- Email: [email protected]
Tissue specificity of a new splice form of the human lysyl hydroxylase 2 gene
Matrix Biology 18 Ž1999. 179]187
Tissue specificity of a new splice form of the human lysyl hydroxylase 2 gene Heather N. Yeowell, Linda C. Walker Di¨ ision of Dermatology, Duke Uni¨ ersity Medical Center, Durham, NC 27710, USA Accepted 8 January 1999
Abstract In this study we present the first report of alternative RNA splicing in a gene for lysyl hydroxylase ŽLH. in a normal population. This splicing event, which we have observed in the LH2 gene, appears to be tissue specific. The LH2 isoform was recently cloned and sequenced from a human kidney cDNA library and predicted to encode a 737 amino acid protein. In the present study, we have isolated a cDNA for LH2 from human skin fibroblasts that codes for a protein of 758 amino acids, of which 21 amino acids are encoded by a new exon. This 63-bp exon, designated exon 13A, is located between exons 13 and 14 of the originally-described LH2 gene. Amplification of cDNAs by PCR, using primers from exons 13 and 14, showed the presence of two distinct LH2 mRNA populations. A 209-bp transcript was expressed in mRNAs isolated from all tissues examined and was the only transcript expressed in skin, lung, aorta and dura, whereas in mRNAs from spleen, cartilage, liver, kidney, frontal lobe and placenta, an additional shorter 146-bp transcript was amplified. DNA sequence analysis showed that these two mRNAs resulted from the alternative splicing of exon 13A. The transcript containing exon 13A is expressed as the major LH2 form in all tissues except kidney and spleen. Analysis of genomic DNA from skin, placenta and spleen showed that both transcripts were generated from the same LH2 gene. Both upstream Žintron 13. and downstream Žintron 13A. sequences bordering exon 13A had normal consensus sequences for the acceptor Žag. and donor Žgt. splice sites. Preliminary studies indicated that only single transcripts which included exon 13A were amplified from normal fetal skin at different stages of gestation. This suggests that although exon 13A is variably expressed in different tissues, this alternative splicing event is not developmentally regulated. Q 1999 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. Keywords: Lysyl hydroxylase isoforms; Alternative splicing; Differential exon expression; Tissue specificity; Developmental regulation
1. Introduction The existence of isoforms of LH has been proposed to explain that the hydroxylation of lysine residues within the helical region of type I collagen appeared distinct from the hydroxylation of lysine residues in the telopeptide region of the collagen gene and there-
Abbre¨ iations: bp, Base pair; EDS VI, Ehlers]Danlos syndrome type VI; kb, Kilobase; LH, Lysyl hydroxylase; nt, Nucleotide; PCR, Polymerase chain reaction
fore may be mediated by different enzymic forms of LH ŽBarnes et al., 1974; Royce and Barnes, 1985; Gerriets et al., 1993.. Until very recently, only one form of the post-translational modifying enzyme of collagen biosynthesis, lysyl hydroxylase Ždesignated LH1., had been characterized. The 40-kb gene for LH1 is located on chromosome 1 and includes 19 exons and an unusually large first intron of 12.5 kb ŽHeikkinen et al., 1994.. The introns are of high homology, generating many potential recombination sites within the gene. LH1 has an mRNA of 3.4 kb ŽHautala et al., 1992; Yeowell et al., 1992, 1994. that
0945-053Xr99r$ - see front matter Q 1999 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. PII: S 0 9 4 5 - 0 5 3 X Ž 9 9 . 0 0 0 1 3 - X
180
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
codes for a protein of 709 amino acids Žaa. and a signal peptide of 18 aa ŽHautala et al., 1992.. The region between amino acids 639 and 715 is highly conserved Ž99%. between chick and human LH1 and may contain the active site of the enzyme. Northern blots show that the LH1 gene is strongly expressed in skin fibroblasts and placenta and, to a lesser extent, in aorta, lung, vein, cartilage and artery ŽYeowell et al., 1994.. An isoform of LH ŽLH2. has been recently isolated from cDNA libraries of human fetal kidney and human pancreas ŽValtavaara et al., 1997.. The open reading frame predicts a protein of 737 aa which includes an amino terminal signal peptide. The amino acid sequence has an overall similarity of 75% to the original LH1 and contains specific residues that are conserved in LH1 and thought to be important in the activity of the enzyme. These include five functionally important histidine residues, of which two may have a role in ferrous binding ŽMyllyla et al., 1992; Passoja et al., 1998a., and two aspartate residues in the carboxyl-terminal which, when mutated, cause a dramatic reduction in LH activity ŽPirskanen et al., 1996.. Ten cysteine residues are also conserved between LH1 and LH2 ŽValtavaara et al., 1997.. Northern analysis identifies a 4.2-kb mRNA that is highly expressed in pancreas, liver, placenta and heart ŽValtavaara et al., 1997.. The gene for LH2 has been localized to chromosome 3 ŽSzpirer et al., 1997., but no information is available on its genomic structure and therefore its exonrintron organization is unknown. A third isoform of LH ŽLH3. has also recently been isolated from kidney and liver libraries which has a high overall similarity to LH1 and LH2 at the amino acid level ŽPassoja et al., 1998b; Valtavaara et al., 1998.. The gene for LH3 has been localized to chromosome 7 ŽValtavaara et al., 1998.. The five histidine residues and the two aspartate residues identified as functionally important in LH1 and LH2 are also conserved in LH3. Two of the histidines and one of the aspartates that bind the ferrous ion ŽPirskanen et al., 1996. together with a conserved arginine that binds to a-ketoglutarate ŽPassoja et al., 1998a. have been recently identified as critical residues in the active site of the LH isoforms. Although their role in enzyme activity has not yet been reported ŽYeowell et al., manuscript in preparation., nine out of 10 cysteine residues are conserved between the three isoforms. The importance of LH is demonstrated in patients with Ehlers]Danlos syndrome type VI ŽEDS VI., whose clinical phenotype of hyperextensible joints and skin results from a deficiency of lysyl hydroxylase. These patients have been designated as EDS VIA. The deficiency of this enzyme, that is crucial for the crosslinking that gives collagen its tensile strength, has been shown to result from several different muta-
tions in the LH1 gene ŽHyland et al., 1992; Hautala et al., 1993; Ha et al., 1994; Heikkinen et al., 1997; Yeowell and Walker, 1997; Pajunen et al., 1998; Pousi et al., 1998; Walker et al., 1998.. A second category of patients Ždesignated EDS VIB. has been identified who, although they are characterized by the clinical characteristics of EDS VI, have normal levels of LH activity. To date, there has been no report of mutations in either the LH2 or LH3 gene that may be responsible for defective extracellular matrix. In the current study, we have identified a new 63-bp exonic sequence Žexon 13A. located between exons 13 and 14 of the LH2 gene that is expressed in all the tissues that we have examined. Although it is expressed as the only transcript in skin, aorta, dura and lung, two alternatively spliced transcripts, with and without exon 13A, are amplified in cDNAs from spleen, cartilage, liver, kidney, frontal lobe and placenta. These transcripts were shown to be generated from a single LH2 gene. We have shown that although this newly-described transcript is expressed as the major form in most tissues, the originally-described transcript is expressed strongly in certain tissues such as kidney and spleen. 2. Materials and methods 2.1. Cell strains and tissues Human fibroblast cell lines used in this research Žitalicized numbers. were obtained from the Coriell Institute for Medical Research, Camden, NJ. They include 1231, 12-month-old caucasian male ŽGM05399.; 842, 14-month-old caucasian male ŽGM05659 .; 1232, 3-year-old caucasian male ŽGM02938.; 1227, 8-week-old black male fetus ŽGM00011B.; 1228, 12-week-old black male fetus ŽGM1603B.; 1226, 16-week-old black female fetus ŽAG04451.; 1229, 20-week-old black male fetus ŽGM06170.; and 1230, 20-week-old white male fetus ŽGM05386B.. Two cell lines: 1201, 12-week-old black female fetus ŽCRL1502.; and 1225, 23-week-old black male fetus ŽCRL1475. were obtained from the American Type Culture Collection, Manassas, VA. Other human fibroblast cell lines that were cultured from biopsies are 1217 and 1162 Žindicated to be EDS VIB patients., and 1191 ŽEDS VIA.. Other types of cultured cells include: 1204, neonatal foreskin fibroblasts from 2-day-old male; 1212, aorta cells grown from biopsy; 1205, chorionic villus cells from 10 weeks gestation; and 1216, amniocytes from 14 weeks gestation. Tissues used include lung, spleen, frontal lobe, and dura obtained from a female donor and placental tissue from two donors. Kidney poly Aq RNA and liver cDNA were pur-
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
chased from Clontech ŽPalo Alto, CA.. The human fetal liver library and the cartilage cDNA library were graciously donated by Dr D. Fleenor ŽDuke University Medical Center. and Dr Y. Yamada ŽNIH., respectively. 2.2. Cell culture Fibroblast cells from skin and aorta were grown to confluency as described ŽMurad et al., 1983. using Dulbecco’s Modified Eagle’s Medium ŽDMEM. ŽGibco BRL, Rockville, MD. supplemented with 20% heat-inactivated calf serum ŽGibco BRL.. The amniocytes and chorionic villus cells were grown in AmnioMax media ŽGibco BRL.. 2.3. Total RNA isolation 2.3.1. Cells Total RNA was prepared from chorionic villus cells, amniocytes, and fibroblasts from skin and aorta, using the guanidine isothiocyanateracid-phenol method described by Chomczynski and Sacchi Ž1987.. The amount of starting material was approximately 6 = 10 6 cells per sample. 2.3.2. Human tissues Total RNA was prepared from the tissues Žlung, spleen, frontal lobe, dura. of a female donor and from the placenta of two other donors using 5.4 ml of guanidinium thiocyanate per 1 g of tissue which had been pulverized using a mortar and pestle cooled with liquid nitrogen. 2.4. Preparation of cDNAs from different cell lines and tissues for PCR Poly Aq RNA was isolated directly from dermal fibroblasts Ž 842, 1217, 1162, and 1191. and aorta Ž 1212 ., chorionic villus Ž 1205 ., and amniocytes Ž 1216 . using approximately 1]2 = 10 6 cells per each isolation ŽMicro-FastTrack kit, Invitrogen, Carlsbad, CA.. Poly Aq RNA from kidney was obtained from Clontech. Either first strand cDNA was synthesized using the Superscript II system ŽGibco-BRL. or, alternatively, RT-PCR was performed directly on these poly Aq RNAs and on total RNA from dermal fibroblast cell lines Ž 1204, 1231, 1232 . and fetal fibroblast cell lines Ž 1201, 1225, 1226, 1227, 1228, 1229, 1230 . and from lung, spleen, frontal lobe, dura, aorta, and placenta using the SuperScript One-Step RT-PCR system ŽGibco BRL. according to manufacturer’s instructions. PCR was performed directly on cDNA libraries from human cartilage and fetal liver. 2.5. Primers The following primers were selected from regions
