The two suborders of chiropterans have the canonical heavy-chain immunoglobulin (Ig) gene repertoire of eutherian mammals

Developmental and Comparative Immunology 35 (2011) 273–284

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

The two suborders of chiropterans have the canonical heavy-chain immunoglobulin (Ig) gene repertoire of eutherian mammals John E. Butler a,∗ , Nancy Wertz a , Yaofeng Zhao b , Shuyi Zhang c , Yonghua Bao b , Sara Bratsch d , Thomas H. Kunz e , John O. Whitaker Jr. f , Tony Schountz g a

Department of Microbiology, University of Iowa, Iowa City, IA, United States State Key Laboratory of Agrobiotechnology, China Agricultural University, Beijing, China School of Life Sciences, East China Normal University, Shanghai, China d Department of Biology, University of Wisconsin-River Falls, United States e Center for Ecology and Conservation Biology, Department of Biology, Boston University, Boston, MA, United States f Department of Biology, Indiana State University, Terra Haute, IN, United States g School of Biological Sciences, University of Northern Colorado, Greeley, CO, United States b c

a r t i c l e

i n f o

Article history: Received 23 July 2010 Received in revised form 24 August 2010 Accepted 25 August 2010 Available online 9 September 2010 Keywords: Bat Immunoglobulin genes Phylogeny

a b s t r a c t Bats comprise 20% of all mammals, yet little is known about their immune system and virtually nothing about their immunoglobulin genes. We show that four different bat species transcribe genes encoding IgM, IgE, IgA and IgG subclasses, the latter which have diversified after speciation; the canonical pattern for eutherian mammals. IgD transcripts were only recovered from insectivorous bats and were comprised of CH1, CH3 and two hinge exons; the second hinge exon was fused to CH3. IgA in all species resembles human IgA2 with the putative cysteine forming the bridge to the light chain found at position 77. Sequence comparisons yielded no evidence for a diphyletic origin of the suborders. Bats show no close similarity to another mammalian order; the strongest association was with carnivores. Data reveal that CH diversity and VDJ and CDR3 organization are similar to other eutherian mammals, although the expressed VH3 family repertoire was unusually diverse. © 2010 Elsevier Ltd. All rights reserved.

1. Introduction Among living vertebrates, bats and birds are unique in their ability to fly, and this common feature sets them apart ecologically and physiologically from other groups. Bats are in some ways the nocturnal equivalent of birds, having evolved and radiated into a diversity of forms to fill many of the same niches. Bats have successfully colonized almost every continental region on earth (except Antarctica) as well as many oceanic islands and archipelagos (Kunz, 1982; Kunz and Lumsden, 2003). Bats impact the environment in several ways. Insectivorous species suppress insect populations (Cleveland et al., 2006; Kalka et al., 2008; Williams-Guillén et al., 2008; Jones et al., 2009), and plant-visiting bats serve as pollinators and disperse seeds (Fujita and Tuttle, 1991; Shilton et al., 1999; Muscarella and Fleming, 2007; Fleming et al., 2009). Insectivorous species like the common little brown bat (Myotis lucifugus) may consume their entire body mass each night in insects (Kurta et al.,

∗ Corresponding author at: Department of Microbiology, University of Iowa, 3550 BSB, 51 Newton Road, Iowa City, IA 52242, United States. Tel.: +1 319 335 7776; fax: +1 319 335 9006. E-mail address: [email protected] (J.E. Butler). 0145-305X/$ – see front matter © 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.dci.2010.08.011

1989). Thus, they are the most important predators of nocturnal insects and consume 5–10 times more insects than swallows and flycatchers. So-called “megabats” or “flying foxes” of the suborder Yinpteropodidae are important pollinators and seed dispersers, but sometimes can be pests when they damage fruit crops. Bats comprise the second largest order of mammals (next to rodents) in total number of species and may exceed all other groups in overall abundance (Kunz, 1982; Wimsatt, 1970). Of the >5400 recognized species of mammals, bats comprise 20% (Teeling et al., 2002; Simmons, 2005). Bats are believed to have evolved early and morphologically have changed very little over the past 52 million years (Hill and Smith, 1984; Simmons et al., 2008). Bats are divided into 18 families that comprise two major suborders: Yinpteropodidae and Yangochiroptera. The former suborder includes the family Pteropodidae which comprises the so-called “megabats” or “flying foxes” and the families Rhinolophidae, Hipposideridae, Megadermatidae, Rhinopomidae and Crasonycyeteridae while the Yangochiroptera includes all other families including the insectivorous “microbats” (Teeling et al., 2002). Except for the genus Rousettes, all of the families Pteropodidae are non-echolators compared to all other species of both suborders. The appearance of certain megabats (flying foxes) and neurological features of the eye and prestrinate cortex lead Pettigrew to propose that the order was

274

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

diphyletic, i.e. the Yinpteropodidae arose from a primate/lemurs stock while all other bat families evolved from the Insectivora (Pettigrew, 1986). This was an intriguing hypothesis because it implied that mammalian flight evolved twice. However, advances in molecular analyses, including what we report here, have largely laid to rest the diphyletic hypothesis for the Chiroptera (Murphy et al., 2007; Teeling et al., 2005; Adkins and Honeycutt, 1991; Mindell et al., 1991). Bats were originally considered members of the superorder Archonta which also included primates, tree shrews and flying lemurs (Gregory, 1910; Simpson, 1945). Recent analyses places bats closer to ungulates, whales, horses and carnivores (Teeling et al., 2002, 2005) [a clade referred to as Laurasiatheria]. All bat species can be vectors for human viral diseases (Messenger et al., 2003; Calisher et al., 2006; Wibbelt et al., 2009). There are >85 viruses known from bats (Calisher et al., 2006) and several are associated with animal and human epidemics (Wong et al., 2007). These include Hendra and Nipah viruses (horse, humans and swine; Mackenzie and Field, 2004) SARS (rodents, cattle swine, dogs, human; Dobson, 2005; Li et al., 2005; Mueller et al., 2007; Shi and Hu, 2008) Ebola (human and other primates; Swanepoel et al., 1996; Leroy et al., 2005) and West Nile viruses (horses and humans; Lau et al., 2005). Recently there is concern over their role in zoonotic diseases (Calisher et al., 2006; Wibbelt et al., 2009; Lau et al., 2005; Halpin et al., 2008). This includes white nose syndrome (WNS) which has caused unprecedented mortality in little brown bat populations in the Northeastern US (Blehert et al., 2009; Frick et al., 2010). However, little is known about the immune system of bats, especially their immunoglobulins (Igs) and the manner which they generate their antibody repertoire. The paucity of information on the bat immune system raised the question of whether their immune system might show any deviation from other mammals that would suggest an adaption for flight. Birds have an immune system disparate from mammals. They lack IgD and IgE and both chicken IgG (IgY) and IgA differ in domain structure from their mammalian counterparts (Ratcliffe, 1991). Furthermore, birds lack lymph nodes, have determinant B cell lymphopoiesis and use somatic gene conversion (SGC) to generate their antibody repertoire (Reynaud et al., 1989; McCormack et al., 1991). Since the work of Teeling et al. (2002, 2005) leaves little doubt that bats are indeed part of the mammalian lineage, it is unlikely that their immune system would resemble that of birds. However, there is considerable variation among mammals regarding their antibody repertoire (Butler, 2006), thus investigating the Ig genes of a mammalian order not previously studied, might uncover variations in the canonical mammalian Ig pattern that could be valuable in future functional studies involving the immune system.

