate the exact n a t u r e of the t r o p o m y o s i n m R N A s expressed d u r i n g the d i f f e r e n t i a t i o n of skeletal muscle.
Acknowledgements W e t h a n k Dr. R o s e m a r y A k h u r s t for the m o u s e m y o b l a s t cell line a n d a c k n o w l e d g e the s u p p o r t of
122
a grant from the Muscular Dystrophy Group of Great Britain to D.P.L. References 1 Smillie, L.B. (1979) Trends Biochem. Sci. 4, 151-155. 2 MacLeod, A.R. (1987) BioEssays 6, 208-212. 3 Nadal-Ginard. B., Breitbart, R., Strehler, E.. Ruiz-Opazo, N., Periasamy, M. and Mahdavi, V. (1986) in Molecular Biology of Muscle Development (Nadal-Ginard, B. and Siddiqui, M., eds.), pp. 387-410, Alan Liss, New York. 4 Mak, A.S., Snaillie, L.B. and Stewart, G.R. 11980) J. Biol. Chem. 255, 3647-3655. 5 Ruiz-Apazo, N. and NadaI-Ginard. B. (1987) J. Biol. ('hem. 262, 4755-4765. 6 MacLeod, A.R. and Gooding. C. (1988) Mol. (_:ell. Biol. 8. 433-440. 7 MacLeod, A.R., Houlker, C., Reinach. F.C., Smillie, L.B., Talbot. K., Modi, (;. and Walsh, F.S. (1985) Proc. Natl. Acad. Sci. USA 82. 7835-7839.
8 Leader, D.P., Gall, I., Campbell. P. and Frischauf. A.M. (1986) DNA 5, 235-238. 9 Maxam, A.M. and Gilbert, W. (1980) Methods Enzymol. 65, 499 560. 10 Sanger, 1:., Nicklen, S. and Coulson. A.R. ~1977) Prc~,'. Natl. Acad. Sci. USA 74, 5463- 5467. 11 Yanisch-Perron, C., Viera. J. and Messing, J. (1985) Gene 33, 103 119. 12 Blau, H.M., Chiu, C.-P. and Webster, (`'. (1983) ('ell 32, 1171 1180. 13 Yaffe, D. and Saxel, O. (1977) Nature 270, 725-727. 14 Lehrach, I1., Diamond, 1)., Wozney, J.M. and Boedtker, H. (1977) Biochemistry 16, 4743-4751. 15 Ilelfman, D.M., Cheley, S., Kuismanen, E., Finn, L.A. and Yamawaki-Kataoka, Y. (1986) Mol. (,'ell. Biol. 6, 3582- 3595. 16 Buckingham, M.I:,. (1985) Essays Biochem. 20. 77-109. 17 Wieczorek, D.F., Smith, C.WJ. and Nadal-Ginard, 13. (1988) Mol. ('ell. Biol. 8, 679-694.