Tomato WRKY81 acts as a negative regulator for drought tolerance by modulating guard cell H2O2–mediated stomatal closure

Journal Pre-proof Tomato WRKY81 acts as a negative regulator for drought tolerance by modulating guard cell H2 O2 –mediated stomatal closure Golam Jalal Ahammed, Xin Li, Youxin Yang, Chaochao Liu, Guozhi Zhou, Hongjian Wan, Yuan Cheng

PII:

S0098-8472(19)31557-6

DOI:

https://doi.org/10.1016/j.envexpbot.2019.103960

Reference:

EEB 103960

To appear in:

Environmental and Experimental Botany

Received Date:

15 September 2019

Revised Date:

28 October 2019

Accepted Date:

27 November 2019

Please cite this article as: Ahammed GJ, Li X, Yang Y, Liu C, Zhou G, Wan H, Cheng Y, Tomato WRKY81 acts as a negative regulator for drought tolerance by modulating guard cell H2 O2 –mediated stomatal closure, Environmental and Experimental Botany (2019), doi: https://doi.org/10.1016/j.envexpbot.2019.103960

This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. © 2019 Published by Elsevier.

Tomato WRKY81 acts as a negative regulator for drought tolerance by modulating guard cell H2O2–mediated stomatal closure Running title: SlWRKY81 regulates drought tolerance in tomato

Golam Jalal Ahammed1, Xin Li2, Youxin Yang3, Chaochao Liu4, Guozhi Zhou5, Hongjian Wan5, Yuan Cheng5,* College of Forestry, Henan University of Science and Technology, Luoyang, 471023, PR China

2

Key Laboratory of Tea Quality and Safety Control, Ministry of Agriculture, Tea Research Institute,

ro

of

1

Chinese Academy of Agricultural Sciences, Hangzhou, 310008, PR China

Key Laboratory of Crop Physiology, Ecology and Genetic Breeding, Ministry of Education,

-p

3

4

re

Jiangxi Agricultural University, Nanchang 330045, China;

College of Biotechnology, Jiangsu University of Science and Technology, Zhenjiang 212018, PR

5

lP

China

State key Laboratory Breeding Base for Zhejiang Sustainable Pest and Disease Control, Institute

ur na

of Vegetables, Zhejiang Academy of Agricultural Sciences, Hangzhou 310021, PR China *Correspondence:

Yuan Cheng, E-mail: [email protected]

Jo

Tel: +86 571 86407677 Fax: +86 571 86400997

Total words: 4977 Total figure: 8

Highlights 

Drought stress gradually increases the transcript levels of SlWRKY81 1



Silencing of SlWRKY81 enhances tolerance to drought in tomato



Overexpression of SlWRKY81 reduces tolerance to drought in Arabidopsis



SlWRKY81 silencing triggers stomatal closure and guard cell H2O2 under drought



SlWRKY81 negatively regulates drought tolerance via H2O2–mediated stomatal closure

Abstract

of

WRKY transcription factors (TFs) are key regulators in numerous plant biological processes and responses to stresses. Although a group III tomato WRKY, SlWKRY81, is induced by some biotic

ro

stressors, its role in drought response remains largely unknown. Here, we unveiled a critical role

-p

of SlWKRY81 in regulation of drought response by using agronomic, bioinformatics, genetic and pharmacological approaches. Drought gradually increased the transcript levels of SlWRKY81 and

re

impaired leaf water potential and membrane stability in tomato. Analysis of plant phenotypes

lP

revealed that silencing of SlWRKY81 in tomato enhanced tolerance to drought, while its overexpression in Arabidopsis resulted in an opposite phenotype. Notably, the enhanced drought tolerance in SlWRKY81-silenced tomato plants was closely associated with a rapid and increased

ur na

stomatal closure. Furthermore, such stomatal response in the SlWRKY81-silenced plants was sensitive to abscisic acid alongside drought-induced enhanced accumulation of H2O2 in the guard cells. The results suggest that SlWRKY81 acts as a negative regulator of stomatal closure by

Jo

suppressing SlRBOH1-derived H2O2 accumulation, which attenuates plant tolerance to drought. These results may have potential implications on improving plant drought tolerance through genetic manipulation.