In the present study, we demonstrate that the Igs of bats possess the canonical pattern characteristic of other eutherian mammals, including apparent diversification of IgG into subclasses after speciation. Given the sequences for both Yinpteropodidae and Yangochiroptera were available, including fruit-eating and insectivorous species, we found no evidence for a polyphyletic origin for bats. However, we did find immunological evidence for the divergence of the two suborders. Our analysis revealed a surprising and unexplained diversity among expressed VH3 genes of the little brown bat, M. lucifugus, which raises the question of whether bats might use SCG similar to that of birds, extensive somatic hypermutation (SHM) or combinatorial diversity to develop their specific antibody repertoire. The latter question has been addressed in a separate study that shows extensive germline diversity but a surprising lack of SHM (Bratsch et al., in press). 2. Materials and methods 2.1. Source of materials Spleen and other lymphoid tissues were removed from euthanized little brown bats (M. lucifugus) that had been collected at a maternity roost in eastern Massachusetts. The same tissues were also collected from the big brown bat (Eptiscus fuscus) from western Indiana. Both species are members of the family Vespertilionidae, suborder Yangochiroptera. The same tissues were collected from the Seba’s short-nosed fruit bat, Carollia perspicillata (family Phyllostomidae suborder Yangochiroptera) as by-products of viral research at Northern Colorado University. CDNA from the short-nosed fruit bat Cynopterus sphinx (family Pteropodidae), was prepared at the East China Normal University and at the China Agricultural University. Apart from the latter, all samples were collected and frozen in liquid nitrogen and shipped on dry ice to the University of Iowa. 2.2. Preparation of RNA and cDNA RNA was extracted from pulverized frozen tissue or from TriZolstored material following the manufacturer’s protocol (Invitrogen, Carlsbad, CA) and as previously described (Sun et al., 1998). RNA concentration was determined spectrophotometrically using a NanoDrop 1000. CDNA was prepared using Superscript II as previous described (Butler et al., 2006). 2.3. Recovery of bat Ig transcripts by PCR Transcripts encoding bat IgM, IgD, IgG, IgA and IgE were recovered by PCR using degenerate primer sets. Table 1 indicates the

Table 1 Primers used for recovery of bat heavy-chain Ig transcripts. Forwarda

Isotype

Product lengthb

Reverse

IgM

PCR1 PCR2

VH FR 1 5 VH FR 1 3

agctggtggagtctggagga actctcctgtgcagcctctg

IgG

PCR1 PCR2

VH FR 1 5 VH FR 1 3

agctggtggagtctggagga actctcctgtgcagcctctg

IgG3 UTR

tttatttcatgctggdcccggg

IgD

PCR1 PCR2

VH FR 1 5 VH FR 1 3

agctggtggagtctggagga actctcctgtgcagcctctg

IgD CH3

tgcctgacctcgcatgtgtag

PCR1 PCR2



VH FR 1 5 VH FR 1 3

agctggtggagtctggagga actctcctgtgcagcctctg

IgA CH3

tgacgtgggtgggtttacccg

PCR1 PCR2



agctggtggagtctggagga actctcctgtgcagcctctg

IgE CH3

IgA IgE a b c

VH FR 1 5 VH FR 1 3 

gtggactttcctctcggt

IgM CH4 

c

aaagaagttctggatcaggcaggtg 

FR1 = framework 1 of VH3 genes. FR1 3 is a nested primer that targets a sequence downstream from FR1 5 . Products of expected length were obtained, cloned and sequenced. All genes encoding C␥ genes share a common UTR sequence.

1500 1400 1450 1300 1500

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

primers used and the domain sequences targeted by the primers employed in first (PCR1) and second (PCR2) round PCR amplification and the expected length of the final PCR products. Since the VH3 family is considered most ancestral (Schroeder et al., 1990) we used the FR1-5 primer based on the VH3 genes of swine and other species that have VH3 genes in their genome (Butler, 2006; Butler et al., 2006). A hemi-nested PCR system was used in which

275

the second round used the internal forward FR1-3 primer (Table 1), but the same reverse primers that annealed to sequences encoding the CH3, CH4 or UTR regions of the various isotypes. PCR product length was evaluated on agarose gels and those of expected length were excised from the gels and cloned into pCR2TOPO according to the manufacturer’s protocol (Invitrogen, Carlsbad, CA). The ligation mixture was plated on L–B plates. Blue/white selection was used

Fig. 1. The deduced amino acid sequences of the heavy chains of IgM, IgD, IgE and IgA from four bats fit the canonical pattern for the corresponding human Ig isotypes. Amino acid positions of interest that are referred to in the text, are in boldface and are numbered according to the IMGT system (Lefranc and LeFranc, 2001). Cysteines involved in the intradomain S–S loop are in bold with arrows indicating the loop. The cysteines involved in the covalent bond to the light chain, are also in bold and indicated as L–H. Potential N-linked glycosylation sites are in boldface. Position in each domain start with 1 as is done in the IMGT system. The functional hinge of IgA is part of the 5 portion of the CH 2 domain. Dots indicate that the residue is the same as for the reference human sequence. Human IgA2 was used for comparison since the extended hinge of human IgA1 is unique among mammals. Gaps are inserted into the alignment to obtain the best possible alignment with the human sequence that was used as a reference. Bat sequences have been deposited in GenBank and the accession numbers and those for the human sequences that were used for comparison are as follows: M. lucifugus = IgA, HM134924; IgD, HM134925, HM134926; IgE, HM134927; IgM, HM134936, HM134937; E. fuscus = IgA, HM134938; IgD, HM134939, HM134940; IgE, HM134941; IgM, HM134943; C. perspicillata = IgA, HM134944; IgE, HM134945; IgM, HM134948; C. sphinx = IgA, HM134948, HM134949; IgE, HM134950; IgM, HM134953.

276

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

Fig. 1. (Continued ).

to recover colonies that were subsequently prepared for sequence analysis. The samples were then processed using a Qiagen Quick lyses kit (Valencia, CA) and digested with EcoR1 for 2 h to release the inserted DNA after which the product was again analyzed on an agarose electrophoretic gel to confirm that products of the expected length were recovered. 2.4. Sequence analysis Clones processed as described above were sent to the core sequencing facility of the University of Iowa where they were analyzed using an Applied Biosystems Model 3730 (96 capillary) DNA sequencer. Our data are presented using the IMGT system in which the start codon for each domain is number 1 (Fig. 1). We have no evidence for variants at each position that are described for human variants on the IMGT website http://www.imgt.org. 2.5. Recovery of genomic IgD Sequences from expressed IgD from M. lucifugus were used to recover genomic IgD sequences (scafford 15451, 11.5 kb) by applying BLAST to the partially sequenced genome of M. lucifugus (http://www.ensembl.org/Myotis lucifugus/Info/Index). A new primer was made by aligning the sequences from the transcribed IgD from M. lucifugus with the sequence recovered from BLAST to identify heavily conserved areas of bat IgD. This new primer recovered IgD from E. fuscus spleen cDNA.