181
of the cDNA sequence of LH2 ŽValtavaara et al., 1997. that were dissimilar to the sequences of LH1 and LH3 cDNAs ŽHautala et al., 1992; Valtavaara et al., 1998.. 1A: ATGCACGGTGAAGCCTCAGCT Žnt 9]29.; 1B: ACGTGTTCATGCCAGTCATTCA Žnt 2252] 2273.; 2B: GCAGACAAGTCGACTGTATCG Žnt 852] 872.; 3A: CTCCGATCAGAGATGAATG Žnt 1414]1432.; 3B: ATTAGCAGTGGATAATAGCC Žnt 1541] 1560.; 3C: GCTCTAGA ATTAGCAGTGGATAATAGCC Žnt 1541]1560.; 4A: GGAACTATTTTGTTCGTGAT Žnt 1436] 1455.; and 4B: TGTCTATTAGAAATGTACATAA Žnt 1508] 1529.. The A and B primers are based on the sense and complementary strands, respectively. Primer 3C is identical to 3B with the addition of an XbaI site Žshown in italics .. 2.6. PCR amplification conditions for LH2 cDNAs 2.6.1. Full length coding region of LH2 The ; 2.3-kb full length coding region for LH2 cDNAs, prepared from skin fibroblast cell lines Ž 842, 1216, 1217, 1162, and 1191., and aorta, lung and kidney as described above, were amplified using primers 1A and 1B. The PCR reaction was in a final volume of 50 m l under conditions as previously described ŽKrol et al., 1996. using an annealing temperature of 588C. The cDNA products were electrophoresed on a 1% agarose gel, excised, and purified using QIAquick gel extraction kit ŽQiagen, Hilden, Germany.. The gel-purified products were directly sequenced at the ICBRrDNA Sequencing Facility, University of Florida, Gainesville, FL. 2.6.2. Amplification of short region of cDNA encompassing new exon Using primers 3A and 3B, the cDNA fragments spanning the region between nt 1414 and 1560 were amplified from cDNA or RNA templates isolated as described above. These included the fetal and postnatal dermal fibroblast cell lines, aorta, dura, lung, placenta, spleen, cartilage, kidney, frontal lobe, liver and chorionic villus cells. The PCR conditions were as previously described, using an annealing temperature of 518C. For RT-PCR, a reverse-transcription cycle at 508C for 30 min and 948C for 2 min was added prior to the PCR reaction. The products were separated
182
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
electrophoretically on a 3% Agarose-1000 gel ŽGibco BRL., and following gel purification, were directly sequenced. 2.7. PCR amplification and sequencing of region between exons 13 and 14 from genomic DNA isolated from skin fibroblasts, spleen and placenta Genomic DNA was isolated from skin fibroblasts using 6]10 = 10 6 cellsrsample and from placental and spleen tissues ŽQIAamp kit for genomic extraction from cells and tissues, Qiagen., according to manufacturer’s protocols. DNA fragments of 2.4 kb between exon 13 and exon 14 were amplified from these genomic DNAs as described ŽYeowell and Walker, 1997.. Amplification was performed in a 50-m l reaction volume containing 200 ng genomic DNA, 300 ng of primers 3A and 3B described above, 250 m M of each deoxynucleotide, 1.5 mM Mg 2q, 50 mM KCl, 10 mM Tris]HCl pH 8.3, and 2.5 units Taq DNA polymerase ŽBoehringer Mannheim.. The reaction mixture was denatured at 948C for 4 min, annealed at 578C for 1 min and the extension carried out at 728C for 1 min. The annealing temperature was decreased by 28C every two cycles three times and was maintained at 518C for the final 35 cycles. Following gel purification, the identity of the 2.4-kb sequences was confirmed by reamplification using nested primers 4A and 4B. Using touchdown PCR with an initial annealing temperature of 558C, the reaction was maintained at 498C for the final 35 cycles. The gel-purified 2.4-kb fragments from the PCR using primers 3A and 3B were analyzed by direct sequencing ŽGenBank accession number: AF085277.. 2.8. Cloning of 2.4-kb fragment from placental genomic DNA The 2.4-kb fragment from placental genomic DNA was amplified by PCR using primer 3A and the complementary primer 3C which had been modified from 3B by adding an XbaI restriction site to the 59 end. The PCR conditions were as described for primers 3A and 3B. Following gel-purification, the fragment was restricted with BamHI Ža unique BamHI restriction site is present 20 bases from the 59 end of the sequence. and XbaI prior to gel-purification and ligation into a similarly restricted pGEM-3ZfŽq. vector ŽPromega, Madison, WI.. Following transformation into E. coli DH5a competent cells, a positive clone was selected, maxi-prepped ŽQiagen., and sequenced at the ICBRrDNA sequencing facility. 2.9. MspI restriction The amplified, gel-purified 2.4-kb genomic fragments from skin and placenta were subjected to re-
striction site analysis with MspI. Following elution into water from the QIAquick gel purification column ŽQiagen., the sample was restricted with MspI according to manufacturer’s instructions ŽBoehringer Mannheim, Indianapolis, IN. at 378C. The restricted samples were run on a 1% agarose gel together with an uncut fragment from skin. 3. Results 3.1. Sequence comparison of full length cDNAs for LH2 from different tissues The complete coding region of LH2 from cDNAs isolated from each of the human skin fibroblast cell lines, aorta cells and lung was amplified by PCR using primers 1A and 1B as described in Section 2. Direct sequencing Žin both directions. of the gel-purified 2.3-kb PCR products showed them to be identical to each other. Each cDNA had an identical in-frame 63-bp sequence insertion at nt 1500 wbased on the numbering of the originally-described sequence of LH2 cDNA isolated from human kidney and pancreas cDNA libraries ŽValtavaara et al., 1997.x. Apart from this 63-bp insertion, the sequences were identical to the previously-reported sequence. Although the genomic sequence for LH2 has not been reported, from a comparison with the genomic sequence of the LH1 gene ŽHeikkinen et al., 1994., we determined that this novel sequence was inserted at the junction of exons 13 and 14. This sequence introduced a new MspI site into LH2 cDNA which enabled us to check additional cDNAs for the presence of this sequence. The cDNA for the coding region of LH2 was similarly amplified from kidney. Sequence analysis of the full length LH2 kidney cDNA showed a lack of the 63-bp insert identified in skin cDNA. This concurred with the previously reported sequence of LH2 kidney cDNA ŽValtavaara et al., 1997.. 3.2. Differential expression of 63-bp sequence in different tissues We then used primers Ž3A and 3B. based on exon 13 and exon 14 that spanned the region between nt 1414 and 1520 to amplify a short region of LH2 cDNA encompassing this 63-bp sequence from each of the cell lines as described in Section 2. The PCR products were separated by electrophoresis as shown in Fig. 1A. Only a single 209-bp transcript was amplified from skin, dura, aorta and lung, whereas in addition to the 209-bp fragment, a shorter 146-bp transcript was amplified from kidney, liver, spleen, cartilage, frontal lobe, chorionic villus and placenta. Within the limits of the PCR, the ratio of expression of the shorter to the longer transcript appeared highly vari-
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
183
from embryonic skin at gestational ages of 8, 12 Žtwo strains ., 16, 20 Žtwo strains . and 23 weeks as described in Section 2, together with cDNAs from fibroblasts from 2-day-old Ž 1204 ., 12-month-old Ž 1231., 14month-old Ž 842 . and 3-year-old Ž 1232 . males. The transcripts covering the 63-bp sequence in these cDNAs were amplified by PCR using primers 3A and 3B as described in the previous section. Electrophoresis of the amplified products ŽFig. 1B. showed that the longer 209-bp fragment was present as a single transcript in all the fetal cells, indicating that the 63-bp sequence was present in skin throughout development and that a regulatory event was not involved. A similar pattern was shown in early postnatal cells in which only a single transcript of 209 bp was amplified from newborn and young fibroblasts ŽFig. 1B.. 3.4. Characterization of the 63-bp sequence as an additional exon in the LH2 gene
Fig. 1. PCR amplification of region spanning the 63-bp sequence shows the variable expression of two transcripts in ŽA. different tissues and ŽB. from skin at different developmental stages. A short region covering the 63-bp sequence was amplified from cDNArRNA templates from different cell strains and tissues using primers 3A and 3B based on exon 13 and exon 14 as described in Section 2. The PCR products were electrophoresed on a 3% agarose gel. ŽA. The variable expression of two transcripts, 209 bp and 146 bp, in different cell strains and tissues is shown. All tissues expressed the 209-bp transcript, whereas the shorter 146-bp transcript was expressed only in frontal lobe, spleen, kidney, liver, placenta, and faintly in cartilage and chorionic villus. A single 209-bp transcript was amplified from dura, lung, aorta and skin. ŽB. cDNAs from fetal cell lines cultured from embryonic skin at gestational ages of 8, 12, 16, 20 and 23 weeks, and from dermal fibroblasts at 2 days, 12 months, 14 months and 3 years were amplified as described. Only a single fragment of 209 bp was amplified in the skin cells regardless of age. The 50-bp ladder is shown on the left of the gels. The 209- and 146-bp transcripts are indicated by arrows on the right of the gels.
