Tissue organization alters gene expression in equine induced trophectoderm cells

General and Comparative Endocrinology xxx (2017) xxx–xxx

Contents lists available at ScienceDirect

General and Comparative Endocrinology journal homepage: www.elsevier.com/locate/ygcen

Research paper

Tissue organization alters gene expression in equine induced trophectoderm cells Brad M. Reinholt, Jennifer S. Bradley, Robert D. Jacobs, Alan D. Ealy, Sally E. Johnson ⇑ Department of Animal and Poultry Sciences, Virginia Polytechnic Institute and State University, Blacksburg, VA, United States

a r t i c l e

i n f o

Article history: Received 29 September 2016 Revised 26 January 2017 Accepted 29 January 2017 Available online xxxx Keywords: Trophectoderm CDX2 POU5F1 Transcriptome Tissue configuration

a b s t r a c t Rapid morphological and gene expression changes occur during the early formation of a mammalian blastocyst. Critical to successful retention of the blastocyst and pregnancy is a functional trophectoderm (TE) that supplies the developing embryo with paracrine factors and hormones. The contribution of TE conformational changes to gene expression was examined in equine induced trophoblast (iTr) cells. Equine iTr cells were cultured as monolayers or in suspension to form spheres. The spheres are hollow and structurally reminiscent of native equine blastocysts. Total RNA was isolated from iTr monolayers and spheres and analyzed by RNA sequencing. An average of 32.2 and 31 million aligned reads were analyzed for the spheres and monolayers, respectively. Forty-four genes were unique to monolayers and 45 genes were expressed only in spheres. Conformation did not affect expression of CDX2, POU5F1, TEAD4, ETS2, ELF3, GATA2 or TFAP2A, the core gene network of native TE. Bioinformatic analysis was used to identify classes of genes differentially expressed in response to changes in tissue shape. In both iTr spheres and monolayers, the majority of the differentially expressed genes were associated with binding activity in cellular, developmental and metabolic processes. Inherent to protein:protein interactions, several receptor-ligand families were identified in iTr cells with enrichment of genes coding for PI3-kinase and MAPK signaling intermediates. Our results provide evidence for ligand initiated kinase signaling pathways that underlie early trophectoderm structural changes. Ó 2017 Elsevier Inc. All rights reserved.

1. Introduction (2000) Reproduction and embryogenesis in the horse contains several unique features that set it apart from other domestic livestock, rodents, and humans (Betteridge, 2007). The inner cell mass (ICM) of blastocysts is tightly clustered in blastocysts of most mammals, but in equids the ICM contains relatively large and loosely packed embryonic cells (Tremoleda et al., 2003). Also, as the embryo emerges into the uterus, the trophectoderm (TE) secretes glycoproteins that creates a capsule that protects the conceptus and prevents its adhesion to the uterus (Klein and Troedsson, 2012; Oriol et al., 1993b). Similar to other species, conceptus-secreted factors prevent corpus luteum regression by suppressing endometrial prostaglandin F2a secretion (Ealy et al., 2010; Stout and Allen, 2002). However, the identity of the embryonic factors necessary for pregnancy recognition by the mare remains unknown. ⇑ Corresponding author at: Department of Animal and Poultry Sciences, Virginia Polytechnic Institute and State University, 3070 Litton Reaves (0306), Blacksburg, VA 24061, United States. E-mail address: [email protected] (S.E. Johnson).

Trophectoderm formation begins during the first 6-days postovulation in the mare with the blastocyst emerging from the oviduct with a loosely defined inner cell mass surrounded by a layer of trophoblast cells (Betteridge, 2007). Shortly after emerging into the uterus, the blastocyst becomes encased in a protective glycocalyx capsule that allows for motility throughout the uterus until fixation in the uterine horn (Stout et al., 2005; Tachibana et al., 2014). The TE transcriptome at embryonic day (ED) 8 includes CDX2, TEAD4, ELF3 and TFAP2A, genetic signatures reported for mouse, human and bovine TE (Golos et al., 2013; Iqbal et al., 2014; Latos and Hemberger, 2014; Roberts et al., 2004; Sakurai et al., 2012). Unlike the mouse, equine TE also expresses the pluripotency factor, POU5F1 (OCT4), arguing species-specific gene networks control formation of the placenta precursor (Choi et al., 2009; Desmarais et al., 2011). The signals emanating from the TE that initiate maternal recognition of pregnancy remain elusive. Factor(s) produced by the conceptus (ED14) down-regulate uterine endometrial prostaglandin H synthetase expression thus preventing prostaglandin synthesis and the return to estrus (Ealy et al., 2010). An enzyme critical to progesterone synthesis, CYP17A1, is abundant in the ED16 conceptus suggesting that the endocrine systems necessary for a

http://dx.doi.org/10.1016/j.ygcen.2017.01.030 0016-6480/Ó 2017 Elsevier Inc. All rights reserved.

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

2

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx

successful pregnancy are present (Klein, 2015). Chorionic girdle formation begins at ED25 culminating with an increase in GCM1 expression at ED34 and subsequent production of chorionic gonadotrophin beta (de Mestre et al., 2009). The gondatrophin contains both LH and FSH-like activities which allows for the formation of secondary corpora lutea (Allen and Wilsher, 2009). Tissue morphology can drive changes in gene expression. The fluid-filled blastocoel cavity pushes the inner cell mass against the outer zona pelucida with the resulting mechanical forces responsible for establishment of the core pluripotent gene network (Mammoto et al., 2012). Culture of human embryonic stem (ES) cells in suspension leads to the formation of embryoid bodies capable of expressing genes associated with the three primary germ layers as well as the trophectoderm (Giakoumopoulos and Golos, 2013). In a similar manner, trophoblast spheroids are created by suspension culture with the resulting structures morphologically and biochemically reminiscent of native blastocysts. Human trophoblast spheroids demonstrate an increase in HCG production, attach to receptive endometrial cells and invade the monolayer (Lee et al., 2015). Thus, cultivation in a conformation typical of a native blastocyst may allow for a more complete representation of core transcriptional networks. The objective of the experiment was to identify genes that are differentially expressed as a function of tissue configuration in induced equine trophoblast cells (iTr). Results may assist with discerning the mechanisms underlying maternal recognition of pregnancy and the establishment of a successful pregnancy. 2. Materials and methods 2.1. Animals, estrous synchronization and embryo recovery The experimental protocol was reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) at Virginia Polytechnic Institute and State University. Mares (n = 4) were maintained on a single pasture and remained on pasture throughout the breeding and collection period. Mares were evaluated by transrectal ultrasonography daily to map follicular development and determine stage of estrous cycle. Examinations were conducted once daily until a 35 mm follicle was observed along with appropriate edema. Once a follicle of this size was observed a single dose (1.8 mg) of deslorelin acetate (SucroMate, BioNiche Animal Health, Louisville KY) was administered via intramuscular injection. Mares were bred to a single stallion of known fertility (500 x 106 motile spermatozoa) 24 h after deslorelin injection. At the time of insemination, mares were evaluated via transrectal ultrasound to determine ovulation status. Mares that had failed to ovulate were bred again approximately 40 h post deslorelin injection. Approximately 7–7.5 d post-ovulation, embryos were collected from all mares. Mares were sedated with xylazine (0.6 mg/kg). A sterile Foley catheter (36 French diameter) was inserted transcervically and secured in the uterus by inflation of the cuff. The uterus of the mare was flushed a minimum of 3 times with 1 L of warmed flush media (BioLife Advantage Complete Flush Medium, AgTech Inc., Manhattan, KS). Prior to the final flush, mares were administered a single intravenous dose (20 IU) of oxytocin (AgriLabs, St. Joseph, MO) to ensure optimal fluid removal from the uterus. The outflow from the catheter was connected to an in-line embryo filter (AgTech Inc., Manhattan, KS). The filter was washed with collection medium and the flushings were examined using a stereomicroscope (SMZ1500, Nikon, Melville, NY). Recovered embryos were transferred to Matrigel (Corning, Corning, NY) coated tissue cultureware for the formation of TE outgrowths.