2.6. Analysis of VDJ transcripts VDJ sequences, generated as by-products of efforts to identify the various Ig heavy-chain genes, were analyzed with regard to the recovery of identical VH genes (Table 2) and for the characteristics of their CDR3 regions (Table 3). Sixty-six IgG VDJ transcripts and seven VDJ transcripts for IgM, IgD, IgE and IgA were recovered from the spleen of M. lucifugus. In addition, 51 VDJ transcripts were also recovered from E. fuscus, C. perspicillata and C. sphinx during the procedure to recover their genes transcribing IgM, IgD, IgG, IgA and IgE. These transcripts allowed for a partial characterization of transcribed VDJs. 2.7. IgG subclass analysis Putative IgG subclass/allotype sequences recovered from all four bat species were compared in PileUp. The translated sequences were then grouped and aligned based on the PileUp so that major difference within and among species could be identified. Because major differences were identified in the hinge region, intraspecific comparisons of hinge sequences for different bat IgGs and for human, mouse, cattle and swine IgG subclasses were compared. 2.8. Phylogenetic comparisons of immunoglobulin heavy-chain constant regions genes Phylogenetic trees were constructed with PHYLIP 3.67 software combined with the TreeView package (Felsenstein, 1989; Page,

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

277

Table 2 Recovery of identical FR4 sequences was common while recovery of identical transcribed VH genes was not. VH Total

M. lucifugus

E. fuscus

73

20

CDR1 Identical

0

0

Identical

CDR2 Sequence

Total

JH-FR4 Sequence

Total

Sequence

6 5

SYWMH SSWMNa

4 3

AISDNGVKT AINPNGGKI

29 20

WGQGTMVTVSS WGQGTLVTVSSb

4 3 3 2 2 2 2 2 2 40

SYSMD DSWMN TSWMN DYHMN NSWMN SYGMS SYPMN SYWMD SYWMS Unique

2 2 2 2 2 2 54

ADSGGST LINVDGSTT AISTNGGNT RINWNGGYI YINSGSSYI YISSGSSYI Unique

7 5 12

WGPGTLVTVSS WGPGTLVTVSQ Unique

2 18

SHYMS Unique

20

Unique

11 3 2

WGQGTMVTVSS WGQGTQVTVSSc WGQGTLVTVSSb

4 12

WGQGTLVTVSSb

14

Unique

14

Unique

2 2

WGQGTQVTVSSc Unique

2

SSWMNa

15

Unique

13

13

Unique

2 C. perspicillata

16

0

C. sphinx

15

0

a b c

NYWMN

2

INTGGDSTY

Unique

2

WGQGTLVTVSSb Unique

Same CDR1 (underlined) found in two different species. The same JH was found in all four species of bats (also underlined). JH found in two of the bat species examined.

1996). Multiple sequence alignments for tree construction were generated using CLUSTAL. Prodist and Neighbor programs in the PHYLIP package were also used for tree construction. A consensus tree was taken from 1000 bootstrapped phylogenetic trees. 3. Results 3.1. Bats possess the canonical isotype repertoire of eutherian mammals Fig. 1 provides an alignment of the deduced amino acid sequences of IgM, IgD, IgE and IgA from four bat species with that of the corresponding isotypes from human. Given that IgG isotypes

from bats appear to have diverged prior to the appearance of the major mammalian orders (Fig. 2), their sequences are separately compared (see below). The major motifs for the five human isotypes (and other eutherian mammals; data not shown) are present in all four bat species investigated in the present study. For those shown in Fig. 1, the intrachain disulfide loop in each domain is also present in the corresponding domains of bat Igs and the sequences adjacent to the cysteines involved in these bridges are generally conserved. With some exceptions, the major potential N-glycosylation sites are conserved for each isotype in bats. In the case of IgM and IgA, these are identical. This also appears to be the situation for IgD although the CH2 domain of bat IgD is absent (Figs. 1 and 5). IgE is most divergent by this criterion since the N-glycosylation site in CH1 (position

Table 3 CDR3 sequences motifs and CDR3 lengths in VDJ recovered with various heavy-chain transcripts. Species

Isotype

Sequence of CDR3

Frequency

CDR3 length (range)

Mean CDR3 length

M. lucifugus

IgM IgA IgE IgD IgG

Ra DRLGSFDV Wa R YGAGADLAY W R DRSTTVTDMEY W R HGSYGDFDV W R DWGHGRFDV W

4 5 3 2 66

8–10 6–12 6–12 9–10 4–12

8.5 9.2 10 9.5 8.6

E. fuscus

IgM IgA IgE IgD IgG

R R R R R

3 5 3 4 9

13 6–11 7–8 11–13 4–13

10 8.8 7.7 11.5 9.4

C. sphinx

IgM IgA IgE IgDb IgG

R EYQGFIGY W R GGGAYNGMDY W R DLTDLGY W

1 4 1

8 6–14 7

8 9.5 7

10

C. perspicellata

IgM IgA IgE IgDb IgG

a b

VYCASGICYGFDY W DGWGTYYLDY W DVRGIYDY W PPPLVAGGFDY W EGDAAGGFDY W

R EGTTNTSPFGY W

8–12

9.9

R DLNWDGY W R GMGRYDFYY W R GVVGGRYFDN W

5 4 2

7–9 4–14 10–12

8 8.8 11

R SRYYSYIYSY W

7

4–12

9.6

The boundaries of CDR3 between the terminal arganine (R) of the FR3 of VH3 family genes and the invariant tryptophan of FR4 (W) are indicated. IgD has not been recovered from the cDNA of C. sphinx and C. perspicillata.

278

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

Fig. 2. Genes encoding the heavy-chain genes of IgM, IgD, IgE and IgA of bats comprise a separate group with highest similarity with carnivores. The phylogenetic tree was constructed by using amino acid sequences of the first and last CH domains (platypus ␦ CH7 was used as the last domain for comparison) of these heavy-chain isotype. The heavy-chain constant regions are indicated with the appropriate Greek letters. M = M. lucifugus, E = E. fuscus, Ca = C. perspicillata; Cy = C. sphinz. For the convenience of readers, the regions dealing with these four isotypes are indicated in boxes. The values supporting each node are derived from 1000 bootstrapped phylogenetic trees. The accession numbers for the sequences used are for C␣: cattle, AF109167; dog, L36871; dolphin, AY621035; echidna, AF416951; horse, AY247966; human, J00220; mouse, J00475; opossum, AF012110; panda, AY818387; swine, U12594; platypus, AY055778; rabbit, X51647; rat, AABR03049801; sheep, AF024645. C␦: cattle, AF515672; dog, DQ297185; horse, AY631942; human, BC021276; mouse, V00786 and V00788; panda, AY818394; swine AF411239; platypus, EU503149; rat, AAO19643; sheep, AF411238. C: cattle U63640; dog, L36872; echidna, AY099258; horse, AJ305046; human, J00222; mouse, X01857; opossum, AF035194; panda, AY818389; swine, U96100; platypus, AY055780; rat, K02901; sheep, M84356. C␮: cattle, U63637; camel, AB091831; cat, AB016712; dog, EF207721 and EF207724; dolphin, AAG40853; echidna, AF416952; horse, L49414; human, X14940; mouse, V00818; opossum, AF012109; panda, AY818392; swine, U50149; platypus, AY168639; rabbit, J00666; rat, AABR03049259; sheep, X59994. Accession numbers for bat species are the same as those given in Figs. 1 and 3.