able, ranging from high in kidney with a sequential decrease in spleen, liver, brain, and placenta. The shorter transcript could be barely detected in cartilage and chorionic villus. Restriction digests with MspI and direct sequencing of these fragments showed that the 209-bp transcript included the 63-bp sequence whereas it was not present in the 146-bp transcript amplified from the other cell lines. 3.3. Is expression of the 63-bp sequence de¨ elopmentally regulated? To determine whether this 63-bp sequence was developmentally regulated in skin, we isolated cDNAs from fetal cell lines Ž 1201 and 1225]1230 . cultured
To characterize this new sequence at the genomic level, we amplified ; 2.4 kb of predominantly intronic sequence, predicted to include this 63-bp sequence, from genomic DNA isolated from skin fibroblasts, placenta and spleen using primers 3A and 3B based on exons 13 and 14 of the originally-reported LH2 cDNA sequence, as described in Section 2. The identity of the gel-purified fragments was confirmed by a second amplification using nested primers 4A and 4B which amplified a slightly shorter Ž; 2.3 kb. fragment Ždata not shown.. The 2366-bp fragments amplified from skin and placental DNA using primers 3A and 3B were gel-purified and restricted with MspI to check for the presence of the 63-bp sequence. This was confirmed by gel-electrophoresis as shown in Fig. 2, in which both DNAs from skin and placenta were fully restricted by MspI to give fragments of 1310 and 1056 bp. Direct sequencing Žin both directions. of the entire 2.4 kb fragment amplified from skin fibroblasts verified the presence of the 63-bp sequence ŽFig. 3; GenBank accession number: AF085277.. Consensus gtrag donorracceptor splice-site junctions were identified in the intronic sequences located on either side of the 63-bp sequence that characterized it as a new exon, which we designated as exon 13A. A repetitive pyrimidine-rich sequence was located within the intron upstream of the 59 end of the new exon. Direct sequencing of genomic DNA from spleen and placenta gave an identical sequence that included exon 13A, with the exception of a region at the 39 end of the sequence that appeared to include approximately 100 overlapping bases. The placental DNA fragment was therefore cloned into pGEM using BamHIrXbaI restriction sites as described in Section 2. Sequencing of placental clones revealed an identical sequence to
184
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
Fig. 2. MspI restriction digest of amplified products spanning the 63-bp exon from skin and placental genomic DNA. 2366-bp products were amplified from skin and placental genomic DNA using primers 3A and 3B as described in Section 2. The gel-purified products were restricted with MspI and the restricted fragments were separated by electrophoresis on a 1% agarose gel together with an uncut fragment from skin. The arrows on the right of the gel show the size of the uncut DNA Ž2366 bp. and the restricted fragments Ž1310 and 1056 bp..
skin, apart from three single base pair changes Žt 1403 ª c, c 1822 ª t, t 2140 ª a.. These changes probably represented polymorphic differences as they were also present in the sequence from spleen. The intron sequence Ždesignated intron 13. between exons 13 and 13A was 1191 bp in length and the intron sequence Ždesignated intron 13A. between exons 13A and 14 was 966 bp. The combined size Ž2197 bp. of these introns is significantly larger than the reported size Ž780 bp. of intron 13 of the human LH1 gene ŽHeikkinen et al., 1994.. We used the consensus branch point sequence YNYTRAY win which A is invariant and Y s pyrimidine; Ns any base; Rs purine ŽKrainer and Maniatis, 1988; Maquat, 1996; Burrows et al., 1998.x, to identify overlapping branch sites in intron 13 beginning at nt 1218 Žggtcaac. and nt 1222 Žaacttac .. Although these sites had two mismatches to the consensus sequence, they were identified as the most likely branch points located 33 bp and 29 bp, respectively, upstream of the intronrexon
junction. Two other more distant overlapping putative branch point sites, each with one mismatch, were located 83 bp Žtttttat . and 79 bp Žtatttac . upstream from exon 13A and a perfect lariat branch site Žttttgat. was located 95 bp upstream Žnt 1156]1162. of the exon. In intron 13A, the most likely branch point site Žwith one mismatch. was located between nt 2251 and 2258 Žgattaat. located 29 bp from the acceptor splice junction of exon 14. The closest perfect lariat branch point sequence Žtcttgat. was located at a distant site 396 bp upstream of exon 14 between nt 1884 and 1890. The 63-bp sequence of exon 13A is predicted to code for a proline-rich sequence of 21 amino acids. Although this sequence has not been previously reported in any human LH cDNA sequences including LH1 ŽHautala et al., 1992., LH2 ŽValtavaara et al., 1997. or LH3 ŽPassoja et al., 1998b; Valtavaara et al., 1998. or in the LH1 cDNA sequences for rat ŽArmstrong and Last, 1995. and chick ŽMyllyla et al., 1991., or in the LH in C. elegans ŽPassoja et al., 1998b., a GenBank search has shown that this sequence has been reported in the data base of five expressed sequence tags. These are listed by accession number with their predicted identity to the 21 amino acid sequence as follows: N68601 and AA370532 Ž100% similarity; 21r21 residues.; T11367 Ž19r19 residues identical.; AA131546 and AA027960 Ž16r16 residues identical.. 4. Discussion In this study we have identified a novel 63-bp exon Žexon 13A. in the LH2 gene that is located between exons 13 and 14 of the originally-described LH2 gene. This exon was not identified in the previously-described cDNA of the LH2 gene Žin which exon 13 is spliced to exon 14. that was isolated from human kidney cells ŽValtavaara et al., 1997.. The newly-identified mRNA transcript Žin which exon 13 is spliced to exon 13A. encodes a 21 amino acid proline-rich se-
Fig. 3. Representation of skin genomic DNA sequence between exon 13 and exon 14 encompassing exon 13A and introns 13 and 13A. The exon bases are in bold caps above the line wbase 1 corresponds to base 1442 in the original reported sequence ŽValtavaara et al., 1997.x. Intronic sequences are in lower case. The predicted amino acid sequence is listed below the line. The consensus splice sites are underlined and the intronic sequences adjacent to the splice sites, including the pyrimidine-rich sequence upstream from exon 13A, are shown. Vertical arrows below the line delineate the exons and the beginning and end of the sequence. The MspI restriction site ŽCrCGG. used to identify exon 13A is underlined Ždashed..
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
quence that has not been previously reported in the genes for LH in any species. Using PCR amplification of cDNAs, we have shown that this exon is expressed in different tissues at variable levels that appear to be regulated by tissue-specific alternative splicing. The relatively low level of the exon 13A-containing transcript detected following amplification of a ; 200-bp fragment from kidney may explain the inability to amplify and isolate a full length Ž2.3 kb. cDNA transcript containing this exon from kidney cells. This report provides the first example of alternative RNA splicing in a lysyl hydroxylase gene and provides a mechanism for generating diversity in this family of genes, in which three isoforms have already been reported. Although we have never observed any abnormal splicing in the LH1 gene in dermal fibroblasts from a normal population, different splicing mutations have been reported in the LH1 gene from three patients with EDS VIA that are responsible for the decreased LH activity leading to their clinical symptoms. These mutations have resulted in the splicing out of exon 5 ŽYeowell and Walker, 1997. and the splicing out of exon 16 ŽPousi et al., 1998. in the LH1 gene in two compound heterozygous patients. In a third EDS VIA patient, a homozygous splicing mutation resulted in the deletion of exon 9 ŽPajunen et al., 1998.. We initially observed the presence of exon 13A-containing transcripts while screening for possible mutations in the LH2 gene in skin fibroblasts from two EDS VIB patients, who have clinical symptoms of EDS VI but normal LH activity. However, our original hypothesis that this exon retention may be a possible cause of EDS VIB was found to be incorrect when we observed this pattern of alternative splicing in the LH2 gene in all fibroblasts from a normal population. Although the alternative splicing reported in this study would be predicted to change the structure of the protein, it does not alter the reading frame of the DNA. The transcript containing exon 13A is lengthened by 63 bp and introduces a 21 amino acid proline-rich sequence into the LH2 enzyme ŽFig. 3.. This in-frame sequence insertion does not therefore interfere with the region at the carboxyl terminal that is especially well conserved between chicken and human LH1 with an identity of over 90% for the last 139 amino acids of the molecule ŽMyllyla et al., 1991; Hautala et al., 1992.. This region, which is also conserved between the three human LH isoforms ŽPassoja et al., 1998b., the LH1 from rat ŽArmstrong and Last, 1995. and the LH from C. elegans ŽPassoja et al., 1998b. is thought to contain the active site of the enzyme ŽMyllyla et al., 1992; Pirskanen et al., 1996.. Differential expression of specific domains within
185