2.2. Cell culture and sphere formation Equine trophectoderm cells were created, as described (Ezashi et al., 2011). In brief, equine umbilical cord matrix mesenchymal stem cells were transduced with modified Sendai virus coding for human POU5F1, CDX2, SOX2, KLF4 and c-Myc (Cytotune, Life Technologies, Grand Island, NY). Induced trophectoderm (iTr) colonies formed on mitotic-inactive mouse embryonic fibroblasts (STO, ATCC CRL 1503, American Type Culture Collection, Manassas, VA) within 14 d post-transduction, as observed for induced pluripotent stem (iPS) cells (Breton et al., 2013; Whitworth et al., 2014). To eliminate confounding effects of STO cultures, the iTr cells were passaged onto Matrigel coated cultureware (Corning, Corning, NY). The iTr cells have exceeded 50 passages over a 2 yr timeframe and have retained their TE morphological, biochemical and genetic features. The cells are cultured routinely in growth media (GM) comprised of high glucose Dulbecco’s modified Eagle medium (DMEM) supplemented with 15% fetal bovine serum (FBS), nonessential amino acids, 2 mM glutamine, 55 lM bmercaptoethanol, 1% penicillin-streptomycin and 0.5% gentamicin. Cells are passaged by physical dissociation. In brief, the cells are scraped from the plates with a cell scraper, transferred to a conical tube, and triturated through an 18-gauge needle prior to seeding onto Matrigel coated plates, as described for bovine TE cultures (Michael et al., 2006). All tissue culture reagents were purchased from Invitrogen (Grand Island, NY). For the formation of tissue spheres, the iTr cells are removed from the plate with L7TM hPSC Passaging Solution (Lonza, Walkersville, MD) and passed through a 100 lm cell strainer to remove non-dissociated cell aggregates and seeded as single-cell suspension in ultra-low attachment tissue culture plates (Corning, Corning, NY) in growth medium. After 3 to 7 d, sphere structures had formed and were visualized on an EVOSÒ cell imaging system (Life Technologies). Outgrowth were formed by transfer of iTr spheres to MatrigelTM (BD Biosciences, Franklin, NJ) coated tissue cultureware in growth media, as described (Yang et al., 2011). For growth factor treatments, iTr spheres (d 7) were cultured in 0.1X GM supplemented with 10 ng/mL recombinant human BMP4, EGF or FGF2 for 48 h prior to lysis and total RNA isolation.

2.3. RNA isolation and PCR Total RNA was isolated from iTr monolayers and spheres using TRIzol reagent (Life Technologies). The RNA was purified with PureLinkÒ RNA mini kit (Life Technologies), according to manufacturer’s directions. Purity and quantity of RNA was determined using a NanoDrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE). Total RNA was treated with amplification grade DNAse I (Life Technologies) to remove genomic DNA contaminates and first-strand cDNA was synthesized using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Thermo Scientific). Real-time PCR amplification was carried out with Power SYBRÒ Master Mix with 10 pmols of equine gene specific forward and reverse primers (Table 1). All primer sets exhibited efficiencies greater than 90% as measured by standard dilution curves. Real-time reactions were initiated at 95 °C for 10 min followed by 40 cycles of 95 °C for 15 s, 60° for 30 s. All PCR reactions were performed on an Eppendorf Realplex2 Mastercycler. Non-reverse transcribed RNA samples were included as negative controls. Relative expression level of target genes between treatments was calculated using 2DDCt method, defined as DDCt = (DCtspheres)
(DCtmonolayer). Calculation of DCt was performed by subtracting GAPDH Ct from the Ct for the gene of interest. The Ct values for GAPDH did not vary as a function of treatment.

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

3

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx Table 1 Primer sequences for quantitative PCR. Gene (Accession No.)

Forward (50 –30 )

Reverse (50 –30 )

Size (bp)

Amphiregulin (AREG; XM_001489473) Early Growth Response 1 (EGR1; XM_001502553) Fibrinogen beta chain (FGB; XM_003364535) Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH; NM_001163856) Growth Arrest Specific 2 Like 3 (GAS2L3; XM_001496518) Lectin, Galactoside Binding Soluble (LGALS1; XM_001501032) NEDD4 Binding Protein 2 (N4BP2; XM_005608811) Neuropilin 2 (NRP2; XM_005601698) Solute Carrier Family 36 Member A2 (SLC36A2; XM_005599277) TATA-Box Binding Protein Associated Factor, RNA Polymerase I Subunit D (TAF1D; NM_001309179)