Key words: Tomato; SlWRKY81; drought; H2O2; SlRBOH1; stomatal aperture

2

1. Introduction

of

In nature, plants are confronted by a myriad of biotic and abiotic stressors that detrimentally

ro

affect their growth and development (Bai et al. 2018). Among numerous abiotic stresses, drought that causes cellular water deficit, is considered as one of the most limiting factors for plant growth,

-p

geographical distribution and crop productivity worldwide (Gilbert and Medina 2016). In response

re

to drought, plants have evolved complex adaptive strategies that help them to avoid or tolerate cellular dehydration, allowing the plants to grow and to complete their life cycles under stressful

lP

conditions. The first critical response of a plant to drought is the regulation of water balance by stomatal closure (Gilbert and Medina 2016; Yoshida and Fernie 2018).

ur na

Abscisic acid (ABA), the well characterized stress hormone, plays a central role in drought or any water deficit conditions through the regulation of stomatal aperture and the activation of a distinct set of genes associated with the biosynthesis of osmolytes and protective proteins (Gilbert and Medina 2016; Yoshida and Fernie 2018; Smirnoff and Arnaud 2019). In plant cells, ABA is

Jo

perceived by membrane bound ABA receptors PYR/PYL/RCAR that interact with type 2C protein phosphatases (PP2Cs), such as abscisic acid insensitive 1 (ABI1), hypersensitive to ABA 1 (HAB1) and AKT1 interacting protein phosphatase 1 (AIP1) (Lim et al. 2012; Yin et al. 2016). In guard cells, ABA perception and PP2C sequestration allow sucrose non-fermenting 1-related protein kinase 2 (SnRK2) and several calcium-dependent protein kinases (CDPKs) to activate NADPH

3

oxidase for hydrogen peroxide (H2O2) production, leading to the activation of anion channels (SLAC1 and SLAH3) for stomatal closure (Joshi-Saha et al. 2011; Smirnoff and Arnaud 2019). The perception of environmental cues induces a number of transcription factors (TFs) that function as central mediators of transcriptional reprogramming, leading to the adaptation of plants to stress ( Geng et al., 2017). In addition to ABF/AREB bZIP TFs, members of several other TF families, such as MYB, MYC, NAC and WRKY TFs have been found to regulate the expression

of

of ABA-, drought- or cold-responsive genes ( Geng et al., 2017). The WRKY TF family with over

ro

70 members in Arabidopsis is one of the central TF families involved in biotic stress responses (Huang et al. 2012; Hwang et al., 2016; Jiang et al., 2017; Bai et al. 2018; Gao et al. 2019).

-p

WRKYs are typically involved in the regulation of defense-related genes ( Bai et al. 2018; Gao et

re

al. 2019), and also implicated in various other physiological and developmental programs, including senescence, seed germination and trichome development ( Chen et al., 2018). Recent

lP

studies, especially in Arabidopsis and rice (Oryza sativa L.), have indicated that some WRKY TFs also play important roles in transcriptional reprograming during abiotic stresses, such as drought,

ur na

high salinity, cold and osmotic stress (Cheng et al. 2012; Bai et al. 2018; Gao et al. 2019; Huang et al. 2012; Zhang et al. 2019). In this context, WRKYs have been implicated in ABA signaling and oxidative stress response (Rushton et al. 2012; Chen et al., 2018). Two members of Arabidopsis WRKY group III, the closely related WRKY54 and WRKY70 TFs, have been shown

Jo

as negative regulators of stomatal closure in Arabidopsis (Li et al. 2013). Furthermore, in AtWRKY46 overexpression lines, the insensitivity of stomatal movement to ABA is due to the reduced accumulation of reactive oxygen species (ROS) in guard cells (Ding et al. 2014). As a popular vegetable crop and an important source of dietary nutrients, tomato is grown around the world (Gao et al. 2019). However, its worldwide productivity is greatly affected by

4

multiple biotic and abiotic stresses, such as drought, salinity, heat and cold stress. In tomato, 83 SlWRKY genes have been reported so far, but only a few members of WRKY family genes have been functionally characterized (Huang et al. 2012; Karkute et al. 2018; Gao et al. 2019). Similar to their counterparts in other plant species, some of the WRKYs have been found to play critical roles in different biological processes in tomato plants. For example, SlWRKY70 is involved in Mi1-mediated resistance against aphids and nematodes (Atamian et al. 2012). While SlWRKY3

of

improves resistance against root-knot nematode (Chinnapandi et al. 2019), overexpression of

ro

SlWRKY45 enhances tomato susceptibility to the root-knot nematode (Chinnapandi et al. 2017). In addition to biotic stress responses, tomato WRKYs have been implicated in plant tolerance to