extracellular matrix proteins and their related modifying enzymes may be important in development. In fibronectin, for example, it appears that alternative splicing may provide a mechanism for generating functionally distinct forms of the protein during development Žffrench-Constant and Hynes, 1988; Bennett et al., 1991.. We therefore examined the relative expression of the alternatively-spliced forms of LH2 in fetal fibroblasts between 8 and 23 weeks of gestation and compared their expression to newborn and young postnatal fibroblasts but found no detectable change in the expression pattern. Only the single longer transcript containing exon 13A was expressed in these cells and the alternative transcript lacking this exon could not be detected at any developmental stage. This could be a consequence of tissue-specific expression however, as only a single exon 13A-containing transcript for LH2 was expressed in a wide age-range of dermal fibroblasts from both normal donors and EDS VIA and EDS VIB patients. Although the cDNA sequence for LH2 isolated from kidney cells was reported for the LH2 transcript in which exon 13A was spliced out ŽValtavaara et al., 1997., the genomic sequence for LH2 has not been determined. We initially established the exonrintron structure between exons 13 and 14 of the LH2 gene in genomic DNA from skin fibroblasts and have confirmed the presence of a 63-bp open reading frame within this intronic sequence which we designated as exon 13A. A comparison of the genomic DNA sequences of this region of the LH2 gene from skin, spleen and placenta confirmed that the mRNA transcripts with and without exon 13A were generated from the same LH2 gene. We selected these tissues because, in contrast to skin in which only the exon 13A-containing transcript was expressed, placenta and spleen expressed both transcripts. Sequence analysis showed that exon 13A was present in each tissue and they had identical sequences apart from three apparently polymorphic single base changes within intron 13A. This confirmed that the two transcripts observed at the cDNA level in tissue from placenta and spleen, and presumably other tissues, were a consequence of tissue-specific alternative splicing occuring in transcripts from a single LH2 gene. In summary, we have identified a hitherto-unreported exon Žexon 13A. in the LH2 gene that we have shown to be expressed as the major LH2 transcript from an alternative RNA processing pathway. Although the function of this novel exon is unknown, we have shown that its expression is regulated in a tissue-specific pattern in which both transcripts, with and without exon 13A, are expressed in the majority of cells examined, with the exception of skin, lung,
186
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
dura and aorta in which only the exon 13A-containing transcript is expressed. The biological significance of two distinct LH2 forms synthesized by the same tissue remains to be determined. Acknowledgements This work has been supported in part by Research Grant AG10215 from the National Institute of Aging and by Research Grant AR17128 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases. References Armstrong, L.C., Last, J.A., 1995. Rat lysyl hydroxylase: molecular cloning, mRNA distribution and expression in a baculovirus system. Biochim. Biophys. Acta 1264, 93]102. Barnes, M.J., Constable, B.J., Morton, L.F., Royce, P.M., 1974. Age-related variations in hydroxylation of lysine and proline in collagen. Biochem. J. 139, 461]468. Bennett, V.D., Pallante, K.M., Adams, S.L., 1991. The splicing pattern of fibronectin mRNA changes during chondrogenesis in an unusual form of the mRNA in cartilage. J. Biol. Chem. 266, 5918]5924. Burrows, N.P., Nicholls, A.C., Richards, A.J., Luccarini, C., Harrison, J.B., Yates, J.R.W., Pope, F.M., 1998. A point mutation in an intronic branch site results in aberrant splicing of COL5A1 and in Ehlers]Danlos syndrome type II in two British families. Am. J. Hum. Genet. 63, 390]398. Chomczynski, P., Sacchi, N., 1987. Single step method for RNA isolation by acid guanidinium thiocyanate]phenol]chloroform extraction. Anal. Biochem. 162, 156]159. ffrench-Constant, C.L., Hynes, R.O., 1988. Alternative splicing of fibronectin is temporarily and spatially regulated in the chicken embryo. Development 106, 375]388. Gerriets, J.E., Curwin, S.L., Last, J.A., 1993. Tendon hypertrophy is associated with increased hydroxylation of nonhelical lysine residues at two specific cross-linking sites in type I collagen. J. Biol. Chem. 268, 25553]25560. Ha, V.T., Marshall, M.K., Elsas, L.J., Pinnell, S.R., Yeowell, H.N., 1994. A patient with Ehlers]Danlos syndrome type VI is a compound heterozygote for mutations in the lysyl hydroxylase gene. J. Clin. Invest. 93, 1716]1721. Hautala, T., Byers, M.G., Eddy, R.L., Shows, T.B., Kivirikko, K.I., Myllyla, R., 1992. Cloning of human lysyl hydroxylase: complete cDNA-derived amino acid sequence and assignment of the gene ŽPLOD. to chromosome 1p36.3 to p36.2. Genomics 13, 62]69. Hautala, T., Heikkinen, J., Kivirikko, K.I., Myllyla, R., 1993. A large duplication in the gene for lysyl hydroxylase accounts for the type VI variant of Ehlers]Danlos syndrome in two siblings. Genomics 15, 399]404. Heikkinen, J., Hautala, T., Kivirikko, K.I., Myllyla, R., 1994. Structure and expression of the human lysyl hydroxylase gene ŽPLOD.: introns 9 and 16 contain Alu sequences at the sites of recombination in Ehlers]Danlos syndrome type VI patients. Genomics 24, 464]471. Heikkinen, J., Toppinen, T., Yeowell, H.N., Krieg, T., Steinmann, B., Kivirikko, K.I., Myllyla, R., 1997. Duplication of seven exons in the lysyl hydroxylase gene is associated with longer forms of a repetitive sequence within the gene and is a common cause for
the type VI variant of Ehlers]Danlos syndrome. Am. J. Hum. Genet. 60, 48]56. Hyland, J., Ala-Kokko, L., Royce, P., Steinmann, B., Kivirikko, K.I., Myllyla, R., 1992. A homozygous stop codon in the lysyl hydroxylase gene in two siblings with Ehlers]Danlos syndrome type VI. Nat. Genet. 2, 228]231. Krainer, A.R., Maniatis, T., 1988. RNA splicing. In: Hames, B.D., Glover, D.M. ŽEds.., Transcription and Splicing. IRL Press, Oxford, pp. 131]206. Krol, B.J., Murad, S., Walker, L.C., Marshall, M.K., Clark, W.L., Pinnell, S.R., Yeowell, H.N., 1996. The expression of a functional, secreted human lysyl hydroxylase in a baculovirus system. J. Invest. Dermatol. 106, 11]16. Maquat, L.E., 1996. Defects in RNA splicing and the consequence of shortened translational reading frames. Am. J. Hum. Genet. 59, 279]286. Murad, S., Sivarajah, A., Pinnell, S.R., 1983. A comparison of lysyl hydroxylation in various types of collagen from type VI Ehlers]Danlos syndrome fibroblasts. Coll. Rel. Res. 3, 511]515. Myllyla, R., Pihlajaniemi, T., Pajunen, L., Turpeenniemi-Hujanen, T., Kivirikko, K.I., 1991. Molecular cloning of chick lysyl hydroxylase. J. Biol. Chem. 266, 2805]2810. Myllyla, R., Gunzler, V., Kivirikko, K.I., Kaska, D.D., 1992. Modification of vertebrate and algal prolyl-4 hydroxylases and vertebrate lysyl hydroxylase by diethyl pyrocarbonate. Biochem. J. 286, 923]927. Pajunen, L., Suokas, M., Hautala, T., Kellokumpu, S., Tebbe, B., Kivirikko, K.I., Myllyla, R., 1998. A splice-site mutation that induces exon skipping and reduction in lysyl hydroxylase mRNA levels but does not create a nonsense codon in Ehlers Danlos syndrome type VI. DNA Cell Biol. 17, 117]123. Passoja, K., Myllyharju, J., Pirskanen, A., Kivirikko, K.I., 1998a. Identification of arginine-700 as the residue that binds the C-5 carboxyl group of 2-oxoglutarate in human lysyl hydroxylase 1. FEBS 434, 145]148. Passoja, K., Rautavuoma, K., Ala-Kokko, L., Kosonen, T., Kivirikko, K.I., 1998b. Cloning and characterization of a third human lysyl hydroxylase isoform. Proc. Natl. Acad. Sci. USA 95, 10482]10486. Pirskanen, A., Kaimio, A.M., Myllyla, R., Kivirikko, K.I., 1996. Site-directed mutagenesis of human lysyl hydroxylase expressed in insect cells. J. Biol. Chem. 271, 9398]9402. Pousi, B., Hautala, T., Hyland, J., Schroter, J., Eckes, B., Kivirikko, K.I., Myllyla, R., 1998. A compound heterozygote patient with Ehlers]Danlos Syndrome type VI has a deletion in one allele and a splicing defect in the other allele of the lysyl hydroxylase gene. Hum. Mutat. 11, 55]61. Royce, P.M., Barnes, M.J., 1985. Failure of highly purified lysyl hydroxylase to hydroxylate lysyl residues in the non-helical regions of collagen. Biochem. J. 230, 475]480. Szpirer, C., Szpirer, J., Riviere, M., Vanvooren, P., Valtavaara, M., Myllyla, R., 1997. Localization of the gene encoding a novel isoform of lysyl hydroxylase. Mamm. Genome 8, 707]708. Valtavaara, M., Papponen, H., Pirttila, A.M., Hiltunen, K., Helander, H., Myllyla, R., 1997. Cloning and characterization of a novel human lysyl hydroxylase isoform highly expressed in pancreas and muscle. J. Biol. Chem. 272, 6831]6834. Valtavaara, M., Szpirer, C., Szpirer, J., Myllyla, R., 1998. Primary structure, tissue distribution, and chromosomal localization of a novel isoform of lysyl hydroxylase. J. Biol. Chem. 273, 12881]12886. Walker, L.C., Marini, J.C., Grange, D.K., Filie, J., Yeowell, H.N., 1998. A patient with Ehlers]Danlos syndrome type VI is homozygous for a premature termination codon in exon 14 of the lysyl hydroxylase gene. Mol. Genet. Metab. Žin press..
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187 Yeowell, H.N., Walker, L.C., 1997. Ehlers]Danlos Syndrome type VI results from a nonsense mutation and a splice site mediated exon-skipping mutation in the lysyl hydroxylase gene. Proc. Assoc. Am. Phys. 109, 1]14. Yeowell, H.N., Ha, V., Walker, L.C., Murad, S., Pinnell, S.R., 1992. Characterization of a partial cDNA for lysyl hydroxylase from human skin fibroblasts; lysyl hydroxylase mRNAs are regulated
187
differently by minoxidil derivatives and hydralazine. J. Invest. Dermatol. 99, 864]869. Yeowell, H.N., Ha, V.T., Clark, W.L., Marshall, M.K., Pinnell, S.R., 1994. Sequence analysis of a cDNA for lysyl hydroxylase isolated from human skin fibroblasts from a normal donor: differences from human placental lysyl hydroxylase cDNA. J. Invest. Dermatol. 102, 382]384.