TCAAAAATTGCTTTAGCGGC ACCTGACCTCAGAGTCTTTTCC CTGCGCTAAAAGAGATGTGG GAGACTCCGCCAACATC GCAATTCAAGTGTGGTTTGG

TTCGTTCTTCAGCTTCTCCC AGAAAAACGGCCAGTGTAGG GTATCTGCCGTTTGGATTGG CTGACAATCTTCAGGGAATTGTC ACAGATCTTCTTGCATGGGC

129 118 129 222 153

ACACCATTGTGTGCAACAGC

ACCTCCATGACACTTCCAGG

93

CAACGTTTTGTTTCAGTGCC

ATCTTCATTGTCTCTCGGGC

119

GACAAAGACTTGCAGCTCCC AAAGCAACATAGGCACAGGG

ATTCCTGTCATCTGGGAACG ACAGTGGGTGGAGATGAAGC

152 109

CAAAAGGAAGGAGAAGCACG

TGCTGCCAACTCTTCAATAGG

186

2.4. Transcriptome analysis

2.6. Statistics

Total RNA was isolated from 3 replicate cultures of iTr spheres and monolayers for RNA sequencing and transcriptome analysis (Cofactor Genomics, Saint Louis, MO). RNA was amplified using Ovation RNA-Seq V2 amplification system (NuGEN, San Carols, CA). Double-stranded cDNA was sheared and indexed adaptors were ligated to the DNA followed by size-selection on 2% agarose gels and PCR amplification. Libraries were sequenced on a NextSeq500 using the appropriate reagent kits (Illumina, San Diego, CA). Raw sequence data were assessed for quality and parsed for ribosomal RNA content using FastQC. Sequence reads were aligned to the reference genome (ENSEMBL, Equi Cab 2) with NovoAlign. The average base coverage for each transcript was normalized with mean number of aligned reads for all samples. Cluster boundaries were created using all samples and only uniquely mapping reads were taken into consideration. The average range of similarity between aligned reads was 92%. ActiveSite (CoFactor Genomics) was used to identify genes differentially expressed at a minimum of 2-fold in iTr monolayers vs. spheres. False discovery rate was determined according to Benjamini and Hochberg using Q = 1%. Normalized transcript abundance values greater than 0.1 for each sample (n = 6) were used in the bioinformatics analysis. Genes identified as differentially expressed were analyzed for over- and under-representation using web-based software (PANTHER v10.0, release date May 2015; www.pantherdb.org) with Bonferroni correction for multiple testing (Mi et al., 2013).

Data were analyzed by ANOVA with Tukey’s post hoc test in PROC GLM (SAS Institute, Inc. Cary, NC). Significant difference was established at P < 0.05. Data are presented as means ± SEM. A minimum of 3 replicates of each experiment was performed.

2.5. Immunocytochemistry Equine iTr cells and spheres were fixed with 4% paraformaldehyde (Polyscience, Inc. Warrington, PA) in PBS for 10 min at room temperature, followed by extensive washing with PBS. Nonspecific antigen sites were blocked with 5% FBS in PBS containing 0.1% (vol/ vol) Triton-X100 for 30 min at room temperature. Fixed cells were incubated with anti-CDX2 (1:500, LifeSpan BioScience, Inc., Seattle WA) and anti-OCT4 (1:200, Santa Cruz Biotechnology, Santa Cruz, CA) diluted in PBS containing 0.5% FBS for 60 min at room temperature. After washing 3 times in PBS, fixed cells were incubated with goat anti-mouse AlexaFluor568 (1:200, Invitrogen) and goat antimouse AlexaFluor488 (1:200, Invitrogen). Nuclei were visualized with 40 , 6-diamidino-2-phenylindole, dihydrochloride (DAPI, 5 lg/mL). Immune complexes were visualized by epifluorescence and representative images captured with a Nikon Eclipse TS100 (Nikon, Melville, NY) connected to a CoolSNAP HQ2 camera (Photometrics, Tucson, AZ) and digitized with NIS-Elements AR Ver4.13.00 software (Nikon).

3. Results The efficiency of ES-like colony formation was less than 0.0001%, as reported by others (Koh and Piedrahita, 2014). All colonies were picked from the initial feeder plates and expanded. Four colonies survived after 30 serial passages and were analyzed further. Immunocytochemistry revealed dome-shaped clusters with flat, cuboidal-shaped cells localized around the perimeter that express both CDX2 and POU5F1 within the nucleus (Fig. 1). Expression of CDX2 defined the cells as induced trophectoderm (iTr). Culture of single cell suspensions of iTr cells on non-adherent surfaces promotes the formation of sphere-shaped vesicles (Fig. 2A). The iTr spheres are morphologically similar to an in vivo produced ED7 embryo. Both iTr spheres and ED7 embryos attach to extracellular matrix and form outgrowths (Fig. 2A). Immunostaining for POU5F1 reveals that the iTr spheres are hollow, forming a cavity similar to the blastocoel (Fig. 2B). The effect of tissue configuration was examined in iTr spheres and monolayers by RNA sequencing and transcriptome analysis. Average aligned reads were 32.2 million for iTr sphere RNA isolates and 31.0 million for the iTr monolayer isolates. A total 21,785 transcripts were detected in the combined iTr monolayer and sphere isolates of which 10,471 annotated genes were present above the biological detection threshold. As a first step, the identity of the iTr cells was confirmed by parsing the data for genes known to be involved in TE formation and function (Table 2). Critical lineage determinants, including CDX2, ETS2 and TEAD4 mRNA were present in the iTr cells. Expression of multiple capsule-forming genes, cytochrome P450 genes and prostaglandin E synthesis genes were contained in the RNAseq data. Gene transcripts for GCM1 and HAND1 were absent suggesting the iTr cells are not an advanced placental cell type. Genes coding for enzymes involved in cortisol synthesis (CYP11B1, CYP11B2) were not present however, the estrogen receptor genes, ESR1 and ESR2, were contained in the dataset. Six genes identified by bioinformatics as differentially expressed were selected for validation by quantitative PCR. Total RNA from spheres and monolayers was amplified with gene specific primers and relative abundance measured (Table 3). Results demonstrate that both methods of RNA quantification parallel one another indicating

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

4

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx

Fig. 1. Immunofluorescent detection of trophectoderm (TE) marker proteins in equine induced trophectoderm (iTr) cells. The iTr cells were fixed and immunostained for CDX2 (B), POU5F1 (C) and total nuclei with DAPI (D). Phase contrast image shown in panel A. Scale bar = 50 lm.

that the RNA sequencing provides an authentic snapshot of gene transcription. The RNA sequencing data was analyzed for genes differentially expressed as a function of tissue configuration. Nearly equivalent numbers of gene transcripts were expressed divergently between spheres and monolayers (Supplemental Table 1). The monolayer transcriptome contained 199 genes expressed at 2-fold or greater (P < 0.05) amounts than in spheres, with 45 transcripts unique to monolayers. The iTr sphere transcriptome contained 179 annotated genes expressed at 2-fold or greater (P < 0.05) amounts than in monolayers of which 44 were unique to spheres (Fig. 3A). Gene ontology (GO) analysis revealed a 5-fold enrichment for genes (21) associated with cell motility and movement (P = 0.00031) following culture on a solid surface. As predicted, GO analysis of iTr sphere transcriptome demonstrated a 2-fold enrichment for genes (56) involved with anatomical structure development (P = 0.00021). Bioinformatic analysis of all genes divergently expressed between iTr spheres and monolayers demonstrated that multiple biological processes are altered by conformation which include cell proliferation, migration, development and cell signaling (Fig. 3B). To gain insight into possible signaling pathways involved in maintaining the TE genetic fingerprint, all expressed iTr monolayer genes were analyzed through the KEGG databases. Thirty-eight cytokine ligand and receptor genes are transcribed by iTr cells (Table 4). Activin receptors (ACVR) type IIA, IIB, I and IB and bone morphogenetic receptor (BMPR) IA are expressed by iTr cells. Transcripts for platelet derived growth factor receptor, epidermal growth factor receptor, fibroblast growth factor receptors 1 and 4 and the hepatocyte growth factor receptor, c-MET, are also present. Many of these growth factor receptors signal through the phosphatidylinositol 3-kinase (PI3K) and mitogen activated protein kinase (MAPK) pathways to alter biological responses. KEGG analysis revealed that iTr cells express 103 transcripts associated with PI3K signaling and 93 transcripts associated with MAPK signaling. Intracellular intermediates of the pathways are listed in Table 5.