-p

abiotic stresses ( Hichri et al., 2017; Karkute et al. 2018). For instance, overexpression of SlWRKY8

re

and SlWRKY3 enhances tomato tolerance to drought and salinity, respectively (Gao et al. 2019; Hichri et al. 2017). In an earlier study, SlWRKY80 and its paralog SlWKRY81 were shown to be

lP

induced by some biotic and abiotic stressors (Huang et al. 2012), but their role in drought tolerance remains largely unknown. In this study, we explored the possible role of tomato SlWRKY81 in

ur na

drought response. We found that SlWRKY81-silenced plants exhibited enhanced tolerance to drought, whereas its overexpression showed an opposite effect. We also characterized the involvement of SlWRKY81 in the regulation of ABA-mediated stomatal movement in tomato plants. Our results suggest that SlWRKY81 modulates stomatal movement through direct or

Jo

indirect transcriptional programming of SlRBOH1 via H2O2 production in the guard cells. The study establishes the SlWRK81 as a negative regulator of plant drought tolerance and highlights the complexity of plant responses to environmental cues as well as the interactions of signaling networks under drought.

5

2. Materials and methods 2.1. Plant materials and treatments Seeds of Solanum lycopersicum cv. Ailsa Craig (AC) were germinated and raised in plastic pots (15-cm diameter and 15-cm depth) with a 3:1 (v/v) mixture of peat and vermiculite. Seedlings were watered with Hoagland’s nutrient solution every 2 days. The pots were placed in a controlled environment chamber with a day/night temperature of 22/18°C and 12-h photoperiod. The

of

photosynthetic photon flux density (PPFD) was 200 μmol m-2 s-1 supplied from the cool-white

ro

fluorescent lamps.

For drought tolerance assays, different genotypes of tomato (TRV control and SlWRKY81–

-p

silenced plants) and Arabidopsis (Col-0 and SlWRKY81–overexpressing lines) were challenged

re

with drought by withholding water supply up to 15 days and 20 days, respectively. For the in vitro experiments, leaflets were excised at the base and placed in distilled water for 1h to eliminate

lP

wound stress. After pre-incubation, the leaflets were immersed in solutions of ABA (SigmaAldrich, St. Louis, MO, USA) for various times (up to 15min) at 25 °C , with a continuous PPFD

ur na

of 200 μmol m-2 s-1.

2.2. Virus-induced gene silencing (VIGS) of SlWRKY81 in tomato and over-expression of SlWRKY81 in Arabidopsis

The tobacco rattle virus (TRV) VIGS constructs used for the silencing of the Tomato SlWRKY81

Jo

gene were generated by cloning a 400-bp SlWRKY81 cDNA fragment which were PCR-amplified using the forward primer (5’ CCGGAATTCATCATCTCACTCCAGCAA 3’) and the reverse primer (5’ CCGCTCGAGTAATACTATCGCAAAACG 3’). The amplified fragment was digested with restriction enzymes EcoRI and XhoI and cloned into the pTRV2 vector. Empty pTRV2 vector was used as control. All constructs were transformed into the Agrobacterium

6

tumefaciens strain GV3101. VIGS was performed by infiltration on 12-day-old tomato seedlings’ fully expanded cotyledons with a mixture of pTRV1- and pTRV2-carrying A. tumefaciens of 1:1 ratio (OD600=1.2 for each). Infiltrated plants were then maintained at 22/18 °C, 12h-photo period and 120 μmol m-2 s-1 PPFD for 30 d before use. In the current study, considering the ease of transformation technique and overall success, we chose Arabidopsis as plant materials for overexpressing the SlWRKY81. For generating transgenic

of

SlWRKY81 over-expression lines, the full-length coding sequences of SlWRKY81 were PCR-

ro

amplified using the forward primer (5’ AGCCTCGAGATGGATAACTCATCGTCTGATCTA 3’) and the reverse primer (5’ AGCTCTAGAAAGCTACCTACACTACACTTGATC 3’). The