Tissue specificity of a new splice form of the human lysyl hydroxylase 2 gene Heather N. Yeowell, Linda C. Walker Di¨ ision of Dermatology, Duke Uni¨ ersity Medical Center, Durham, NC 27710, USA Accepted 8 January 1999
Abstract In this study we present the first report of alternative RNA splicing in a gene for lysyl hydroxylase ŽLH. in a normal population. This splicing event, which we have observed in the LH2 gene, appears to be tissue specific. The LH2 isoform was recently cloned and sequenced from a human kidney cDNA library and predicted to encode a 737 amino acid protein. In the present study, we have isolated a cDNA for LH2 from human skin fibroblasts that codes for a protein of 758 amino acids, of which 21 amino acids are encoded by a new exon. This 63-bp exon, designated exon 13A, is located between exons 13 and 14 of the originally-described LH2 gene. Amplification of cDNAs by PCR, using primers from exons 13 and 14, showed the presence of two distinct LH2 mRNA populations. A 209-bp transcript was expressed in mRNAs isolated from all tissues examined and was the only transcript expressed in skin, lung, aorta and dura, whereas in mRNAs from spleen, cartilage, liver, kidney, frontal lobe and placenta, an additional shorter 146-bp transcript was amplified. DNA sequence analysis showed that these two mRNAs resulted from the alternative splicing of exon 13A. The transcript containing exon 13A is expressed as the major LH2 form in all tissues except kidney and spleen. Analysis of genomic DNA from skin, placenta and spleen showed that both transcripts were generated from the same LH2 gene. Both upstream Žintron 13. and downstream Žintron 13A. sequences bordering exon 13A had normal consensus sequences for the acceptor Žag. and donor Žgt. splice sites. Preliminary studies indicated that only single transcripts which included exon 13A were amplified from normal fetal skin at different stages of gestation. This suggests that although exon 13A is variably expressed in different tissues, this alternative splicing event is not developmentally regulated. Q 1999 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. Keywords: Lysyl hydroxylase isoforms; Alternative splicing; Differential exon expression; Tissue specificity; Developmental regulation
1. Introduction The existence of isoforms of LH has been proposed to explain that the hydroxylation of lysine residues within the helical region of type I collagen appeared distinct from the hydroxylation of lysine residues in the telopeptide region of the collagen gene and there-
Abbre¨ iations: bp, Base pair; EDS VI, Ehlers]Danlos syndrome type VI; kb, Kilobase; LH, Lysyl hydroxylase; nt, Nucleotide; PCR, Polymerase chain reaction
fore may be mediated by different enzymic forms of LH ŽBarnes et al., 1974; Royce and Barnes, 1985; Gerriets et al., 1993.. Until very recently, only one form of the post-translational modifying enzyme of collagen biosynthesis, lysyl hydroxylase Ždesignated LH1., had been characterized. The 40-kb gene for LH1 is located on chromosome 1 and includes 19 exons and an unusually large first intron of 12.5 kb ŽHeikkinen et al., 1994.. The introns are of high homology, generating many potential recombination sites within the gene. LH1 has an mRNA of 3.4 kb ŽHautala et al., 1992; Yeowell et al., 1992, 1994. that
0945-053Xr99r$ - see front matter Q 1999 Elsevier Science B.V.rInternational Society of Matrix Biology. All rights reserved. PII: S 0 9 4 5 - 0 5 3 X Ž 9 9 . 0 0 0 1 3 - X
180
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
codes for a protein of 709 amino acids Žaa. and a signal peptide of 18 aa ŽHautala et al., 1992.. The region between amino acids 639 and 715 is highly conserved Ž99%. between chick and human LH1 and may contain the active site of the enzyme. Northern blots show that the LH1 gene is strongly expressed in skin fibroblasts and placenta and, to a lesser extent, in aorta, lung, vein, cartilage and artery ŽYeowell et al., 1994.. An isoform of LH ŽLH2. has been recently isolated from cDNA libraries of human fetal kidney and human pancreas ŽValtavaara et al., 1997.. The open reading frame predicts a protein of 737 aa which includes an amino terminal signal peptide. The amino acid sequence has an overall similarity of 75% to the original LH1 and contains specific residues that are conserved in LH1 and thought to be important in the activity of the enzyme. These include five functionally important histidine residues, of which two may have a role in ferrous binding ŽMyllyla et al., 1992; Passoja et al., 1998a., and two aspartate residues in the carboxyl-terminal which, when mutated, cause a dramatic reduction in LH activity ŽPirskanen et al., 1996.. Ten cysteine residues are also conserved between LH1 and LH2 ŽValtavaara et al., 1997.. Northern analysis identifies a 4.2-kb mRNA that is highly expressed in pancreas, liver, placenta and heart ŽValtavaara et al., 1997.. The gene for LH2 has been localized to chromosome 3 ŽSzpirer et al., 1997., but no information is available on its genomic structure and therefore its exonrintron organization is unknown. A third isoform of LH ŽLH3. has also recently been isolated from kidney and liver libraries which has a high overall similarity to LH1 and LH2 at the amino acid level ŽPassoja et al., 1998b; Valtavaara et al., 1998.. The gene for LH3 has been localized to chromosome 7 ŽValtavaara et al., 1998.. The five histidine residues and the two aspartate residues identified as functionally important in LH1 and LH2 are also conserved in LH3. Two of the histidines and one of the aspartates that bind the ferrous ion ŽPirskanen et al., 1996. together with a conserved arginine that binds to a-ketoglutarate ŽPassoja et al., 1998a. have been recently identified as critical residues in the active site of the LH isoforms. Although their role in enzyme activity has not yet been reported ŽYeowell et al., manuscript in preparation., nine out of 10 cysteine residues are conserved between the three isoforms. The importance of LH is demonstrated in patients with Ehlers]Danlos syndrome type VI ŽEDS VI., whose clinical phenotype of hyperextensible joints and skin results from a deficiency of lysyl hydroxylase. These patients have been designated as EDS VIA. The deficiency of this enzyme, that is crucial for the crosslinking that gives collagen its tensile strength, has been shown to result from several different muta-
tions in the LH1 gene ŽHyland et al., 1992; Hautala et al., 1993; Ha et al., 1994; Heikkinen et al., 1997; Yeowell and Walker, 1997; Pajunen et al., 1998; Pousi et al., 1998; Walker et al., 1998.. A second category of patients Ždesignated EDS VIB. has been identified who, although they are characterized by the clinical characteristics of EDS VI, have normal levels of LH activity. To date, there has been no report of mutations in either the LH2 or LH3 gene that may be responsible for defective extracellular matrix. In the current study, we have identified a new 63-bp exonic sequence Žexon 13A. located between exons 13 and 14 of the LH2 gene that is expressed in all the tissues that we have examined. Although it is expressed as the only transcript in skin, aorta, dura and lung, two alternatively spliced transcripts, with and without exon 13A, are amplified in cDNAs from spleen, cartilage, liver, kidney, frontal lobe and placenta. These transcripts were shown to be generated from a single LH2 gene. We have shown that although this newly-described transcript is expressed as the major form in most tissues, the originally-described transcript is expressed strongly in certain tissues such as kidney and spleen. 2. Materials and methods 2.1. Cell strains and tissues Human fibroblast cell lines used in this research Žitalicized numbers. were obtained from the Coriell Institute for Medical Research, Camden, NJ. They include 1231, 12-month-old caucasian male ŽGM05399.; 842, 14-month-old caucasian male ŽGM05659 .; 1232, 3-year-old caucasian male ŽGM02938.; 1227, 8-week-old black male fetus ŽGM00011B.; 1228, 12-week-old black male fetus ŽGM1603B.; 1226, 16-week-old black female fetus ŽAG04451.; 1229, 20-week-old black male fetus ŽGM06170.; and 1230, 20-week-old white male fetus ŽGM05386B.. Two cell lines: 1201, 12-week-old black female fetus ŽCRL1502.; and 1225, 23-week-old black male fetus ŽCRL1475. were obtained from the American Type Culture Collection, Manassas, VA. Other human fibroblast cell lines that were cultured from biopsies are 1217 and 1162 Žindicated to be EDS VIB patients., and 1191 ŽEDS VIA.. Other types of cultured cells include: 1204, neonatal foreskin fibroblasts from 2-day-old male; 1212, aorta cells grown from biopsy; 1205, chorionic villus cells from 10 weeks gestation; and 1216, amniocytes from 14 weeks gestation. Tissues used include lung, spleen, frontal lobe, and dura obtained from a female donor and placental tissue from two donors. Kidney poly Aq RNA and liver cDNA were pur-
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
chased from Clontech ŽPalo Alto, CA.. The human fetal liver library and the cartilage cDNA library were graciously donated by Dr D. Fleenor ŽDuke University Medical Center. and Dr Y. Yamada ŽNIH., respectively. 2.2. Cell culture Fibroblast cells from skin and aorta were grown to confluency as described ŽMurad et al., 1983. using Dulbecco’s Modified Eagle’s Medium ŽDMEM. ŽGibco BRL, Rockville, MD. supplemented with 20% heat-inactivated calf serum ŽGibco BRL.. The amniocytes and chorionic villus cells were grown in AmnioMax media ŽGibco BRL.. 2.3. Total RNA isolation 2.3.1. Cells Total RNA was prepared from chorionic villus cells, amniocytes, and fibroblasts from skin and aorta, using the guanidine isothiocyanateracid-phenol method described by Chomczynski and Sacchi Ž1987.. The amount of starting material was approximately 6 = 10 6 cells per sample. 2.3.2. Human tissues Total RNA was prepared from the tissues Žlung, spleen, frontal lobe, dura. of a female donor and from the placenta of two other donors using 5.4 ml of guanidinium thiocyanate per 1 g of tissue which had been pulverized using a mortar and pestle cooled with liquid nitrogen. 2.4. Preparation of cDNAs from different cell lines and tissues for PCR Poly Aq RNA was isolated directly from dermal fibroblasts Ž 842, 1217, 1162, and 1191. and aorta Ž 1212 ., chorionic villus Ž 1205 ., and amniocytes Ž 1216 . using approximately 1]2 = 10 6 cells per each isolation ŽMicro-FastTrack kit, Invitrogen, Carlsbad, CA.. Poly Aq RNA from kidney was obtained from Clontech. Either first strand cDNA was synthesized using the Superscript II system ŽGibco-BRL. or, alternatively, RT-PCR was performed directly on these poly Aq RNAs and on total RNA from dermal fibroblast cell lines Ž 1204, 1231, 1232 . and fetal fibroblast cell lines Ž 1201, 1225, 1226, 1227, 1228, 1229, 1230 . and from lung, spleen, frontal lobe, dura, aorta, and placenta using the SuperScript One-Step RT-PCR system ŽGibco BRL. according to manufacturer’s instructions. PCR was performed directly on cDNA libraries from human cartilage and fetal liver. 2.5. Primers The following primers were selected from regions