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

279

Fig. 3. The IgG subclasses of bats diversified after speciation as in other eutherian mammals. The phylogenetic tree was constructed based on the amino acid sequences of the first CH domain of all IgG subclasses which is highly species-specific. The designation for bat species is the same as for Fig. 2, i.e. M, E, C␣ and C␺. These designations are shown in boldface. The accession numbers for the sequences compared are: cattle (X16701, M36946, U63638), camel (AJ421266, AJ131945), dog (AF354264, AF354265, AF354266, AF354267), horse (AJ302055, AJ302056, AJ312379, AJ302058, AJ312380, AJ312381), human (J00228, J00230, X03604, K01316), mouse (J00453, V00825, V00763, J00479, X00915), opossum (AF035195), swine (U03778, U03779, U03782, EU372658, EU372657, EU372655), possum (AF157619), rabbit (L29172), rat (AABR03048905, AABR03049560, AABR03048905, AABR03049912), sheep (X69797, X70983). GenBank numbers for bats C␥ sequences are: M. lucifugus (HM134929, HM134930, HM134931, HM134932, HM134933, HM134934, HM134935), E. fuscus (HM134942), C .perspicillata (HM134946), C. sphinx (HM134951, HM134952).

280

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

Fig. 4. The IgG subclasses of bats, like other eutherian mammals, differ most in their hinge regions and hinge motifs are not shared among species. The amino acid sequences of the hinge regions of IgG from different bat species and for subclasses of human, mice, cattle and swine are presented. Sequence motifs shared by the hinge regions of different subclasses within a species are underlined. The −1, −2, etc. associated with subclasses in cattle and humans indicate the use of alternative hinge exons. Superscripts for swine C␥ genes denote allotypic variants. The accession numbers for the cg hinge sequences are the same as those listed in the legend of Fig. 3.

21) is not present in any bat species we examined. Moreover, the potential N-glycosylation motif in the CH2 (position 43) is missing in all bats and only one of the three potential N-glycosylation sites in the CH3 domain of human IgE (position 65) is found in bat IgE. Because of this observation we examined the IgE sequences of several other mammalian IgEs including the duckbill platypus and the Virginia opossum. We found that the N-glycosylation motif at position 21 in CH1 was common to human, mouse, cattle and swine but was missing in all bats, in the opossum and the platypus. Cattle have an additional site at position 22. Of particular interest is the absence of a cysteine in the CH1 domain of bat IgA that is part of the covalent S–S bond to the light chains in human IgA1. Thus we used human IgA2 as our reference because it also lacks this cysteine. Furthermore human IgA2 lacks the unique 13 amino acid hinge of human IgA1 that is not found in any other mammal. This means that bat IgA resembles human IgA2 and that of cattle and swine with a cysteine at position 77 in CH 1 that is part of the putative L–H bridge, whereas IgA from the Virginia opossum and the duckbill platypus apparently use the cysteine at position 14 in CH1 to form the L–H bridge like in human IgA1. 3.2. IGHC gene sequences of bats form a separate group most similar to carnivores Phylogenetic analysis of IgM, IgD, IgE and IgA gene sequences from bats indicates that especially IgM and IgD share their greatest similarity to that of carnivores (Fig. 2). While IgE from bats also shares sequence homology with carnivores, it is also related to IgE from the horse, swine and the human; rodents and ruminant artiodactyls are more distantly related. A somewhat similar pattern of sequence similarity was found for bat IgA. Noteworthy is that the sequence similarity of IgE, IgM and IgA, which corresponds to the accepted taxonomic relationship for the bats included in this study (Fig. 2). Given that IgM and IgD are the two most primordial Ig isotypes among vertebrates (Ohta and Flajnik, 2006) the comparison

of the C␮ and C␦ from bats to those in other mammals should be most reliable. Using this criterion, a common ancestry of bats with carnivores is suggested. 3.3. Subclass diversification occurred after speciation The branch points for the various IgG subclasses appear to have occurred after species diversification (Fig. 3). Our data also show that the IgG from the Neotropical, Seba’s short-tailed fruit bat, C. perspicillata and those from the Paleotropical, short-tailed fruit bat C. sphinx form separate branches from the one leading to the insectivorous members of the Yangochiroptera, M. lucifugus and E. fuscus, of the family Vespertilionidae. On the basis of transcripts recovered, IgG in M. lucifugus has diversified to the greatest extent; seven different transcripts were recovered, whereas the transcript of only a single IgG was recovered from C. perspicillata. While some variants may be alleles, this cannot explain all the variants in M. lucifugus or C. sphinx because all sequences were recovered from tissues of the same individuals. 3.4. IgG subclass genes in bats differ in the hinge region and differences appear order-specific Alignment of the various C␥ transcripts recovered from different bat species revealed that the putative bat IgG subclass genes show their greatest difference in their hinge region. This follows the pattern observed in other species (Butler et al., 2009). Thus, we focused our comparison on variations in the hinge of the various C␥ genes from the four species of bats available for the present study. Since the nomenclature of subclasses in all species is based on order of discovery, same-name homology is not implied. This should also be apparent from Fig. 3, which shows that bat IgG subclasses diversified after speciation, as observed for other mammalian orders (Butler, 2006) making sequence comparisons of subclasses between different species of little phylogenetic relevance. Therefore, sequence similarities between the four bat

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

281

in the duckbill platypus, the African clawed frog (Xenopus sp.) and the catfish (Ohta and Flajnik, 2006; Zhao et al., 2006, 2009). 3.6. The transcribed VH3 repertoire is diverse

Fig. 5. The domain structure of IgD of bats is rodent-like but unique because of the fusion of the second hinge exon with the CH3 domain. The TM exons were missing in the retrieved genomic sequence. IgD was only recovered from two bat species and only the genomic domain structure of M. lucifugus is indicated.

species in the present study are postulated to reflect either convergent or parallel evolution. The hinge sequences of IgG from different mammalian taxa, including bats, illustrate several features of evolutionary and functional importance. First, nearly all hinges are characterized by the presence of a combination of prolines (often paired) in association with cysteines. Second, the actual motif for this feature appears to be species- (or order-) specific; these are illustrated by the underlined motifs in Fig. 4. In some cases different IgG subclasses share nearly the same hinge. This is demonstrated in swine (Butler et al., 2009; Fig. 4) but has been observed in M. lucifugus, C. perspicillata and C. sphinx. The exception is in cattle. Alternative and duplicated hinges also occur. This is best illustrated by IgG3 in humans and cattle; this is also a common feature of the domain structure of IgD in some species. Since the genomic structure of the bat C␥ genes has not yet been determined, this may also be true for some bat IgG subclasses. 3.5. The domain structure of bat IgD is unique but is otherwise most similar to rodents A partial genomic ␦ sequence (scafford 15451, 11.5 kb) of M. lucifugus was retrieved from its genome database using a BLAST-based approach. Although the typical transmembrane (TM) encoding exons are missing in the retrieved sequence, two constant region (C) domain encoding exons, could be identified with one corresponding to CH1, and the other to the CH3 of other known placental mammalian IgD heavy chains. The genomic structure of IgD from a variety of vertebrates was compared with the partial genomic structure of IgD from M. lucifugus (Fig. 5). These data show that the domain structure of IgD from M. lucifugus is most similar to that of rodents in having only one hinge exon and in lacking a CH2 domain; H2 and CH3 are fused exons in M. lucifugus. Despite this rodent-like feature, sequence similarities place bat IgD closer to that of carnivores than rodents (Fig. 2). In no eutherian mammals is there evidence for the multi-domain structure of IgD seen