-p

amplified fragments were digested with corresponding enzymes XhoI and XbaI, and inserted

re

behind the CaMV 35S promoter in the plant transformation vector PFGC5941. The resulted plasmids were transformed into Arabidopsis Col-0 wild-type plants using the Agrobacterium-

lP

mediated floral-dip procedure (Clough and Bent, 1998). The silencing and over-expressing efficiency was assessed by quantitative real-time PCR as described by Livak and Schmittgen

ur na

(2001). Actin was used as the internal control for normalization. Plants with over 80% silencing and 300 folds over-expression of SlWRKY81 were selected for experiments, respectively. 2.3. Gas exchange and stomatal movement assays Stomatal conductance (Gs) was determined with an infrared gas analyzer-based portable

Jo

photosynthesis system (LI-6400; LI-COR, Lincoln, NE, USA). The air temperature, relative humidity, PPFD and CO2 concentration were maintained at 25°C, 85%, 1,000 μmol m-2 s-1 and 400 μmol mol-1, respectively (Ahammed et al. 2018). To assess the promotion of stomatal closure, abaxial epidermises were peeled with forceps, floated on buffer [30mM KCl, 10 mM 2-(N-morpholino)-ethanesulphonic acids (MES), pH 6.15]

7

and incubated in the light (200 μmol m-2 s-1 PPFD) for 1h to initially open the stomata. The epidermal peels were then transferred to fresh buffer with or without ABA and incubated for 0-15 min under the same conditions described above. The temperature during the experiment was set at 25 °C . The final stomatal apertures were measured using a light microscope equipped with a digital camera (Leica, Wetzlar, Germany) and the image analysis software Adobe Photoshop CS5 (Adobe, San Jose, CA, USA).

of

2.4. Detection of guard cell H2O2

ro

The H2O2 accumulation in guard cells was detected using 2,7-dichlorofluorescein diacetate (H2DCF-DA) as previously described (Shi et al. 2015). The fluorescent dye H2DCFDA was

-p

loaded into guard cells by incubation. Abaxial epidermal peels were incubated in MES buffer

re

(MES 10 mM, KCl 50 mM, pH 6.15) containing 50 μM H2DCFDA in the dark for 10 min at 25°C and subsequently rinsed with distilled water for three times. The fluorescence in guard cells was

lP

detected using a confocal laser scanning microscope (Leica TCS SL; Leica Microsystems, Wetzlar, Germany) equipped with argon/He-Ne laser sources using 10-nm bandwidth standard filters

ur na

(excitation, 480 nm; emission, 530 nm). 2.5. ABA analysis

For the ABA assay, 0.5 g of fresh leaves was ground in a mortar and homogenized in extraction solution (80% methanol, v/v). Extracts were incubated for 4h at 4 °C and then centrifuged at 10,000

Jo

g for 20 min. The supernatant liquid was eluted through a Sep-Pak C18 cartridge (Waters, Milford, MA, USA) to remove polar compounds and then under a stream of N2. Dried samples were resuspended in 5 ml of eluting buffer [10% (v/v) methanol in 50 mM Tris (pH 8.1), 1 mM MgCl2, 150 mM NaCl] and analyzed with enzyme-linked immunosorbent assay (ELISA). The ELISA was conducted according to the instructions provided by the manufacturer (China Agricultural

8

University, Beijing, China). ABA was determined by Multimode Plate Reader Label-free System (PerkinElmer, MA, USA). 2.6. RNA extraction, cDNA synthesis and qRT-PCR assay Total RNA was isolated from leaves using the RNAprep Pure Plant Kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer’s instructions. DNA was removed using RNase-free DNase during the isolation step. Approximately 2 μg of total RNA was reverse

of

transcribed using the oligo d(T)16 primer and M-MLV reverse transcriptase (TaKaRa Bio Inc.,

ro

Dalian, China). The single-stranded cDNA synthesized from total RNA was used as qRT-PCR templates. We used 1 μL of cDNA as a template in 20 μL PCR reactions. PCR was run for 40

-p

cycles of 30 s at 94 °C, 30 s at 58 °C and 1 min at 72 °C. The specific primers for SlWRKY81 and

according to Livak and Schmittgen (2001).

re

actin could be found in Supplementary Table S1.The relative gene expression was calculated

lP

2.7. Water potential and electrolyte leakage measurements Leaf water potential of control and SlWRKY81-silenced plants under different duration of

ur na

drought treatment was measured in detached leaves with WP4 water potential meter using continuous measure mode for data record. For electrolyte leakage determination, leaf samples (1g) were washed with deionized water and placed in tubes with 20 ml of deionized water. The electrical conductivity of the solution (L1) was

Jo

measured after 1h of shaking at 25 °C . The samples were then boiled for 20 min and measured again for conductivity (L2). The electrolyte leakage was calculated as follows: EL(%)=(L1/L2) ×100%.