181
of the cDNA sequence of LH2 ŽValtavaara et al., 1997. that were dissimilar to the sequences of LH1 and LH3 cDNAs ŽHautala et al., 1992; Valtavaara et al., 1998.. 1A: ATGCACGGTGAAGCCTCAGCT Žnt 9]29.; 1B: ACGTGTTCATGCCAGTCATTCA Žnt 2252] 2273.; 2B: GCAGACAAGTCGACTGTATCG Žnt 852] 872.; 3A: CTCCGATCAGAGATGAATG Žnt 1414]1432.; 3B: ATTAGCAGTGGATAATAGCC Žnt 1541] 1560.; 3C: GCTCTAGA ATTAGCAGTGGATAATAGCC Žnt 1541]1560.; 4A: GGAACTATTTTGTTCGTGAT Žnt 1436] 1455.; and 4B: TGTCTATTAGAAATGTACATAA Žnt 1508] 1529.. The A and B primers are based on the sense and complementary strands, respectively. Primer 3C is identical to 3B with the addition of an XbaI site Žshown in italics .. 2.6. PCR amplification conditions for LH2 cDNAs 2.6.1. Full length coding region of LH2 The ; 2.3-kb full length coding region for LH2 cDNAs, prepared from skin fibroblast cell lines Ž 842, 1216, 1217, 1162, and 1191., and aorta, lung and kidney as described above, were amplified using primers 1A and 1B. The PCR reaction was in a final volume of 50 m l under conditions as previously described ŽKrol et al., 1996. using an annealing temperature of 588C. The cDNA products were electrophoresed on a 1% agarose gel, excised, and purified using QIAquick gel extraction kit ŽQiagen, Hilden, Germany.. The gel-purified products were directly sequenced at the ICBRrDNA Sequencing Facility, University of Florida, Gainesville, FL. 2.6.2. Amplification of short region of cDNA encompassing new exon Using primers 3A and 3B, the cDNA fragments spanning the region between nt 1414 and 1560 were amplified from cDNA or RNA templates isolated as described above. These included the fetal and postnatal dermal fibroblast cell lines, aorta, dura, lung, placenta, spleen, cartilage, kidney, frontal lobe, liver and chorionic villus cells. The PCR conditions were as previously described, using an annealing temperature of 518C. For RT-PCR, a reverse-transcription cycle at 508C for 30 min and 948C for 2 min was added prior to the PCR reaction. The products were separated
182
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
electrophoretically on a 3% Agarose-1000 gel ŽGibco BRL., and following gel purification, were directly sequenced. 2.7. PCR amplification and sequencing of region between exons 13 and 14 from genomic DNA isolated from skin fibroblasts, spleen and placenta Genomic DNA was isolated from skin fibroblasts using 6]10 = 10 6 cellsrsample and from placental and spleen tissues ŽQIAamp kit for genomic extraction from cells and tissues, Qiagen., according to manufacturer’s protocols. DNA fragments of 2.4 kb between exon 13 and exon 14 were amplified from these genomic DNAs as described ŽYeowell and Walker, 1997.. Amplification was performed in a 50-m l reaction volume containing 200 ng genomic DNA, 300 ng of primers 3A and 3B described above, 250 m M of each deoxynucleotide, 1.5 mM Mg 2q, 50 mM KCl, 10 mM Tris]HCl pH 8.3, and 2.5 units Taq DNA polymerase ŽBoehringer Mannheim.. The reaction mixture was denatured at 948C for 4 min, annealed at 578C for 1 min and the extension carried out at 728C for 1 min. The annealing temperature was decreased by 28C every two cycles three times and was maintained at 518C for the final 35 cycles. Following gel purification, the identity of the 2.4-kb sequences was confirmed by reamplification using nested primers 4A and 4B. Using touchdown PCR with an initial annealing temperature of 558C, the reaction was maintained at 498C for the final 35 cycles. The gel-purified 2.4-kb fragments from the PCR using primers 3A and 3B were analyzed by direct sequencing ŽGenBank accession number: AF085277.. 2.8. Cloning of 2.4-kb fragment from placental genomic DNA The 2.4-kb fragment from placental genomic DNA was amplified by PCR using primer 3A and the complementary primer 3C which had been modified from 3B by adding an XbaI restriction site to the 59 end. The PCR conditions were as described for primers 3A and 3B. Following gel-purification, the fragment was restricted with BamHI Ža unique BamHI restriction site is present 20 bases from the 59 end of the sequence. and XbaI prior to gel-purification and ligation into a similarly restricted pGEM-3ZfŽq. vector ŽPromega, Madison, WI.. Following transformation into E. coli DH5a competent cells, a positive clone was selected, maxi-prepped ŽQiagen., and sequenced at the ICBRrDNA sequencing facility. 2.9. MspI restriction The amplified, gel-purified 2.4-kb genomic fragments from skin and placenta were subjected to re-
striction site analysis with MspI. Following elution into water from the QIAquick gel purification column ŽQiagen., the sample was restricted with MspI according to manufacturer’s instructions ŽBoehringer Mannheim, Indianapolis, IN. at 378C. The restricted samples were run on a 1% agarose gel together with an uncut fragment from skin. 3. Results 3.1. Sequence comparison of full length cDNAs for LH2 from different tissues The complete coding region of LH2 from cDNAs isolated from each of the human skin fibroblast cell lines, aorta cells and lung was amplified by PCR using primers 1A and 1B as described in Section 2. Direct sequencing Žin both directions. of the gel-purified 2.3-kb PCR products showed them to be identical to each other. Each cDNA had an identical in-frame 63-bp sequence insertion at nt 1500 wbased on the numbering of the originally-described sequence of LH2 cDNA isolated from human kidney and pancreas cDNA libraries ŽValtavaara et al., 1997.x. Apart from this 63-bp insertion, the sequences were identical to the previously-reported sequence. Although the genomic sequence for LH2 has not been reported, from a comparison with the genomic sequence of the LH1 gene ŽHeikkinen et al., 1994., we determined that this novel sequence was inserted at the junction of exons 13 and 14. This sequence introduced a new MspI site into LH2 cDNA which enabled us to check additional cDNAs for the presence of this sequence. The cDNA for the coding region of LH2 was similarly amplified from kidney. Sequence analysis of the full length LH2 kidney cDNA showed a lack of the 63-bp insert identified in skin cDNA. This concurred with the previously reported sequence of LH2 kidney cDNA ŽValtavaara et al., 1997.. 3.2. Differential expression of 63-bp sequence in different tissues We then used primers Ž3A and 3B. based on exon 13 and exon 14 that spanned the region between nt 1414 and 1520 to amplify a short region of LH2 cDNA encompassing this 63-bp sequence from each of the cell lines as described in Section 2. The PCR products were separated by electrophoresis as shown in Fig. 1A. Only a single 209-bp transcript was amplified from skin, dura, aorta and lung, whereas in addition to the 209-bp fragment, a shorter 146-bp transcript was amplified from kidney, liver, spleen, cartilage, frontal lobe, chorionic villus and placenta. Within the limits of the PCR, the ratio of expression of the shorter to the longer transcript appeared highly vari-
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
183
from embryonic skin at gestational ages of 8, 12 Žtwo strains ., 16, 20 Žtwo strains . and 23 weeks as described in Section 2, together with cDNAs from fibroblasts from 2-day-old Ž 1204 ., 12-month-old Ž 1231., 14month-old Ž 842 . and 3-year-old Ž 1232 . males. The transcripts covering the 63-bp sequence in these cDNAs were amplified by PCR using primers 3A and 3B as described in the previous section. Electrophoresis of the amplified products ŽFig. 1B. showed that the longer 209-bp fragment was present as a single transcript in all the fetal cells, indicating that the 63-bp sequence was present in skin throughout development and that a regulatory event was not involved. A similar pattern was shown in early postnatal cells in which only a single transcript of 209 bp was amplified from newborn and young fibroblasts ŽFig. 1B.. 3.4. Characterization of the 63-bp sequence as an additional exon in the LH2 gene
Fig. 1. PCR amplification of region spanning the 63-bp sequence shows the variable expression of two transcripts in ŽA. different tissues and ŽB. from skin at different developmental stages. A short region covering the 63-bp sequence was amplified from cDNArRNA templates from different cell strains and tissues using primers 3A and 3B based on exon 13 and exon 14 as described in Section 2. The PCR products were electrophoresed on a 3% agarose gel. ŽA. The variable expression of two transcripts, 209 bp and 146 bp, in different cell strains and tissues is shown. All tissues expressed the 209-bp transcript, whereas the shorter 146-bp transcript was expressed only in frontal lobe, spleen, kidney, liver, placenta, and faintly in cartilage and chorionic villus. A single 209-bp transcript was amplified from dura, lung, aorta and skin. ŽB. cDNAs from fetal cell lines cultured from embryonic skin at gestational ages of 8, 12, 16, 20 and 23 weeks, and from dermal fibroblasts at 2 days, 12 months, 14 months and 3 years were amplified as described. Only a single fragment of 209 bp was amplified in the skin cells regardless of age. The 50-bp ladder is shown on the left of the gels. The 209- and 146-bp transcripts are indicated by arrows on the right of the gels.