The primers used to recover the various C-region genes in bats involved the use of forward primers for the ancestral VH3 variable gene family. Thus, the 140 transcripts recovered all contain VDJs encoded by VH3 genes. Because VH3 family genes in all species differ primarily in CDR1 and CDR2, our analysis focused on these gene segments. Sixty-one percent of the transcripts had CDR1 sequences that were only recovered once, 13% had CDR1s that were recovered twice and 4% had CDR1s that were recovered six times (Table 2). Being a longer sequence, a higher proportion of CDR2 sequences were unique (75%). By contrast only 14% of JH-FR4 region sequences were unique suggesting that there are a limited number of JH genes in the genome but many different VH3 genes. Of the 73 VDJ sequences recovered form M. lucifugus, none contained identical VH genes when both CDR1 and CDR2 were considered, although some of these VH genes share CDR regions with other VH genes. Sharing was most common among the shorter (15 nucleotides) CDR1 segments. In one case an identical CDR1 from M. lucifugus was also found twice in C. sphinx. By contrast, identical FR4 regions (JH encoded) were quite frequently recovered. The number and sequences of the various JH segments is unknown since the genome has not been mapped. In any case, the frequency of FR4 recovery suggests that there are fewer JH than VH genes and that M. lucifugus probably has at least five JH gene segments in its genome. The limited diversity of JH is also supported by the observation that all four bat species in the present study share one identical FR4. Since the species studied represent different families and suborders; (E. fuscus and M. lucifugus belong to the same Vespertilionidae, suborder Yangochiroptera, C. perspicillata to the family Phyllostomidae, suborder Yangochiroptera, and C. sphinx to the family Pteropodidae, suborder Yinpterochiroptera) this JH gene is evolutionarily conserved. All VDJ sequences were from transcripts so that the diversity among these VH3 genes may be the result of somatic hypermutation (SHM) of CDR1 and CDR2 regions. This issue has been recently addressed in a separate study (Bratsch et al., in press). 3.7. The CDR3 regions of VDJ transcripts resembles that of most mammals The CDR3 portion of transcribed VDJs mostly results from contributions by DH segments, differences in the 5 end of JH gene segments, nucleotide additions and SHM. Table 3 summarizes data from the most frequently encountered CDR3 regions transcribed with different isotypes of the four bat species. Our data indicate that the mean length of CDR3 was 9.1 ± 1.1 amino acids; the same length found in mice, humans and swine. We found no significant differences in CDR3 length among the isotype or the various species. Identification of putative DH segments in CDR3 was not possible because: (a) the same motif was never recovered twice among the 140 transcripts and (b) there is currently no information available on the genomic DH repertoire of bats. 4. Discussion Biologists have long recognized the importance that 20% of the world’s mammals play in the ecosystem. They suppress aerial insect populations, pollinate flowers and disperse seeds (Cleveland et al., 2006; Kalka et al., 2008; Williams-Guillén et al., 2008; Shilton et al., 1999; Fleming et al., 2009). Despite their ecological importance, interest in their immune system has been almost entirely limited to the Old World family Pteropodidae (suborder Yinpterochiroptera).

282

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

Chakraborty and Chakravarty (1984) studied the immune system of the Indian flying fox (Pteropus giganteus) using a hemolytic plaque assay and (Omatsu et al. (2003) purified IgG from the Egyptian flying fox (Rousettus aegyptiacus, family Pteropodidae) and used it in serological comparison with other mammals. In studies on histoplasmosis, McMurry et al. (1982) purified serum Igs from the New World fruit bat, Artibeus lituratus and monitored changes during infection. However, to our knowledge, no attention has been given to the Igs of insectivorous bats in the suborder Yangochiroptera, and no effort has been made to clone and characterize the heavy-chain constant region Ig genes of any bat species. The studies herein were undertaken for three reasons. First, by addressing the growing concern for emerging diseases carried by bats, we reasoned that an understanding of their immune system might provide valuable insight that could indirectly aid in mitigating these diseases. Bats carry >85 viruses and are vectors for a variety of human pandemic disease like SARS, Hendra and Ebola (Calisher et al., 2006). WNS, a fungal disease of hibernating bats in the eastern US (Blehert et al., 2009; Gargas et al., 2009), has caused one of the most precipitous declines ever reported for North American wildlife, that is threatening regional extinction (Frick et al., 2010). Second, we wished to determine whether bats might show differences in their Ig repertoire or its formation from that seen in other mammals. Finally, we reasoned that by comparing the Ig genes of different bats species with those of other mammals, we could improve our understanding of mammalian phylogeny in general and chiropteran phylogeny in particular. Various hypotheses have been proposed linking bats with various taxa including primates, rodents, insectivores, carnivores and ungulates (Teeling et al., 2002, 2005). A relatively recent hypothesis even proposed that the two suborders (i.e. so-called mega- and microbats), evolved from two separate lineages (Pettigrew, 1986) Our findings are unambiguous in showing that Ig genes of bats fit the canonical pattern of eutherian mammals, neither birds nor proto- or protherian mammals. All four bat species examined in the present study transcribed genes for IgM, IgG, IgA and IgE and both insectivorous species of the suborder Yangochiroptera transcribed IgD (Figs. 1 and 2) with a domain structure characteristic of eutherian (e.g. placental) mammals but not of Protheria (e.g. monotremes) or lower vertebrates (e.g. amphibians and fish; Fig. 5). We were unable to recover a transcript for IgD from either C. perspicillata or C. sphinx. IgD in mammals shows the least interspecific homology among all Ig isotypes and has therefore been elusive to recover (Butler, 2006; Butler et al., 1996). It is likely that when genomic projects for bats other than M. lucifugus appear, IgD may also be found in the genome of other bat species, with an altered sequence and possibly as pseudogenes. Since IgD has been lost during evolution in some cases such as in birds, marsupials and even the eutherian rabbit (Mage et al., 2006), its loss in one suborder of bats may not be surprising. The differences among mammals in the existence of the cysteine at position 15–18 (Fig. 1) in the CH1 domain that forms a bridge to the light chain in human IgA, suggests that either bats, human IgA2, cattle and swine: (a) have light chains that are noncovalently bonded to the C␣ chain or (b) the cysteine at position 77 (Fig. 1) is used in the L–H bridge. Because there is no biochemical evidence of non-covalent L chains in swine and cattle, the latter hypothesis is most likely. Our results suggest that in the diversification of mammalian IgA, the pathways diverged in C␣1 resulting in the human being the only mammal outside of the exceptional rabbit family, which has more than one subclass and retains both motifs for covalent linkage to light chains. Motifs for N-glycosylation are less likely to be conserved than cysteine resides but may nevertheless distinguish evolutionary pathways. In this respect, the pattern of N-glycosylation sites in all bats studied to date resembles that of the Virginia opossum