2.8. Sequence and phylogenetic analysis To examine possible regulation of Arabidopsis VQ genes by WRKY transcription factors, the

9

1.5-kb sequences upstream of the predicted translational start sites of the 8 genes encoding ABAstomatal pathway components were collected from Sol Genomics Network (SGN: https://solgenomics.net/), and the core W-box sequences (TTGAC) were labeled on the corresponding sites, respectively. The alignments of amino acid sequences of 15 complete WRKY domains from Arabidopsis, 11 complete WRKY domains from Tomato (group III WRKY members), were performed using

of

ClustalX 1.83 with default settings (Thompson et al. 1997) (http://www.clustal.org/). An unrooted

ro

phylogenetic tree was conducted based on the alignment data using MEGA 5.0 with neighbor joining method and maximum-likelihood method, respectively (Tamura et al. 2011).

-p

2.9. Statistical analysis

re

All data were subject to analysis of variance and the mean values were presented for each treatment. At least 3 independent replicates were used for each determination. The statistical analysis of the

lP

bioassays was performed with the SPSS 16.0 statistical software package, and a Tukey’s test (P <

3. Results

ur na

0.05) was performed to evaluate the treatment effects.

3.1. Structural and functional analysis of SlWRKY81 Through comparing the protein sequences of group III WRKY transcription factors of Tomato

Jo

and Arabidopsis using MEGA 5.0, we identified 3 homologous proteins of SlWRKY81, one in tomato (SlWRKY80), and two in Arabidopsis (AtWRKY54 and AtWRKY70), respectively (Fig. 1A). The 400bp fragment of SlWRKY81 gene at 3' region was specifically selected to avoid cosilencing of SlWRKY80 (Fig. 1B). SlWRKY81 has been predicted to be nuclear located (Fig. 1B) based on the NLStradamus program (http://www.moseslab.csb.utoronto.ca/NLStradamus/). The

10

tertiary structure of SlWRKY81 was demonstrated in Fig. 1C. 3.2. Drought response is altered by silencing and overexpression of SlWRKY81 To explore the function of SlWRKY81 in drought response, SlWRKY81-silenced (TRV:SlWRKY81) and TRV control (TRV:TRV) tomato plants, as well as SlWRKY81 overexpressing (35S:SlWRKY81) and wild-type (Col-0) Arabidopsis plants were exposed to drought by withholding irrigation for 12d (Fig. 2B) and 15d (Fig. 2D), respectively. The qRT-PCR

of

analysis confirmed that silencing of SlWRKY81 in tomato specifically suppressed the expression

ro

of SlWRKY81 without affecting the expression of its highly paralogous counterpart SlWRKY80 (Fig. 2A). On the other hand, overexpression of SlWRKY81 in Arabidopsis significantly

-p

upregulated the transcript levels of SlWRKY81 in two overexpressing lines (L1, L2) compared with

re

that in control (Col-0) (Fig. 2C).

As shown in Fig. 3A, the transcript levels of SlWRKY81 increased rapidly and transiently after

lP

suspension of irrigation, reaching the maximum level after 8d of drought treatment. This response was far more significant in TRV:TRV plants compared to that in TRV:SlWRKY81 plants,

ur na

suggesting that silencing of SlWRKY81 greatly attenuated the drought-induced elevation in SlWRKY81 expression. After 12d, the expression of SlWKY81 in TRV:TRV plants reduced to less than one-half of the maximal level (at 8d). Nonetheless, TRV:SlWRKY81 plants exhibited an enhanced drought tolerance throughout the study period as reflected by their phenotypes at 4d, 8d,