4. Discussion 4.1. Induced Tr cells are phenotypically and biochemically analogous to TE This work utilized techniques that normally produce iPS cells in humans and rodents. In equine cells, like porcine umbilical matrix mesenchymal stromal cells, ectopic expression of the pluripotency factors, POU5F1, Kruppel-like factor 4 (KLF4), Sex Determining Region Y-Box 2 (SOX2) and c-Myc, produced an apparent equine iTr lineage (Ezashi et al., 2011). This equine iTr cell line demonstrates all the characteristics and features of native equine TE and growth and morphological parameters indistinguishable from other species of TE cell lines. To date, the cells have been passaged for over 50times in a 2-yr period. The iTr cells resemble native equine TE with a morphology identical to that illustrated in previous reports of blastocyst-derived TE outgrowths observed in the horse and cow (Ball et al., 1989; Choi et al., 2015; Iqbal et al., 2014). Each of these cell lines share the same epithelial-like, tightly packed, cobblestone appearance when grown in monolayers. Also sporadic, fluid-filled cellular domes containing raised layers of cells were observed. Cellular morphology of the iTr cells also resembled immortalized chorionic girdle cells (Thway et al., 2001) with the exception that the iTr cells show no apparent bi-nucleated TE that presumably indicated the formation of chorionic girdle cells (invasive TE lineage). The iTr cells also formed sphere-shaped structures identical in conformation to primary-culture generated equine TE spheres reported by others (Ball et al., 1989). Moreover, these equine iTr spheres were identical in size and conformation to spheres generated from the bovine TE cell line, CT1, when the two lines were cultured simultaneously (data not shown). Transcriptome profiling of the iTr cells provided insight into the genetic architecture underlying early TE formation. Comparison of equine iTr cells expression profiles with those from native TE derived from a day 8 conceptus (Iqbal et al., 2014) and other TE cell lines (Schiffmacher and Keefer, 2013) revealed identical expression of the core TE lineage markers, CDX2, TEAD4, GATA2, EOMES and

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx

5

Fig. 2. Induced trophoblast cells form hollow spheres. Equine iTr cells were cultured in suspension for 7 d for the formation of tissue spheres that closely resemble a native ED7 equine embryo (A). The spheres can attach to Matrigel coated plasticware and form outgrowths reminiscent of ED7 blastocysts (lower panels). Inner cell mass of ED7 embryo denoted with white arrow. Trophectoderm outgrowth denoted by TE. Confocal immunofluorescent detection of POU5F1 and nuclei with Hoechst 33,245 demonstrates the existence of a blastocoel-like cavity (B). Scale bar = 400 lm.

TFAP2A. In addition, POU5F1 is present in the nucleus of iTr monolayers and spheres similar to the native equine blastocyst (Choi et al., 2015, 2009; Paris and Stout, 2010). The presence of POU5F1 in equine TE is not surprising. In rodents and primates, there is a Table 2 Gene transcripts indicative of trophoblast lineage and peri-implantation function. Genes present in iTr cells Lineage CDX2, ELF3, EOMES, ERRB, ETS2, GATA2, ID2, TEAD4, specification TFAP2A Capsule B3GALNT1, GALNT12, GALNT1, GNE, FUCA1, NEU1, formation SLC17A5, SLC35A1, ST3GAL1, ST3GAL1, ST3GAL5, ST3GAL6, ST5, TGM3 Steroidogenesis CYP11A1, CYP17A1, CYP19A1, CYP21A2, HSD3B, NR3C1, ESR1, ESR2, PR Prostaglandin PLA2G4A, PLA2G6, PTGES2, PTES, PTGER4, PTGES3, PTGS1, Synthesis PTGS2, SLCO2A1, PTGFRN Genes absent in iTr cells Lineage ASCL2, GATA3, GCM1, HAND1 specification Capsule GALNT4, CHST4 formation Steroidogenesis CYP11B1, CYP11B2, CYP21A1 Prostaglandin PTGER2, PTGFR Synthesis

rapid down-regulation in POU5F1 expression within the TE lineage shortly after their formation (Niakan and Eggan, 2013; Niwa et al., 2005; Ralston and Rossant, 2005). This event does not occur in other species, including equids, where POU5F1 expressed in both TE and ICM well after TE lineage commitment (Berg et al., 2011; Iqbal et al., 2014; Kuijk et al., 2008). The presence of POU5F1 is also evident in cattle, with noted expression in TE at the blastocyst stage and in blastocyst-derived TE outgrowths and CT1 cells (Ozawa et al., 2012; Schiffmacher and Keefer, 2013). Using POU5F1 promoter reporters, a clear distinction between mouse and bovine regulatory networks was uncovered (Berg et al., 2011). Mouse blastocysts are unable to extinguish expression from a bovine POU5F1 promoter-reporter and the equivalent mouse POU5F1-reporter remained transcriptionally active in bovine TE. The mechanism that causes restriction of POU5F1 and CDX2 to the ICM and TE, respectively, in ruminants and equine embryos prior to implantation remains unknown. 4.2. Transcriptome assessment of iTr functional capacity Blastocoel cavity formation is an early event during segregation of the ICM and TE. The fluid-filled cavity first appears at day 6

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

6

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx

Table 3 Comparison of RNAseq and reverse transcription-quantitative PCR results for selected genes. Gene

Fold Change (Monolayer/Sphere)

AREG FGB LGALS1 SLC35A2

RNAseq

qPCR

5.44 4.00 4.02 2.37

2.53 1.76 2.85 1.95

Gene

Fold Change (Sphere/Monolayer) RNAseq

qPCR

EGR1 GAS2L3 N4BP2 NRP2

8.90 2.67 2.82 4.38

6.94 2.04 2.23 3.62

Fig. 3. Gene ontology of the iTr sphere and monolayer transcriptome. Differentially expressed genes from iTr spheres and monolayers were analyzed in PANTHER against the Equus caballus reference database. Results of the most significantly enriched GO term families are shown.

Table 4 Cytokine ligands and receptors present in iTr cells and functional classification1.