and duckbill platypus, but not other mammals for which data are available. The diversification of IgG into subclasses is primarily a feature of eutherian mammals; the Virginia opossum has only a single IgG and the duckbill platypus has two very similar IgGs (Zhao et al., 2009; Wang et al., 2009). The IgG-like Igs in other vertebrates have only distant sequence similarities to those in eutherian mammals (Fig. 3). The IgG-like IgY of the chicken and lizard also shows no subclass diversification (Wei et al., 2009), although in the African clawed frog (Xenopus sp.) a short Ig molecule, IgF, appears to have been derived from IgY and further diversified in genus Xenopus (Zhao et al., 2006). IgG has been regarded as the “flagship Ig” of mammals and is not found in other vertebrates (Butler et al., 2009). Thus, its presence in bats and in diversified form (subclasses) further supports the conclusion that bats possess the canonical isotype repertoire of other eutherian mammals. Also consistent with the pattern seen in eutherian mammals is that post-speciation diversification of IgG into subclasses mostly affects the sequence of the hinge exon (Butler et al., 2009). We observed the same to be true in the Chiroptera. The hinge sequences of the IgG variants from bats, together with that of other eutherian mammals, are shown in Fig. 4. These data show that specific hinge sequence motifs are often shared among the hinges of different IgGs in one species but not shared between species. Seven variants were recovered from a single specimen of M. lucifugus, so that assuming this individual was heterozygous, there must be 3–4 subclass eugenes while the remainder could be alleles of these subclasses. At this time only a single IgG has been recovered from Seba’s shorttailed fruit bat (family Phyllostomidae, suborder Yangochiroptera; Fig. 3). IgGs with extended hinges such as human and swine IgG3 are best-suited for complement activation (Butler et al., 2009; Lefranc and LeFranc, 2001). In humans all but IgG2 are actively transported across the placenta (Lefranc and LeFranc, 2001) and IgG1 of cattle is selectively transported across the acinar epithelial cells of the mammary gland (Hammer et al., 1969; Brandon et al., 1971). Subclass IgGs also differ in their affinity for Fc␥R1, Fc␥RII and Fc␥RIII that are distributed among phagocytic cells and lymphocytes, resulting in a further division of labor among subclasses (Ravetch and Kinet, 1991). Differential subclass expression can depend on whether a pro- or anti-inflammatory cytokine microenvironment is present (Mossman and Coffman, 1989). Based on the known division of function among IgG subclasses in well-studied species, the expressed subclass diversity we report here for bats predicts a similar diversification of function for bat IgGs like that seen among human IgG subclasses and in other eutherian mammals. The organization of the heavy-chain variable region appears similar to that of other eutherian mammals. However, the low frequency of recovering a particular VH gene during a second attempt in >70 chances in M. lucifugus (Table 2) suggests an exceptionally diverse germline VH3 repertoire or a high rate of somatic hypermutation. The same applies to the recovery of putative DH segments (Table 3). A separate study indicates that diversity is germline encoded and not the result of extensive SHM (Bratsch et al., in press). As in laboratory mice, the rabbit family and humans, at least five different FR4 regions were recovered suggesting as many as five JH regions. Furthermore one of these is highly conserved since it was found in all bat species examined in this study and was recovered 20 and 13 times respectively, in species from two different suborders (Table 2). CDR3 length was in the same range as in humans, laboratory mice and swine with no evidence for the unusually long CDR3 regions that are seen in cattle (Berens et al., 1997) or camels (Nguyen et al., 2000). Data summarized in Tables 2 and 3 therefore suggests a VH, DH and JH repertoire at least similar to humans and

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

laboratory mice. These results are in stark contrast to swine (Sun et al., 1998; Butler et al., 2006). Regarding the issue of phylogenetic origins, our data offer no evidence to support the diphyletic origin of bats (Pettigrew, 1986) and thus are consistent with the conclusions reached by others (Mindell et al., 1991; Nikaida et al., 2000; Teeling et al., 2005). Regarding their relationship to other mammalian orders, the sequence similarity of the genes encoding IgM and IgD may be most valuable because these are regarded as phylogenetically the two oldest Ig genes. Using this criterion, bats are closely related to carnivores (Fig. 2). While sequence similarity of carnivores and bat IgD is strong, the domain structure is more rodent-like due to the lack of a CH2 domain (Fig. 5). Analogous with IgA, the hinge exon of bat IgD is fused to the CH3 domain. In the case of IgD, this has not been reported in other mammals. When genes for IgA and IgE are considered, a relationship with carnivores is still present but there is also a relationship with hoofed mammals (e.g. ungulates), humans and the dolphin (Fig. 2). Our data linking Chiroptera, Carnivora and Perissodactyla (horses) with the Laurasiatheria is consistent with studies using retroposon insertion (Nishihara et al., 2006) and noncoding intron sequences (Matthee et al., 2007). The relationship to the Perissodactyla was also reported by Murphy et al. (2007). Thus, from our analysis there is no evidence to support the hypothesis that bats evolved from flying primates or rodents. Since IgG diversified following the appearance of bats (Fig. 3) sequence similarity among eutherian mammals provides no insight into phylogeny but suggest that IgG diversification is convergent. Results from our study unambiguously support the hypothesis that the Ig genes of both the Yinpteropodidae and the Yangochiroptera have the same canonical pattern of organization as in other eutherian mammals, and thus are not in support of a diphyletic origin for the Chiroptera. Their surprisingly diverse variable heavy-chain diversity appears to be germline encoded (Bratsch et al., in press). All other factors predict that the humoral immune system of bats will function in much the same manner as in well-studied species such as laboratory rodents. This means that the humoral immune responses of bats to their pathogens, the viruses they transmit and vaccines that may be developed, are likely to follow the same pattern as in well-studied, non-volant eutherian mammals. Acknowledgement Research supported in part by NIH Contract AI25489. References Adkins, R.M., Honeycutt, R.L., 1991. Molecular phylogeny of the superorder Archonta. Proc. Natl. Acad. Sci. 88, 10317–10321. Berens, S.J., Wylie, D.E., Lopez, O.J., 1997. Use of a single VH family and long CDR3s in the variable region of cattle Ig heavy chains. Int. Immunol. 9, 189–199. Blehert, D.S., Hicks, A.C., Behr, M., Meteyer, C.U., Berlowski-Zier, B.M., Buckles, E.L., Coleman, J.T.H., Darling, S.R., Gargas, A., Niver, R., Okoniewski, J.C., Rudd, R.J., Stone, W.B., 2009. Bat white-nose syndrome: an emerging fungal pathogen? Science 323, 227. Brandon, M.R., Watson, D.L., Lascelle, A.K., 1971. The mechanism of transfer of immunoglobulins into mammary secretions of cows. Aust. J. Exp. Biol. Med. Sci. 49, 613–623. Bratsch, S., Wertz, N., Chaloner, K., Kunz, T.H., Butler, J.E., in press. The little brown bat displays a highly diverse VH, DH and JH repertoire but little evidence of somatic hypermutation. Dev. Comp. Immunol., doi:10.1016/j.dci.2010.06.004. Butler, J.E., Sun, J., Navarro, P., 1996. The swine immunoglobulin heavy chain locus has a single JH and no identifiable IgD. Int. Immunol. 8, 1897–1904. Butler, J.E., Weber, P., Wertz, N., 2006. Antibody repertoire development in fetal and neonatal pigs. XIII. “Hybrid VH genes” and the pre-immune repertoire revisited. J. Immunol. 177, 5459–5470. Butler, J.E., Wertz, N., Deschacht, N., Kacskovics, I., 2009. Porcine IgG: structure, genetics and evolution. Immunogenetics 61, 209–230. Butler, J.E., 2006. Preface: why I agreed to do this. In: Butler, J.E. (Guest Ed.), Antibody Repertoire Development. Developmental and Comparative Immunology, vol. 30, special ed., pp. 1–17.