Jo

12d of no irrigation treatment compared to that of TRV:TRV control (Fig. 3B). Consistent with the phenotype, the relative electrolyte leakage (%) gradually increased (Fig. 3C), while the leaf water potential decreased in both TRV:TRV control and TRV:SlWRKY81 plants with the prolongation of water withholding (Fig. 3D). However, SlWRKY81-silenced plants maintained a lower electrolyte leakage (%) and a higher leaf water potential compared with that in TRV:TRV control plants under

11

drought. For instance, after 12d drought, the electrolyte leakage (%) in the SlWRKY81-silenced plants was 26% lower than that in TRV:TRV control plants, suggesting that suppression of SlWRKY81 attenuated drought-induced damages to tomato plants (Fig. 3C). Notably, we also performed a re-watering experiment to compare the recovery between two tomato genotypes. The phenotype of TRV:SlWRKY81 plants clearly demonstrated total recovery from the drought compared with the TRV:TRV control plants at 2d after re-watering (Supplementary figure S1). On

of

the contrary, the SlWRKY81 over-expressing lines of Arabidopsis plants (both 35S:SlWRKY81

ro

line1 and line2) were highly sensitive to drought and severely damaged by the 15d-long water withholding (Fig. 2D), suggesting that SlWRKY81 might act as a negative regulator of drought

-p

tolerance in plants. To further support the drought response phenotype of SlWRKY81 silencing

re

plants, equal number of TRV:TRV control and TRV:SlWRKY81 plants were grown in the same rectangular plastic containers filled with soil. After 20 days of no irrigation, all SlWRKY81-silenced

lP

plants exhibited enhanced drought tolerance (Fig. S2).

3.3. Stomatal closure is more sensitive to drought and exogenous ABA treatment in

ur na

SlWRKY81-silenced tomato plants

Rapid stomatal closure is one of the most important responses that confer drought tolerance in plants. Therefore, we intend to explore whether SlWRKY81 has a role in stomatal movement. Firstly, we measured stomatal conductance in SlWRKY81-silenced and control plants. Although

Jo

there was no remarkable difference in stomatal conductance between TRV:TRV control and TRV:SlWRKY81 plants under normal conditions (0d), the stomatal conductance decreased rapidly and more significantly in TRV:SlWRKY81 plants with the prolongation of drought compared with that in TRV control (Fig. 4). Secondly, we analyzed stomatal density by light microscopy and found no significant differences between TRV control and TRV:SlWRKY81 plants (Fig. 5A&B).

12

However, TRV:SlWRKY81 leaves showed less opened stomata under drought compared to TRV control (Figs. 5C&D), indicating that the reduced stomatal conductance in SlWRKY81-silenced plants largely attributed to stomatal movement. The role of ABA in stomatal movement and abiotic stress response is well established in model plants (Yoshida and Fernie 2018). To further explore whether SlWRKY81-mediated stomatal regulation is dependent on ABA, we analyzed the ABA content in tomato leaves under drought.

of

As shown in Fig. 6A, although the ABA content was induced by drought (12d), there were no

ro

remarkable differences in the ABA content between TRV control and TRV:SlWRKY81 plants under drought treatment (Fig. 6A). These results compelled us to exclude the hypothesis that SlWRKY81

-p

functions upstream of ABA to regulate stomatal closure. Moreover, exogenous ABA application

re

did not affect the transcript levels of SlWRKY81 in TRV control and TRV:SlWRKY81 plants, suggesting that SlWRKY81 transcription is not directly regulated by ABA (Supplementary figure

lP

S3). However, analysis of stomatal conductance following exogenous ABA treatment revealed that TRV:SlWRKY81 plants exhibited a faster decrease in stomatal conductance compared to TRV:TRV

ur na

after ABA treatment (Fig. 6B). In addition, light microscopic observation revealed that the ratio of length over width of stomata increased more rapidly in SlWRKY81–silenced plants compared to that in TRV control (Fig. 6C&D), suggesting that the silencing of SlWRKY81 facilitated the rapid stomatal closure in an ABA-dependent manner.