1 2 3

Chemokine Family

Hematopoietin Family

Platelet derived Growth Factor Family

Interferon Family

Tumor Necrosis Factor Family

Transforming Growth Factor Beta Family

Interleukin 1 Family

L2

R3

L

R

L

R

L

R

L

R

L

R

L

R

CXCL10 CXCL12 CXCL16 CX3CL1 CCL20 CCL25 CCL28

CXCR4

CNTF IL12 TPO

IL6R IL11RA CNTFR LIFR IL13RA1 IL4R IL12RB1 IL12RB2 EPOR GHR

VEGFA VEGFB KITLG FGF7 IGF1 IGF2

PDGFRA PDGFRB MET EGFR KIT FGFR1 FGFR3 FGFR4 IGFR1 IGFR2

IFNK

IFNAR1 IFNGR1 IFNGR2

EDA

SF11A SF11B SF25 SF12A SF21 SF1A SF17 SF19

TGFB2 TGFB3 BMP7

ACVR1 ACVR2 ACVR1B ACVR2B AMHR2 BMPR2 BMPR1A

IL18

IL1RAP IL1R2

Classification based upon KEGG pathway analysis. L = ligand. R = receptor.

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx Table 5 Intracellular intermediates of the PI3-kinase and MAPK signaling pathways detected in iTr cells1. Pathway

Genes

PI3-kinase

Grb2, RAC1, JAK1, JAK2, JAK3, PTK2, GNB1, GNB2, GNB3, GNB4, GNB5, GNG2, GNG3, GNG4, GNG5, GNG7, GNG8, GNG10, GNG11, GNG12, GNG13, GNGT1, GNGT2, H-RAS, NRAS, K-RAS, PDK1, PTEN, CDC37, mTORC2, THEM4, STK11, DDIT4, TSC1, TSC2, RHEB, PRKCA, SGK1, SGK2, SGK3, MLST8, Mtor, eIF4EBP1, eIF4E, eIF4B, MAP2K1, MAP2K2, GSK3b, CDKN1A, CDKN1B, FOXO3, BAD, CREB1, CREB3, CREB5, ATF2, ATF4, ATF6B, RXRA, IKBKA, IKBKG, IKBKB, NFKB1, RELA, BCL2L1, BCL2L11, MDM2, MCL1, RBL2, p27KIP1, CCND1, CCND2, CCND3, CCNE, CDK2, CDK4, CDK6, MYC, BRCA1

MAPK Classical

JNK/p38

1

GRB2, GNA12, GNG12, H-RAS, N-RAS,K-RAS, RRAS2, MRAS, RASA2, RASA1, NF1, RAPGEF2, PRKCA, PRKCB, PRKCG, RAP1A, RAP1B, BRAF, MAP2K1, MAP2K2, LAMTOR3, PTPRR, PTPN5, PTPN7, DUSP3, DUSP, DUSP9, DUSP10, IKBKA, IKBKG, IKBKB, STMN1, NFKB1, NFKB2, RELA, RELB, ATF4, ELK1, ELK4, MYC, FOS, SRF DAXX, TRAF2, TRAF6, CASP3, ECSIT, RAC1, RAC2, RAC3, CDC42, MAP4K3, MAP4K4, PAK1, PAK2, STK3, STK4, MAP3K1, MAP3K2, MAP3K3, MAP3K4, MAP3K5, MAP3K6, MAP3K7, MAP3K11, MAP3K12, MAP3K13, PPM1B, FLNA, CRK, MAP2K3, MAP2K4, MAP2K6, MAPK8IP1, MAPK8IP2, MAPK8IP3, PPP5C, PTPRR, PTPN5, PTPN7, DUSP3, DUSP, DUSP9, DUSP10, NLK, MAPKAPK2, MAPKAPK3, MAPKAPK5, ATF2, ATF4, HSP27, MAX, DDIT3, ELK1, ELK4, NFATC1, NFATC3, JUN

Classification performed in KEGG. Ligands and receptors not included.

post-ovulation (ED6) in the horse followed shortly thereafter by a glycoprotein capsule that surrounds the blastocyst (Betteridge, 2007; Betteridge et al., 1982). The TE synthesizes and secretes enzymes and extracellular matrix proteins, primarily mucins, that comprises the protective glycocalyx (Oriol et al., 1993a,b). Removal of the protective capsule at ED6 causes conceptus death in utero, thus demonstrating its necessity (Stout et al., 2005). The embryo travels throughout the uterine horns and body for the first twoweeks of pregnancy before it becomes fixed at approximately ED16 (Oriol et al., 1993b). Coincident with fixation, the capsule begins to disassemble using mechanisms that include neuraminidase 2 (NEU2) removal of sialic acid from mucin and other glycoproteins (Klein and Troedsson, 2012). Transcriptome analysis of TE during the ED8-14 window reveals substantial up-regulation of SLC35A1 and SLC17A5, sialic acid transporters, and other genes involved in extracellular matrix production and modification (Iqbal et al., 2014; Klein and Troedsson, 2011a). Similar to native TE, equine iTr cells transcribe acidic sugar transporters and enzymes involved in extracellular matrix modification. Interestingly, all of the previously identified genes involved in capsule formation are expressed at equivalent levels in spheres and monolayers implying that morphogenesis is not a prerequisite for capsule gene formation. It remains to be determined if cell:cell contact is required or if the individual cells are programmed for expression of the protective genes. Estrogens, progestins and prostaglandins are critical for successful pregnancy establishment in multiple species. Estradiol and other estrogens are synthesized by equine conceptuses before and after fixation and implantation (Choi et al., 1997; Zavy et al., 1984). This steroid family is produced primarily by TE during early pregnancy, although the functional necessity of the hormone to pregnancy remains unresolved (Marsan et al., 1987). In swine, conceptus-derived estrogens are essential for the maintenance of pregnancy during early gestation by preventing the luteolytic actions of endometrial-derived PGF2a (Bazer, 1989; Geisert et al., 1987). However, conceptus-derived estrogens are not responsible for maternal recognition of pregnancy in equids, as intrauterine