283

Calisher, C.H., Childs, J.E., Field, H.E., Homes, K.V., Schountz, T., 2006. Bats: important reservoir host of emerging viruses. Clin. Microbiol. Rev. 19, 531–545. Chakraborty, A.K., Chakravarty, A.K., 1984. Antibody-mediated response in the bat, Pteropus giganteus. Dev. Comp. Immunol. 8, 415–423. Cleveland, C.J., Frank, J.D., Federico, P., Gomez, I., Hallam, T.G., Horn, J., Lopez, J., McCracken, G.F., Medellin, R.A., Moreno-Valdez, A., Sansone, C., Westbrook, J.K., Kunz, T.H., 2006. Economic value of the pest control service provided by Brazilian free-tailed bat in south-central Texas. Front. Ecol. Environ. 4, 238–243. Dobson, A.P., 2005. What links bats to emerging infectious diseases? Science 310, 628–629. Felsenstein, J., 1989. PHYLIP—phylogeny inference package (Version 3.2). Cladistics 5, 164–166. Fleming, T.H., Geiselman, C., Kress, W.J., 2009. The evolution of bat pollination: a phylogenetic perspective. Ann. Bot. 104, 1017–1043. Frick, W.F., Pollock, J.F., Hicks, A., Langwig, K., Reynolds, D.S., Turner, G., Butchowski, C., Kunz, T.H., 2010. An emerging disease causes regional population collapse of a common North American bat species. Science 328, 679–682. Fujita, M.S., Tuttle, M.D., 1991. Flying foxes (Chiroptera: Pteropodidae): threatened animals of key ecological and economic importance. Conserv. Biol. 5, 455–463. Gargas, A., Trest, M.T., Christensen, M., Volk, T.J., Blehert, D.S., 2009. Geomyces destructans sp. associated with bat white-nose syndrome. Mycotaxon 108, 147–154. Gregory, W.K., 1910. The orders of mammals. Bull. Am. Museum Nat. Hist. 27, 1–524. Halpin, K., Hyatt, A.D., Plowright, R.K., Epstein, J.H., Daszak, P., Field, H., Wang, L., Daniels, P.W., 2008. Henipavirus Ecology Research Group 2007 Emerging viruses: coming in on a wrinkled wing and a prayer. Clin. Infect. Dis., 44711–44717. Hammer, D.K., Kickhoefen, B., Henning, G., 1969. Molecular classes and properties of antibodies in cattle serum and colostrum synthesized during the primary and secondary response to protein antigens. J. Biochem. 6, 443–454. Hill, J.E., Smith, J.D., 1984. Bats: A Natural History. Univ. Texas Press, Austin. Jones, G., Jacobs, D.S., Kunz, T.H., Willig, M.R., Racey, P.A., 2009. Carpe noctem: the importance of bats as bioindicators. Endangered Species Res. 8, 93–115. Kalka, M.B., Smith, A.R., Kalko, E.K.V., 2008. Bats limit arthropods and herbivors in a tropical forest. Science 320, 71. Kunz, T.H. (Ed.), 1982. Ecology of Bats. Plenum Press, New York. Kunz, T.H., Lumsden, L.F., 2003. Ecology of cavity and foliage roosting bats. In: Kunz, T.H., Fenton, M.B. (Eds.), Bat Ecology. Univ. Chicago Press, pp. 3–89. Kurta, A., Bell, G.P., Nagy, K.A., Kunz, T.H., 1989. Energetics of pregnancy and lactation in free-ranging little brown bats (Myotis lucifugus). Physiol. Zool. 62, 804–818. Lau, S.K.P., Woo, P.C., Li, K.C., Huang, Y., Tsoi, H.W., Wong, B.H., Wong, S.S., Leung, S.Y., Chan, K.H., Yuen, K.Y., 2005. Severe acute respiratory syndrome coronavirus-like virus in Chinese horseshoe bats. Proc. Natl. Acad. Sci. U.S.A. 102, 14040–14045. Lefranc, M.-P., LeFranc, G., 2001. The Immunoglobulin Facts Book. Academic Press, NY, pp. 457. Leroy, E.M., Kumulungui, B., Pourrut, X., Rouquet, P., Hassmanin, A., Yaba, P., Delicat, A., Paweska, J.T., Gonzales, J.P., Swanepoel, P., 2005. Fruit bats as reservoirs of Ebola virus. Nature 438, 575–576. Li, W., Shi, Z., Yu, M., Ren, W., Smith, C., Epstein, J.H., Wang, H., Eaton, G.B.T., Zhang, S., Wang, L.F., 2005. Bats are natural reservoirs of SARS-like coronaviruses. Science 310, 676–679. Mackenzie, J.S., Field, H., 2004. Emerging encephalitogenic viruses: lyssaviruses and henipaviruses transmitted by frugivorous bats. Arch. Virol. Suppl. 18, 97–111. Mage, R.G., Lanning, D.D., Knight, K.L., 2006. B cell and antibody repertoire development in rabbits: the requirement of gut-associated lymphoid tissues. Dev. Comp. Immunol. 30, 137–153. Matthee, C.A., Eick, G., Willows-Munro, S., Montgelard, C., Pardini, A.T., Robinson, T.J., 2007. Indel evolution of mammalian introns and the utility of non-coding nuclear markers in eutherian phylogenetics. Mol. Phylogenet. Evol. 42, 827–837. McCormack, W.T., Tjoelker, L.W., Thompson, C.B., 1991. Avian B cell developmental generation of an immunoglobulin repertoire by gene conversion. Annu. Rev. Immunol. 9, 219–241. McMurry, D.N., Stroud, J., Murphy, J.J.R., Carlomagno, M.A., Greer, D.L., 1982. Role of immunoglobulin classes in experimental histoplasmosis in bats. Dev. Comp. Immunol. 6, 557–567. Messenger, S.L., Rupprecht, C.E., Smith, J.S., 2003. Bats, emerging virus infections, and the rabies paradigm. In: Kunz, T.H., Fenton, M.B. (Eds.), Bat Ecology. Univ. Chicago Press, Chicago, pp. 622–679. Mindell, D.P., Dick, C.W., Baker, R.J., 1991. Phylogenetic relationships among megabats, microbats and primates. Proc. Natl. Acad. Sci. U.S.A. 88, 10322–10326. Mossman, T.R., Coffman, R.L., 1989. THI and TH2 cells: different patterns of lymphokines secretion lead to different functional properties. Annu. Rev. Immunol. 7, 145–173. Mueller, M.A., Paweska, J.T., Leman, P.A., Drosten, C., Grywna, K., Kemp, A., Raach, L., Sonnenberg, K., Niedrig, M., Swanepoel, R., 2007. Coronavirus antibodies in African bat species. Emerg. Infect. Dis. 13, 1367–1370. Murphy, W.J., Pringle, T.H., Crider, T.A., Springer, M.S., Miller, W., 2007. Using genomic data to unravel the root of the placental mammal phylogeny. Genome Res. 174, 413–421. Muscarella, R., Fleming, T.H., 2007. The role of frugivorous bats in tropical forest succession. Biol. Rev. Camb. Philos. Soc. 82, 573–590. Nguyen, V.K., Hamers, R., Wyns, L., Muyldermanns, S., 2000. Camel heavy chain antibodies: diverse germline VHH and specific mechanisms enlarge the antigenbinding repertoire. EMBO J. 19, 921–931. Nikaida, M., Harada, M., Cao, Y., Hasegawa, M., Okada, N., 2000. Monophyletic origin of the order Chiroptera and its phylogenetic position among mammals, as