Jo

3.4. SlWRKY81 negatively regulates stomatal closure by decreasing H2O2 accumulation in guard cells

Apoplastic hydrogen peroxide (H2O2) has been shown to play a critical role in ABA-induced

stomatal movement in tomato plants (Agurla and Raghavendra 2016; Islam et al. 2019; Smirnoff and Arnaud 2019). We used 2,7-dichlorofluorescein diacetate (H2DCF-DA) to detect the H2O2

13

accumulation in guard cells under drought. Based on the light microscopic observation and mean fluorescence intensity analysis, we found that H2O2 accumulated more rapidly and abundantly in guard cells of TRV:SlWRKY81 plants compared to TRV:TRV plants with the prolongation of water withholding (Fig. 7A, Supplementary figure S4). These results suggest that SlWRKY81 negatively regulates the tolerance of tomato plants to drought by suppressing the production of H2O2 in an ABA-dependent stomatal closure pathway.

of

3.5. Expression profile of ABA-dependent stomatal closure pathway genes as influenced by

ro

SlWRKY81 silencing and drought treatment

To further understand the regulation mechanism of SlWRKY81 in ABA-dependent stomatal

-p

movement, qRT-PCR was conducted. The expression levels of some genes, such as SlPYR1,

re

SlPYL4, SlCPK3 and SlSLAC1, were compromised by the silencing of SlWRKY81 under normal conditions (0d). Although most of the genes were induced by drought conditions, the expression

lP

pattern differed among genes to some extent. For instance, the transcript levels of SlPYL2, SlPYL4, SlABI1, SlOST1, SlRBOH1 and SlSLAC1 consistently upregulated with the prolongation of

ur na

drought treatment (4d and 8d). However, that of SlPYR1 and SLCPK3 increased initially after 4d of water withholding and then decreased significantly at 8d of drought in both TRV:TRV and TRV:SlWRKY81 plants. After 4d of water withholding, the transcript level of NADPH oxidase encoding gene SlRBOH1 and calmodulin kinase encoding gene SlCPK3 in TRV:SlWRKY81 plants

Jo

remained significantly higher than that in TRV:TRV plants (Fig. 7B). Likewise, following 8d drought treatment, the transcript levels of SlRBOH1, SlCPK3 and SlSLAC1 significantly increased in TRV:SlWRKY81 plants compared with that in TRV:TRV plants. We further inspected 1.5-kb sequences upstream of the predicted translational start sites of the 8 genes encoding ABA-stomatal pathway components for the core W-box sequence (TTGACC/T).

14

Among the 8 genes, 2 genes (SlPYL2, SlPYL4) do not contain any copy of the TTGACC/T sequence in their promoters (Fig. 7C), and SlPYR1, SlRBOH1 have 4 and 2 copies, respectively, whilst the remaining 4 genes (SlABI1, SlOST1, SlCPK3 and SlSLAC1) have only 1 copy of the Wbox sequence in their promoters. Although drought-induced patterns of all these 8 genes do not seem to correlate well with the corresponding number of W-boxes in the promoters, it appears that SlRBOH1 was induced more significantly in TRV:SlWRKY81 plants under drought condition,

of

which contains two copies of WRKY-binding site, indicating that this gene is a potential target of

ro

SlWRKY81 transcription factor. Thus, the enhanced accumulation of hydrogen peroxide (H2O2) in SlWRKY81-silenced tomato plants could be modulated by the SlWRKY81 via NADPH oxidase

-p

encoding gene SlRBOH1.

re

4. Discussion

Plant adaptation to drought involves a massive transcriptional reprogramming (Gilbert and Medina

lP

2016). Several superfamily of transcription factors, including WRKYs have been shown to mediate drought responses (Gao et al. 2019; Wang et al. 2015). However, only a few tomato WRKY

ur na

genes were functionally characterized in response to abiotic stresses (Karkute et al. 2018). Recently, there has been an increasing body of evidence that SlWRKY transcription factors could influence drought tolerance in plants (Bai et al. 2018; Ding et al. 2014; Li et al. 2013), but the mechanisms involved are still largely unknown. In this study, we reveal that drought gradually upregulated

Jo

SlWRKY81 expression, but suppression of SlWRKY81 expression remarkably enhanced tomato tolerance to drought, which was associated with a decreased stomatal conductance (Fig. 3A&B, Fig. 4), reduced ion leakage from the leaves compared to control plants (Fig. 3C) and increased leaf water potential (Fig. 3D). Furthermore, overexpression of SlWRKY81 in Arabidopsis plants enhanced hypersensitivity to drought (Fig. 2C&D), a phenomenon totally opposite to that observed