7

injection of estrogens does not induce a pseudopregnant state in non-pregnant mares (Berg and Ginther, 1978; Zavy et al., 1984). Transcriptome analysis revealed that enzymes required for estrogen synthesis as well as the estrogen receptors, ESR1 and ESR2, are expressed in equine iTr cells. In a similar manner, conceptusderived prostaglandins, PGE2 and PGF2a, are produced by the TE during early pregnancy in the mare prior to conceptus fixation and implantation (Stout and Allen, 2002). These prostaglandins do not serve as pregnancy recognition factors, but they facilitate pregnancy by promoting conceptus migratory activity (Stout and Allen, 2001). Such migration is essential for sustaining a pregnant state in mares (McDowell et al., 1988; Stout and Allen, 2001). The ability of the iTr cells to make and respond to estrogens and prostaglandins, coupled with their ease of culture in multiple configurations make these cells a valuable tool for examining the requirement of these pregnancy-associated hormones for TE function. Bioinformatic analysis of the iTr transcriptome revealed several receptor tyrosine kinase (RTK) and ligands in iTr cells were expressed coincident with a prevalence of PI3-kinase and MAPK signal pathway intermediates. It is interesting to note that VEGFA, VEGFB and KITLG ligands are expressed without their corresponding receptor. VEGFR2 localizes to the luminal and glandular epithelium of pregnant pony mares with little to no immunoreactivity in non-pregnant counterparts (Silva et al., 2011). No differences were reported for VEGFA or VEGFR1 as a function of pregnancy status. Our results suggest that the TE supplies the VEGF that participates in vascular remodeling during pregnancy. Additional RTK and ligand pairs point to autocrine loops for IGF-I and –II signaling and possibly FGF7. Fibroblast growth factor receptors are intimately involved in bovine maternal recognition of pregnancy. Treatment of bovine CT-1 trophoblasts with FGF2 causes increased expression of IFNT, the maternal recognition of pregnancy factor in ruminants (Michael et al., 2006). From day 14 to 21 of gestation, FGF2, FGFR1 and FGFR2 expression increases in the equine conceptus (de Ruijter-Villani et al., 2013). This developmental window coincides with the recognition of pregnancy (Klein and Troedsson, 2011b). Equine iTr cells express the FGFR genes but do not express detectable amounts of FGF2 indicating that the autocrine loop does not exist. The cells do express FGF7, an FGF ligand that induces differentiation of human cytotrophoblasts to synctiotrophoblasts (Massabbal et al., 2005). The absence of HAND1 and GCM1 in the iTr cells supports a permissive role for FGF7 during TE differentiation and points to the requirement of additional factors for the formation of specialized placental cells. Further research is needed to better understand the role of FGF7 to TE formation and function. 4.3. Tissue configuration drives iTr gene expression patterns Multiple conformational changes occur during embryogenesis that elicit distinct transcriptional responses. We hypothesized that cultivation of TE as a sphere-shaped organ would alter developmental gene expression due to a permissive structure. Several key biological processes were affected by configuration with most associated with developmental processes. These results parallel similar findings with mouse and human ES cells cultured as freefloating embryoid bodies as means of initiating germ layer formation and subsequent tissue differentiation (Bratt-Leal et al., 2009). Altered surface elastic modulus can direct cell fate of mesenchymal stem cells and tissue-restricted muscle stem cells clearly conveying that niche properties are important regulators of plasticity (Engler et al., 2006, 2007). Monolayers of iTr cell cultured on a solid surface expressed several genes associated with cell migration, motility and movement. This finding fits well with expected movement of cells across the cultureware surface as well as TE migration

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

8

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx

and invasion into the uterus. Transition of the spherical porcine conceptus to a tubular and elongating structure is typified by enrichment for genes in cell motility and migration (Ross et al., 2009). Future studies will examine the transcript profiles of iTr spheres following re-plating and outgrowth formation with the original monolayers to determine if differences in specific motility transcripts exist. 5. Conclusions Equine iTr cells are a valuable tool for discovery research on equine TE formation. Using these cells, the effect of tissue configuration on TE gene expression was examined. Genes unique to monolayers and spheres were uncovered by RNA sequencing that may participate in native blastocyst structural integrity. Transcriptome analysis provided insight into several receptor-mediated signaling systems present in TE cells. The effects of these putative autocrine and paracrine factors and their participation in maternal:conceptus communication are the focus of future research. Funding This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ygcen.2017.01. 030. References Allen, W.R., Wilsher, S., 2009. A review of implantation and early placentation in the mare. Placenta 30, 1005–1015. http://dx.doi.org/10.1016/j.placenta.2009. 09.007. Ball, B.A., Altschul, M., Freeman, K.P., Hillman, R.B., 1989. Culture of equine trophoblastic vesicles in vitro. Theriogenology 32, 401–412. Bazer, F.W., 1989. Establishment of pregnancy in sheep and pigs. Reprod. Fertil. Dev. 1, 237–242. Berg, D.K., Smith, C.S., Pearton, D.J., Wells, D.N., Broadhurst, R., Donnison, M., Pfeffer, P.L., 2011. Trophectoderm lineage determination in cattle. Dev. Cell 20, 244– 255. http://dx.doi.org/10.1016/j.devcel.2011.01.003. Berg, S.L., Ginther, O.J., 1978. Effect of estrogens on uterine tone and life span of the corpus luteum in mares. J. Anim. Sci. 47, 203–208. Betteridge, K.J., 2007. Equine embryology: an inventory of unanswered questions. Theriogenology 68 (Suppl. 1), S9–S21. http://dx.doi.org/10.1016/j. theriogenology.2007.04.037. Betteridge, K.J., Eaglesome, M.D., Mitchell, D., Flood, P.F., Beriault, R., 1982. Development of horse embryos up to twenty two days after ovulation: observations on fresh specimens. J. Anat. 135, 191–209. Bratt-Leal, A.M., Carpenedo, R.L., McDevitt, T.C., 2009. Engineering the embryoid body microenvironment to direct embryonic stem cell differentiation. Biotechnol. Progr. 25, 43–51. http://dx.doi.org/10.1002/btpr.139. Breton, A., Sharma, R., Diaz, A.C., Parham, A.G., Graham, A., Neil, C., Whitelaw, C.B., Milne, E., Donadeu, F.X., 2013. Derivation and characterization of induced pluripotent stem cells from equine fibroblasts. Stem Cells Dev. 22, 611–621. http://dx.doi.org/10.1089/scd.2012.0052. Choi, S.J., Anderson, G.B., Roser, J.F., 1997. Production of free estrogens and estrogen conjugates by the preimplantation equine embryo. Theriogenology 47, 457– 466. Choi, Y.H., Harding, H.D., Hartman, D.L., Obermiller, A.D., Kurosaka, S., McLaughlin, K.J., Hinrichs, K., 2009. The uterine environment modulates trophectodermal POU5F1 levels in equine blastocysts. Reproduction 138, 589–599. http://dx.doi. org/10.1530/REP-08-0394. Choi, Y.H., Ross, P.J., Velez, I.C., Macías García, B., Riera, F.L., Hinrichs, K., 2015. Cell lineage allocation in equine blastocysts produced in vitro under varying glucose concentrations. Reproduction 150, 31–41. http://dx.doi.org/10.1530/REP-140662. de Mestre, A.M., Miller, D., Roberson, M.S., Liford, J., Chizmar, L.C., McLaughlin, K.E., Antczak, D.F., 2009. Glial cells missing homologue 1 is induced in differentiating equine chorionic girdle trophoblast cells. Biol. Reprod. 80, 227–234. http://dx. doi.org/10.1095/biolreprod.108.070920. de Ruijter-Villani, M., van Boxtel, P.R.M., Stout, T.A.E., 2013. Fibroblast growth factor-2 expression in the preimplantation equine conceptus and endometrium