able, ranging from high in kidney with a sequential decrease in spleen, liver, brain, and placenta. The shorter transcript could be barely detected in cartilage and chorionic villus. Restriction digests with MspI and direct sequencing of these fragments showed that the 209-bp transcript included the 63-bp sequence whereas it was not present in the 146-bp transcript amplified from the other cell lines. 3.3. Is expression of the 63-bp sequence de¨ elopmentally regulated? To determine whether this 63-bp sequence was developmentally regulated in skin, we isolated cDNAs from fetal cell lines Ž 1201 and 1225]1230 . cultured
To characterize this new sequence at the genomic level, we amplified ; 2.4 kb of predominantly intronic sequence, predicted to include this 63-bp sequence, from genomic DNA isolated from skin fibroblasts, placenta and spleen using primers 3A and 3B based on exons 13 and 14 of the originally-reported LH2 cDNA sequence, as described in Section 2. The identity of the gel-purified fragments was confirmed by a second amplification using nested primers 4A and 4B which amplified a slightly shorter Ž; 2.3 kb. fragment Ždata not shown.. The 2366-bp fragments amplified from skin and placental DNA using primers 3A and 3B were gel-purified and restricted with MspI to check for the presence of the 63-bp sequence. This was confirmed by gel-electrophoresis as shown in Fig. 2, in which both DNAs from skin and placenta were fully restricted by MspI to give fragments of 1310 and 1056 bp. Direct sequencing Žin both directions. of the entire 2.4 kb fragment amplified from skin fibroblasts verified the presence of the 63-bp sequence ŽFig. 3; GenBank accession number: AF085277.. Consensus gtrag donorracceptor splice-site junctions were identified in the intronic sequences located on either side of the 63-bp sequence that characterized it as a new exon, which we designated as exon 13A. A repetitive pyrimidine-rich sequence was located within the intron upstream of the 59 end of the new exon. Direct sequencing of genomic DNA from spleen and placenta gave an identical sequence that included exon 13A, with the exception of a region at the 39 end of the sequence that appeared to include approximately 100 overlapping bases. The placental DNA fragment was therefore cloned into pGEM using BamHIrXbaI restriction sites as described in Section 2. Sequencing of placental clones revealed an identical sequence to
184
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
Fig. 2. MspI restriction digest of amplified products spanning the 63-bp exon from skin and placental genomic DNA. 2366-bp products were amplified from skin and placental genomic DNA using primers 3A and 3B as described in Section 2. The gel-purified products were restricted with MspI and the restricted fragments were separated by electrophoresis on a 1% agarose gel together with an uncut fragment from skin. The arrows on the right of the gel show the size of the uncut DNA Ž2366 bp. and the restricted fragments Ž1310 and 1056 bp..
skin, apart from three single base pair changes Žt 1403 ª c, c 1822 ª t, t 2140 ª a.. These changes probably represented polymorphic differences as they were also present in the sequence from spleen. The intron sequence Ždesignated intron 13. between exons 13 and 13A was 1191 bp in length and the intron sequence Ždesignated intron 13A. between exons 13A and 14 was 966 bp. The combined size Ž2197 bp. of these introns is significantly larger than the reported size Ž780 bp. of intron 13 of the human LH1 gene ŽHeikkinen et al., 1994.. We used the consensus branch point sequence YNYTRAY win which A is invariant and Y s pyrimidine; Ns any base; Rs purine ŽKrainer and Maniatis, 1988; Maquat, 1996; Burrows et al., 1998.x, to identify overlapping branch sites in intron 13 beginning at nt 1218 Žggtcaac. and nt 1222 Žaacttac .. Although these sites had two mismatches to the consensus sequence, they were identified as the most likely branch points located 33 bp and 29 bp, respectively, upstream of the intronrexon
junction. Two other more distant overlapping putative branch point sites, each with one mismatch, were located 83 bp Žtttttat . and 79 bp Žtatttac . upstream from exon 13A and a perfect lariat branch site Žttttgat. was located 95 bp upstream Žnt 1156]1162. of the exon. In intron 13A, the most likely branch point site Žwith one mismatch. was located between nt 2251 and 2258 Žgattaat. located 29 bp from the acceptor splice junction of exon 14. The closest perfect lariat branch point sequence Žtcttgat. was located at a distant site 396 bp upstream of exon 14 between nt 1884 and 1890. The 63-bp sequence of exon 13A is predicted to code for a proline-rich sequence of 21 amino acids. Although this sequence has not been previously reported in any human LH cDNA sequences including LH1 ŽHautala et al., 1992., LH2 ŽValtavaara et al., 1997. or LH3 ŽPassoja et al., 1998b; Valtavaara et al., 1998. or in the LH1 cDNA sequences for rat ŽArmstrong and Last, 1995. and chick ŽMyllyla et al., 1991., or in the LH in C. elegans ŽPassoja et al., 1998b., a GenBank search has shown that this sequence has been reported in the data base of five expressed sequence tags. These are listed by accession number with their predicted identity to the 21 amino acid sequence as follows: N68601 and AA370532 Ž100% similarity; 21r21 residues.; T11367 Ž19r19 residues identical.; AA131546 and AA027960 Ž16r16 residues identical.. 4. Discussion In this study we have identified a novel 63-bp exon Žexon 13A. in the LH2 gene that is located between exons 13 and 14 of the originally-described LH2 gene. This exon was not identified in the previously-described cDNA of the LH2 gene Žin which exon 13 is spliced to exon 14. that was isolated from human kidney cells ŽValtavaara et al., 1997.. The newly-identified mRNA transcript Žin which exon 13 is spliced to exon 13A. encodes a 21 amino acid proline-rich se-
Fig. 3. Representation of skin genomic DNA sequence between exon 13 and exon 14 encompassing exon 13A and introns 13 and 13A. The exon bases are in bold caps above the line wbase 1 corresponds to base 1442 in the original reported sequence ŽValtavaara et al., 1997.x. Intronic sequences are in lower case. The predicted amino acid sequence is listed below the line. The consensus splice sites are underlined and the intronic sequences adjacent to the splice sites, including the pyrimidine-rich sequence upstream from exon 13A, are shown. Vertical arrows below the line delineate the exons and the beginning and end of the sequence. The MspI restriction site ŽCrCGG. used to identify exon 13A is underlined Ždashed..
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
quence that has not been previously reported in the genes for LH in any species. Using PCR amplification of cDNAs, we have shown that this exon is expressed in different tissues at variable levels that appear to be regulated by tissue-specific alternative splicing. The relatively low level of the exon 13A-containing transcript detected following amplification of a ; 200-bp fragment from kidney may explain the inability to amplify and isolate a full length Ž2.3 kb. cDNA transcript containing this exon from kidney cells. This report provides the first example of alternative RNA splicing in a lysyl hydroxylase gene and provides a mechanism for generating diversity in this family of genes, in which three isoforms have already been reported. Although we have never observed any abnormal splicing in the LH1 gene in dermal fibroblasts from a normal population, different splicing mutations have been reported in the LH1 gene from three patients with EDS VIA that are responsible for the decreased LH activity leading to their clinical symptoms. These mutations have resulted in the splicing out of exon 5 ŽYeowell and Walker, 1997. and the splicing out of exon 16 ŽPousi et al., 1998. in the LH1 gene in two compound heterozygous patients. In a third EDS VIA patient, a homozygous splicing mutation resulted in the deletion of exon 9 ŽPajunen et al., 1998.. We initially observed the presence of exon 13A-containing transcripts while screening for possible mutations in the LH2 gene in skin fibroblasts from two EDS VIB patients, who have clinical symptoms of EDS VI but normal LH activity. However, our original hypothesis that this exon retention may be a possible cause of EDS VIB was found to be incorrect when we observed this pattern of alternative splicing in the LH2 gene in all fibroblasts from a normal population. Although the alternative splicing reported in this study would be predicted to change the structure of the protein, it does not alter the reading frame of the DNA. The transcript containing exon 13A is lengthened by 63 bp and introduces a 21 amino acid proline-rich sequence into the LH2 enzyme ŽFig. 3.. This in-frame sequence insertion does not therefore interfere with the region at the carboxyl terminal that is especially well conserved between chicken and human LH1 with an identity of over 90% for the last 139 amino acids of the molecule ŽMyllyla et al., 1991; Hautala et al., 1992.. This region, which is also conserved between the three human LH isoforms ŽPassoja et al., 1998b., the LH1 from rat ŽArmstrong and Last, 1995. and the LH from C. elegans ŽPassoja et al., 1998b. is thought to contain the active site of the enzyme ŽMyllyla et al., 1992; Pirskanen et al., 1996.. Differential expression of specific domains within
185