284

J.E. Butler et al. / Developmental and Comparative Immunology 35 (2011) 273–284

inferred from the composite sequences of the mitochondrial DNA of a Japanese megabat, the Ryukyu flying fox (Pteropus dasymailus). J. Mol. Evol. 51, 318–328. Nishihara, H., Hasegawa, M., Okada, N., 2006. Pegasoferae, an unexpected mammalian clade revealed by tracking ancient retroposan insertions. Proc. Natl. Acad. Sci. U.S.A. 103, 9929–9934. Ohta, Y., Flajnik, M., 2006. IgD like IgM is a primordial immunoglobulin class perpetuated in most jawed vertebrates. Proc. Natl. Acad. Sci. U.S.A. 103, 10723–19728. Omatsu, T., Ishii, Y., Kyuwa, S., Milanda, E.G., Terao, K., Yoshikawa, Y., 2003. Molecular evolution inferred from immunological cross-reactivity of immunoglobulin G among Chiroptera and closely-related species. Exp. Anim. 52, 425–428. Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Pettigrew, J.D., 1986. Flying primates? Megabats have advanced pathway from eye to midbrain. Science 231, 1304–1306. Ratcliffe, M.J.H., 2006. Antibodies, immunoglobulin genes and the bursa of Fabricius in chicken B cell development. Dev. Comp. Immunol. 30, 101–118. Ravetch, J.V., Kinet, J.P., 1991. Fc receptors. Annu. Rev. Immunol. 9, 457–492. Reynaud, C.-A., Dahan, A., Anquez, V., Weill, J.C., 1989. Somatic hyperconversion diversifies the single VH gene of the chicken with a high incidence in the D region. Cell 59, 171–183. Schroeder Jr., H.W., Hillson, J.L., Perlmutter, R.M., 1990. Structure and evolution of mammalian VH families. Int. Immunol. 2, 41–50. Shi, Z., Hu, Z., 2008. A review of studies on animal reservoirs of the SARS coronavirus. Virus Res. 133, 74–87. Shilton, L.A., Altringham, J.D., Compton, S.G., Whittaker, R.J., 1999. Old World fruit bats can be long-distance seed dispersers through extended retention of viable seeds in gut. Proc. R. Soc. Ser. B 266, 219–223. Simmons, N.B., 2005. Order Chiroptera. In: Wilson, D.E., Reeder, D.M. (Eds.), Mammal Species of the World: A Taxonomic and Geographic Reference, 2nd ed. Smithsonian Institution Press, Washington, DC, pp. 159–174. Simmons, N.B., Seymour, K.L., Habersetzer, J., Gunnell, G.F., 2008. Primitive Early Eocene bat from Wyoming and the evolution of flight and echolocation. Nature 451, 818–821. Simpson, G.G., 1945. The principles of classification and a classification of mammals. Bull. Am. Museum Nat. Hist. 85, 1–350.

Sun, J., Hayward, C., Shinde, R., Christenson, R., Ford, S.P., Butler, J.E., 1998. Antibody repertoire development in fetal and neonatal piglets. I. Four VH genes account for 80% of VH usage during 84 days of fetal life. J. Immunol. 161, 5070– 5078. Swanepoel, R., Leman, P.A., Bart, F.J., Zachariades, N.A., Braack, L.E., Ksiazek, T.G., Rollin, P.E., Zaki, S.R., Peters, C.J., 1996. Experimental inoculation of plants and animals with bola virus. Emerg. Infect. Dis. 2, 321–325. Teeling, E.C., Madsen, O., Van Den Busche, R.A., deJong, W.W., Stanhope, M.J., Springer, M.S., 2002. Microbat paraphyly and the convergent evolution of a key innovation in Old World rhinolophoid microbats. Proc. Natl. Acad. Sci. U.S.A. 99, 1431–1436. Teeling, E.C., Springer, M.S., Madsen, O., Bates, P., O’Brien, J.J., Murphy, W.J., 2005. A molecular phylogeny for bats illuminates biogeography and the fossil record. Science 307, 580–584. Wang, X., Olp, J.J., Miller, R.D., 2009. On the genomics of immunoglobulins in the gray, short-tailed opossum Monodelphis domestica. Immunogenetics 61, 581–596. Wei, Z., Wu, Q., Ren, L., Hu, X., Guo, Y., Warr, G.W., Hammarstrom, L., Li, N., Zhao, Y., 2009. Expression of IgM, IgD and IgY in a reptile, Anolis carolinensis. J Immunol 183, 3858–3864. Wibbelt, G., Speck, S., Field, H., 2009. Methods for assessing diseases in bats. In: Kunz, T.H., Parsons, S. (Eds.), Ecological and Behavioral Methods for the Study of Bats. Johns Hopkins University Press, Baltimore, pp. 775–793. Williams-Guillén, K., Perfecto, I., Vandermeer, J., 2008. Bats limit insects in a Neotropical agroforestry ecosystem. Science 320, 703. Wimsatt, W.A., 1970. Biology of Bats, vol. 1. Academic Press, NY. Wong, S., Lau, S., Woo, P., Yuen, K.Y., 2007. Bats as a continuing source of emerging infections in humans. Res. Med. Virol. 17, 67–91. Zhao, Y., Ciu, H., Whittington, C.M., Wei, Z., Zhang, X., Zhang, Z., Yu, L., Ren, L., Hu, X., Zhang, Y., Hellman, L., Belov, K., Li, N., Hammarstrom, L., 2009. Ornithorhynchus anatinus (Platypus) links the evolution of immunoglobulin genes in eutherian mammals and nonmammalian tetrapods. J. Immunol. 183, 3285–3293. Zhao, Y., Pan-Hammarstrom, Q., Yu, S., Wertz, N., Zhang, X., Li, N., Butler, J.E., Hammarstrom, L., 2006. Identification of IgF, a hinge-region containing Ig class and IgD in Xenopus tropicalis. Proc. Natl. Acad. Sci. U.S.A. 103, 12087–12092.