of pregnant and cyclic mares. Theriogenology 80, 979–989. http://dx.doi.org/ 10.1016/j.theriogenology.2013.07.024. Desmarais, J.A., Demers, S.-P., Suzuki, J., Laflamme, S., Vincent, P., Laverty, S., Smith, L.C., 2011. Trophoblast stem cell marker gene expression in inner cell massderived cells from parthenogenetic equine embryos. Reproduction 141, 321– 332. http://dx.doi.org/10.1530/REP-09-0536. Ealy, A.D., Eroh, M.L., Sharp, D.C., 2010. Prostaglandin H synthase Type 2 is differentially expressed in endometrium based on pregnancy status in pony mares and responds to oxytocin and conceptus secretions in explant culture. Anim. Reprod. Sci. 117, 99–105. http://dx.doi.org/10.1016/j. anireprosci.2009.03.014. Engler, A.J., Sen, S., Sweeney, H.L., Discher, D.E., 2006. Matrix elasticity directs stem cell lineage specification. Cell 126, 677–689. http://dx.doi.org/10.1016/ j.cell.2006.06.044. Engler, A.J., Sweeney, H.L., Discher, D.E., Schwarzbauer, J.E., 2007. Extracellular matrix elasticity directs stem cell differentiation. J. Musculoskelet. Neuronal Interact. 7, 335. Ezashi, T., Matsuyama, H., Telugu, B.P.V.L., Roberts, R.M., 2011. Generation of colonies of induced trophoblast cells during standard reprogramming of porcine fibroblasts to induced pluripotent stem cells. Biol. Reprod. 85, 779– 787. http://dx.doi.org/10.1095/biolreprod.111.092809. Geisert, R.D., Zavy, M.T., Wettemann, R.P., Biggers, B.G., 1987. Length of pseudopregnancy and pattern of uterine protein release as influenced by time and duration of oestrogen administration in the pig. J. Reprod. Fertil. 79, 163–172. Giakoumopoulos, M., Golos, T.G., 2013. Embryonic stem cell-derived trophoblast differentiation: a comparative review of the biology, function, and signaling mechanisms. J. Endocrinol. 216, R33–R45. http://dx.doi.org/10.1530/JOE-120433. Golos, T.G., Giakoumopoulos, M., Gerami-Naini, B., 2013. Review: trophoblast differentiation from human embryonic stem cells. Placenta 34 (Suppl), S56–S61. http://dx.doi.org/10.1016/j.placenta.2012.11.019. Iqbal, K., Chitwood, J.L., Meyers-Brown, G.A., Roser, J.F., Ross, P.J., 2014. RNA-seq transcriptome profiling of equine inner cell mass and trophectoderm. Biol. Reprod. 90, 61. http://dx.doi.org/10.1095/biolreprod.113.113928. Klein, C., 2015. Novel equine conceptus–endometrial interactions on Day 16 of pregnancy based on RNA sequencing. Reprod. Fertil. Dev. http://dx.doi.org/ 10.1071/RD14489. Klein, C., Troedsson, M.H.T., 2012. Equine pre-implantation conceptuses express neuraminidase 2–a potential mechanism for desialylation of the equine capsule. Reprod. Domest. Anim. 47, 449–454. http://dx.doi.org/10.1111/ j.1439-0531.2011.01901.x. Klein, C., Troedsson, M.H.T., 2011a. Transcriptional profiling of equine conceptuses reveals new aspects of embryo-maternal communication in the horse. Biol. Reprod. 84, 872–885. http://dx.doi.org/10.1095/biolreprod.110.088732. Klein, C., Troedsson, M.H.T., 2011b. Maternal recognition of pregnancy in the horse: a mystery still to be solved. Reprod. Fertil. Dev. 23, 952–963. http://dx.doi.org/ 10.1071/RD10294. Koh, S., Piedrahita, J.A., 2014. From ‘‘ES-like” cells to induced pluripotent stem cells: a historical perspective in domestic animals. Theriogenology 81, 103–111. http://dx.doi.org/10.1016/j.theriogenology.2013.09.009. Kuijk, S., Puy, E.W., Du, L., Van Tol, H.T.A., Oei, C.H.Y., Haagsman, H.P., Colenbrander, B., Roelen, B.A.J., 2008. Differences in early lineage segregation between mammals. Dev. Dyn 237, 918–927. http://dx.doi.org/10.1002/dvdy.21480. Latos, P.A., Hemberger, M., 2014. Review: the transcriptional and signalling networks of mouse trophoblast stem cells. Placenta 35 (Suppl), S81–S85. http://dx.doi.org/10.1016/j.placenta.2013.10.013. Lee, Y.-L., Fong, S.-W., Chen, A.C.H., Li, T., Yue, C., Lee, C.-L., Ng, E.H.Y., Yeung, W.S.B., Lee, K.-F., 2015. Establishment of a novel human embryonic stem cell-derived trophoblastic spheroid implantation model. Hum. Reprod. 30, 2614–2626. http://dx.doi.org/10.1093/humrep/dev223. Mammoto, A., Mammoto, T., Ingber, D.E., 2012. Mechanosensitive mechanisms in transcriptional regulation. J. Cell. Sci. 125, 3061–3073. http://dx.doi.org/ 10.1242/jcs.093005. Marsan, C., Goff, A.K., Sirois, J., Betteridge, K.J., 1987. Steroid secretion by different cell types of the horse conceptus. J. Reprod. Fertil. Suppl. 35, 363–369. Massabbal, E., Parveen, S., Weisoly, D.L., Nelson, D.M., Smith, S.D., Fant, M., 2005. PLAC1 expression increases during trophoblast differentiation: evidence for regulatory interactions with the fibroblast growth factor-7 (FGF-7) axis. Mol. Reprod. Dev. 71, 299–304. http://dx.doi.org/10.1002/mrd.20272. McDowell, K.J., Sharp, D.C., Grubaugh, W., Thatcher, W.W., Wilcox, C.J., 1988. Restricted conceptus mobility results in failure of pregnancy maintenance in mares. Biol. Reprod. 39, 340–348. Mi, H., Muruganujan, A., Casagrande, J.T., Thomas, P.D., 2013. Large-scale gene function analysis with the PANTHER classification system. Nat. Protoc. 8, 1551– 1566. http://dx.doi.org/10.1038/nprot.2013.092. Michael, D.D., Alvarez, I.M., Ocón, O.M., Powell, A.M., Talbot, N.C., Johnson, S.E., Ealy, A.D., 2006. Fibroblast growth factor-2 is expressed by the bovine uterus and stimulates interferon-tau production in bovine trophectoderm. Endocrinology 147, 3571–3579. http://dx.doi.org/10.1210/en.2006-0234. Niakan, K.K., Eggan, K., 2013. Analysis of human embryos from zygote to blastocyst reveals distinct gene expression patterns relative to the mouse. Dev. Biol. 375, 54–64. http://dx.doi.org/10.1016/j.ydbio.2012.12.008. Niwa, H., Toyooka, Y., Shimosato, D., Strumpf, D., Takahashi, K., Yagi, R., Rossant, J., 2005. Interaction between Oct3/4 and Cdx2 determines trophectoderm differentiation. Cell 123, 917–929. http://dx.doi.org/10.1016/j.cell.2005.08.040.