extracellular matrix proteins and their related modifying enzymes may be important in development. In fibronectin, for example, it appears that alternative splicing may provide a mechanism for generating functionally distinct forms of the protein during development Žffrench-Constant and Hynes, 1988; Bennett et al., 1991.. We therefore examined the relative expression of the alternatively-spliced forms of LH2 in fetal fibroblasts between 8 and 23 weeks of gestation and compared their expression to newborn and young postnatal fibroblasts but found no detectable change in the expression pattern. Only the single longer transcript containing exon 13A was expressed in these cells and the alternative transcript lacking this exon could not be detected at any developmental stage. This could be a consequence of tissue-specific expression however, as only a single exon 13A-containing transcript for LH2 was expressed in a wide age-range of dermal fibroblasts from both normal donors and EDS VIA and EDS VIB patients. Although the cDNA sequence for LH2 isolated from kidney cells was reported for the LH2 transcript in which exon 13A was spliced out ŽValtavaara et al., 1997., the genomic sequence for LH2 has not been determined. We initially established the exonrintron structure between exons 13 and 14 of the LH2 gene in genomic DNA from skin fibroblasts and have confirmed the presence of a 63-bp open reading frame within this intronic sequence which we designated as exon 13A. A comparison of the genomic DNA sequences of this region of the LH2 gene from skin, spleen and placenta confirmed that the mRNA transcripts with and without exon 13A were generated from the same LH2 gene. We selected these tissues because, in contrast to skin in which only the exon 13A-containing transcript was expressed, placenta and spleen expressed both transcripts. Sequence analysis showed that exon 13A was present in each tissue and they had identical sequences apart from three apparently polymorphic single base changes within intron 13A. This confirmed that the two transcripts observed at the cDNA level in tissue from placenta and spleen, and presumably other tissues, were a consequence of tissue-specific alternative splicing occuring in transcripts from a single LH2 gene. In summary, we have identified a hitherto-unreported exon Žexon 13A. in the LH2 gene that we have shown to be expressed as the major LH2 transcript from an alternative RNA processing pathway. Although the function of this novel exon is unknown, we have shown that its expression is regulated in a tissue-specific pattern in which both transcripts, with and without exon 13A, are expressed in the majority of cells examined, with the exception of skin, lung,
186
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187
dura and aorta in which only the exon 13A-containing transcript is expressed. The biological significance of two distinct LH2 forms synthesized by the same tissue remains to be determined. Acknowledgements This work has been supported in part by Research Grant AG10215 from the National Institute of Aging and by Research Grant AR17128 from the National Institute of Arthritis and Musculoskeletal and Skin Diseases. References Armstrong, L.C., Last, J.A., 1995. Rat lysyl hydroxylase: molecular cloning, mRNA distribution and expression in a baculovirus system. Biochim. Biophys. Acta 1264, 93]102. Barnes, M.J., Constable, B.J., Morton, L.F., Royce, P.M., 1974. Age-related variations in hydroxylation of lysine and proline in collagen. Biochem. J. 139, 461]468. Bennett, V.D., Pallante, K.M., Adams, S.L., 1991. The splicing pattern of fibronectin mRNA changes during chondrogenesis in an unusual form of the mRNA in cartilage. J. Biol. Chem. 266, 5918]5924. Burrows, N.P., Nicholls, A.C., Richards, A.J., Luccarini, C., Harrison, J.B., Yates, J.R.W., Pope, F.M., 1998. A point mutation in an intronic branch site results in aberrant splicing of COL5A1 and in Ehlers]Danlos syndrome type II in two British families. Am. J. Hum. Genet. 63, 390]398. Chomczynski, P., Sacchi, N., 1987. Single step method for RNA isolation by acid guanidinium thiocyanate]phenol]chloroform extraction. Anal. Biochem. 162, 156]159. ffrench-Constant, C.L., Hynes, R.O., 1988. Alternative splicing of fibronectin is temporarily and spatially regulated in the chicken embryo. Development 106, 375]388. Gerriets, J.E., Curwin, S.L., Last, J.A., 1993. Tendon hypertrophy is associated with increased hydroxylation of nonhelical lysine residues at two specific cross-linking sites in type I collagen. J. Biol. Chem. 268, 25553]25560. Ha, V.T., Marshall, M.K., Elsas, L.J., Pinnell, S.R., Yeowell, H.N., 1994. A patient with Ehlers]Danlos syndrome type VI is a compound heterozygote for mutations in the lysyl hydroxylase gene. J. Clin. Invest. 93, 1716]1721. Hautala, T., Byers, M.G., Eddy, R.L., Shows, T.B., Kivirikko, K.I., Myllyla, R., 1992. Cloning of human lysyl hydroxylase: complete cDNA-derived amino acid sequence and assignment of the gene ŽPLOD. to chromosome 1p36.3 to p36.2. Genomics 13, 62]69. Hautala, T., Heikkinen, J., Kivirikko, K.I., Myllyla, R., 1993. A large duplication in the gene for lysyl hydroxylase accounts for the type VI variant of Ehlers]Danlos syndrome in two siblings. Genomics 15, 399]404. Heikkinen, J., Hautala, T., Kivirikko, K.I., Myllyla, R., 1994. Structure and expression of the human lysyl hydroxylase gene ŽPLOD.: introns 9 and 16 contain Alu sequences at the sites of recombination in Ehlers]Danlos syndrome type VI patients. Genomics 24, 464]471. Heikkinen, J., Toppinen, T., Yeowell, H.N., Krieg, T., Steinmann, B., Kivirikko, K.I., Myllyla, R., 1997. Duplication of seven exons in the lysyl hydroxylase gene is associated with longer forms of a repetitive sequence within the gene and is a common cause for
the type VI variant of Ehlers]Danlos syndrome. Am. J. Hum. Genet. 60, 48]56. Hyland, J., Ala-Kokko, L., Royce, P., Steinmann, B., Kivirikko, K.I., Myllyla, R., 1992. A homozygous stop codon in the lysyl hydroxylase gene in two siblings with Ehlers]Danlos syndrome type VI. Nat. Genet. 2, 228]231. Krainer, A.R., Maniatis, T., 1988. RNA splicing. In: Hames, B.D., Glover, D.M. ŽEds.., Transcription and Splicing. IRL Press, Oxford, pp. 131]206. Krol, B.J., Murad, S., Walker, L.C., Marshall, M.K., Clark, W.L., Pinnell, S.R., Yeowell, H.N., 1996. The expression of a functional, secreted human lysyl hydroxylase in a baculovirus system. J. Invest. Dermatol. 106, 11]16. Maquat, L.E., 1996. Defects in RNA splicing and the consequence of shortened translational reading frames. Am. J. Hum. Genet. 59, 279]286. Murad, S., Sivarajah, A., Pinnell, S.R., 1983. A comparison of lysyl hydroxylation in various types of collagen from type VI Ehlers]Danlos syndrome fibroblasts. Coll. Rel. Res. 3, 511]515. Myllyla, R., Pihlajaniemi, T., Pajunen, L., Turpeenniemi-Hujanen, T., Kivirikko, K.I., 1991. Molecular cloning of chick lysyl hydroxylase. J. Biol. Chem. 266, 2805]2810. Myllyla, R., Gunzler, V., Kivirikko, K.I., Kaska, D.D., 1992. Modification of vertebrate and algal prolyl-4 hydroxylases and vertebrate lysyl hydroxylase by diethyl pyrocarbonate. Biochem. J. 286, 923]927. Pajunen, L., Suokas, M., Hautala, T., Kellokumpu, S., Tebbe, B., Kivirikko, K.I., Myllyla, R., 1998. A splice-site mutation that induces exon skipping and reduction in lysyl hydroxylase mRNA levels but does not create a nonsense codon in Ehlers Danlos syndrome type VI. DNA Cell Biol. 17, 117]123. Passoja, K., Myllyharju, J., Pirskanen, A., Kivirikko, K.I., 1998a. Identification of arginine-700 as the residue that binds the C-5 carboxyl group of 2-oxoglutarate in human lysyl hydroxylase 1. FEBS 434, 145]148. Passoja, K., Rautavuoma, K., Ala-Kokko, L., Kosonen, T., Kivirikko, K.I., 1998b. Cloning and characterization of a third human lysyl hydroxylase isoform. Proc. Natl. Acad. Sci. USA 95, 10482]10486. Pirskanen, A., Kaimio, A.M., Myllyla, R., Kivirikko, K.I., 1996. Site-directed mutagenesis of human lysyl hydroxylase expressed in insect cells. J. Biol. Chem. 271, 9398]9402. Pousi, B., Hautala, T., Hyland, J., Schroter, J., Eckes, B., Kivirikko, K.I., Myllyla, R., 1998. A compound heterozygote patient with Ehlers]Danlos Syndrome type VI has a deletion in one allele and a splicing defect in the other allele of the lysyl hydroxylase gene. Hum. Mutat. 11, 55]61. Royce, P.M., Barnes, M.J., 1985. Failure of highly purified lysyl hydroxylase to hydroxylate lysyl residues in the non-helical regions of collagen. Biochem. J. 230, 475]480. Szpirer, C., Szpirer, J., Riviere, M., Vanvooren, P., Valtavaara, M., Myllyla, R., 1997. Localization of the gene encoding a novel isoform of lysyl hydroxylase. Mamm. Genome 8, 707]708. Valtavaara, M., Papponen, H., Pirttila, A.M., Hiltunen, K., Helander, H., Myllyla, R., 1997. Cloning and characterization of a novel human lysyl hydroxylase isoform highly expressed in pancreas and muscle. J. Biol. Chem. 272, 6831]6834. Valtavaara, M., Szpirer, C., Szpirer, J., Myllyla, R., 1998. Primary structure, tissue distribution, and chromosomal localization of a novel isoform of lysyl hydroxylase. J. Biol. Chem. 273, 12881]12886. Walker, L.C., Marini, J.C., Grange, D.K., Filie, J., Yeowell, H.N., 1998. A patient with Ehlers]Danlos syndrome type VI is homozygous for a premature termination codon in exon 14 of the lysyl hydroxylase gene. Mol. Genet. Metab. Žin press..
H.N. Yeowell, L.C. Walker r Matrix Biology 18 (1999) 179]187 Yeowell, H.N., Walker, L.C., 1997. Ehlers]Danlos Syndrome type VI results from a nonsense mutation and a splice site mediated exon-skipping mutation in the lysyl hydroxylase gene. Proc. Assoc. Am. Phys. 109, 1]14. Yeowell, H.N., Ha, V., Walker, L.C., Murad, S., Pinnell, S.R., 1992. Characterization of a partial cDNA for lysyl hydroxylase from human skin fibroblasts; lysyl hydroxylase mRNAs are regulated
187
differently by minoxidil derivatives and hydralazine. J. Invest. Dermatol. 99, 864]869. Yeowell, H.N., Ha, V.T., Clark, W.L., Marshall, M.K., Pinnell, S.R., 1994. Sequence analysis of a cDNA for lysyl hydroxylase isolated from human skin fibroblasts from a normal donor: differences from human placental lysyl hydroxylase cDNA. J. Invest. Dermatol. 102, 382]384.