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030

B.M. Reinholt et al. / General and Comparative Endocrinology xxx (2017) xxx–xxx Oriol, J.G., Betteridge, K.J., Clarke, A.J., Sharom, F.J., 1993a. Mucin-like glycoproteins in the equine embryonic capsule. Mol. Reprod. Dev. 34, 255–265. http://dx.doi. org/10.1002/mrd.1080340305. Oriol, J.G., Sharom, F.J., Betteridge, K.J., 1993b. Developmentally regulated changes in the glycoproteins of the equine embryonic capsule. J. Reprod. Fertil. 99, 653– 664. Ozawa, M., Sakatani, M., Yao, J., Shanker, S., Yu, F., Yamashita, R., Wakabayashi, S., Nakai, K., Dobbs, K.B., Sudano, M.J., Farmerie, W.G., Hansen, P.J., 2012. Global gene expression of the inner cell mass and trophectoderm of the bovine blastocyst. BMC Dev. Biol. 12, 33. http://dx.doi.org/10.1186/1471-213X12-33. Paris, D.B.B.P., Stout, T.A.E., 2010. Equine embryos and embryonic stem cells: defining reliable markers of pluripotency. Theriogenology 74, 516–524. http:// dx.doi.org/10.1016/j.theriogenology.2009.11.020. Ralston, A., Rossant, J., 2005. Genetic regulation of stem cell origins in the mouse embryo. Clin. Genet. 68, 106–112. http://dx.doi.org/10.1111/j.13990004.2005.00478.x. Roberts, R.M., Ezashi, T., Das, P., 2004. Trophoblast gene expression: Transcription factors in the specification of early trophoblast. Reprod. Biol. Endocrinol. 2, 47. http://dx.doi.org/10.1186/1477-7827-2-47. Ross, J.W., Ashworth, M.D., Stein, D.R., Couture, O.P., Tuggle, C.K., Geisert, R.D., 2009. Identification of differential gene expression during porcine conceptus rapid trophoblastic elongation and attachment to uterine luminal epithelium. Physiol. Genomics 36, 140–148. http://dx.doi.org/10.1152/physiolgenomics. 00022.2008. Sakurai, T., Bai, H., Bai, R., Arai, M., Iwazawa, M., Zhang, J., Konno, T., Godkin, J.D., Okuda, K., Imakawa, K., 2012. Coculture system that mimics in vivo attachment processes in bovine trophoblast cells. Biol. Reprod. 87, 60. http://dx.doi.org/ 10.1095/biolreprod.112.100180. Schiffmacher, A.T., Keefer, C.L., 2013. CDX2 regulates multiple trophoblast genes in bovine trophectoderm CT-1 cells. Mol. Reprod. Dev. 80, 826–839. http://dx.doi. org/10.1002/mrd.22212. Silva, L.A., Klein, C., Ealy, A.D., Sharp, D.C., 2011. Conceptus-mediated endometrial vascular changes during early pregnancy in mares: an anatomic, histomorphometric, and vascular endothelial growth factor receptor system

9

immunolocalization and gene expression study. Reproduction 142, 593–603. http://dx.doi.org/10.1530/REP-11-0149. Stout, T.A., Allen, W.R., 2001. Role of prostaglandins in intrauterine migration of the equine conceptus. Reproduction 121, 771–775. Stout, T.A.E., Allen, W.R., 2002. Prostaglandin E(2) and F(2 alpha) production by equine conceptuses and concentrations in conceptus fluids and uterine flushings recovered from early pregnant and dioestrous mares. Reproduction 123, 261–268. Stout, T.A.E., Meadows, S., Allen, W.R., 2005. Stage-specific formation of the equine blastocyst capsule is instrumental to hatching and to embryonic survival in vivo. Anim. Reprod. Sci. 87, 269–281. http://dx.doi.org/10.1016/j. anireprosci.2004.11.009. Tachibana, Y., Sakurai, T., Bai, H., Shiota, K., Nambo, Y., Nagaoka, K., Imakawa, K., 2014. RNA-Seq analysis of equine conceptus transcripts during embryo fixation and capsule disappearance. PLoS One 9, e114414. http://dx.doi.org/10.1371/ journal.pone.0114414. Thway, T.M., Clay, C.M., Maher, J.K., Reed, D.K., McDowell, K.J., Antczak, D.F., Eckert, R.L., Nilson, J.H., Wolfe, M.W., 2001. Immortalization of equine trophoblast cell lines of chorionic girdle cell lineage by simian virus-40 large T antigen. J. Endocrinol. 171, 45–55. Tremoleda, J.L., Stout, T.A.E., Lagutina, I., Lazzari, G., Bevers, M.M., Colenbrander, B., Galli, C., 2003. Effects of in vitro production on horse embryo morphology, cytoskeletal characteristics, and blastocyst capsule formation. Biol. Reprod. 69, 1895–1906. http://dx.doi.org/10.1095/biolreprod.103.018515. Whitworth, D.J., Ovchinnikov, D.A., Sun, J., Fortuna, P.R.J., Wolvetang, E.J., 2014. Generation and characterization of leukemia inhibitory factor-dependent equine induced pluripotent stem cells from adult dermal fibroblasts. Stem Cells Dev. http://dx.doi.org/10.1089/scd.2013.0461. Yang, Q.E., Fields, S.D., Zhang, K., Ozawa, M., Johnson, S.E., Ealy, A.D., 2011. Fibroblast growth factor 2 promotes primitive endoderm development in bovine blastocyst outgrowths. Biol. Reprod. 85, 946–953. http://dx.doi.org/ 10.1095/biolreprod.111.093203. Zavy, M.T., Vernon, M.W., Asquith, R.L., Bazer, F.W., Sharp, D.C., 1984. Effect of exogenous gonadal steroids and pregnancy on uterine luminal prostaglandin F in mares. Prostaglandins 27, 311–320.

Please cite this article in press as: Reinholt, B.M., et al. Tissue organization alters gene expression in equine induced trophectoderm cells. Gen. Comp. Endocrinol. (2017), http://dx.doi.org/10.1016/j.ygcen.2017.01.030