15

in SlWRKY81-silenced tomato plants (Fig. 2A&B). These results suggest that SlWRKY81 might act as a negative regulator of plant tolerance to drought. Drought adaptation mechanisms largely rely on efficient water balance through regulation of stomatal movement (Gilbert and Medina 2016). Since SlWRKY81-silenced plants maintained a reduced stomatal conductance under drought, we intend to examine the potential contribution of stomatal density and stomatal aperture to the changes in stomatal conductance. We found that SlWRKY81-mediated stomatal closure but not

of

stomatal density contributed to reduced stomatal conductance and subsequent drought tolerance in

ro

tomato plants (Fig. 5). Similarly, overexpression of WRKY46 in Arabidopsis increased water loss rate and decreased survival rate, which was partly attributed to impaired stomatal movement (Ding

-p

et al. 2014).

re

The role of phytohormone ABA in stomatal closure is well recognized (Yoshida and Fernie 2018). Signaling molecules, such as H2O2 has been shown to mediate ABA-dependent stomatal

lP

closure (Ding et al. 2014; Shi et al. 2015; Zhang et al. 2018). In Arabidopsis, AtWRKY46 negatively regulates ABA-dependent ROS accumulation in guard cells (Ding et al. 2014). In our

ur na

study, stomata of SlWRKY81-silenced plants were sensitive to exogenous ABA as evidenced by rapid changes in stomatal conductance and stomatal aperture compared to TRV:TRV control plants (Fig. 6B&C&D). Although no significant changes were found in ABA content between TRV:TRV control and SlWRKY81-silenced plants under drought (Fig.6A), H2O2 accumulation in

Jo

guard cells greatly increased in SlWRKY81-silenced plants following the drought (Fig. 7A), suggesting that SlWRKY81 might negatively regulate ROS accumulation in the guard cells to impair ABA-dependent stomatal closure. H2O2 plays a critical role in plant responses to environmental cues (Smirnoff and Arnaud 2019). In particular, guard cell H2O2 mediates high CO2induced stomatal movement (Shi et al. 2015). Furthermore, H2O2 derived from SlRBOH1

16

encoding NADPH oxidase mediates elevated CO2-induced thermo tolerance, which is closely associated with the efficient stomatal movement in tomato plants (Zhang et al. 2018). There are different sources of H2O2 in plant cells; however, NADPH oxidase-dependent apoplastic H2O2 frequently functions as a signaling molecule in stress responses (Smirnoff and Arnaud 2019). Consistent with the role of AtWRKY46 in ABA-dependent ROS accumulation in guard cells, suppression of SlWRKY81 increased H2O2 accumulation in guard cells of tomato and enhanced

of

tomato tolerance to drought (Ding et al. 2014).

ro

ABA activates Ca2+ channels in the plasma membrane by triggering NADPH oxidasedependent H2O2 generation, leading to stomatal closure (Agurla and Raghavendra 2016; Islam et

-p

al. 2019; Smirnoff and Arnaud 2019). In tomato, NADPH oxidase SlRBOH1 functions in H2O2-

re

dependent ABA signaling (Zhou et al., 2014a; Zhou et al., 2014b). In our experiment, the expression level of SlRBOH1 could be repressed by SlWRKY81 under drought condition (Fig.

lP

7B), which could further compromise the H2O2 accumulation in guard cells (Fig. 7A) and subsequently attenuate ABA-dependent stomatal closure through repression of downstream

ur na

SlCPK3 and SlSLAC1 (Fig. 7B). Thus, we propose that the negative regulation of SlWRKY81 on ABA-stomatal pathway functioned through the direct or indirect regulation of SlRBOH1 transcript. Furthermore, the two W-box elements distributed on the promoter of SlRBOH1 gene suggest a possibility that SlRBOH1 is a target of SlWRKY81 (Fig. 7C).

Jo

As SlWRKY81 negatively regulates drought tolerance in Arabidopsis and tomato plants, it

remains a question, why do plants upregulate SlWRKY81 expression in response to drought? It is to be noted that several WRKYs have been shown to negatively regulate plant defense responses (Bai et al. 2018; Ding et al. 2014; Fukushima et al. 2016). However, the role of a single WRKY cannot be fully ascertained from a single gene suppression, because WRKYs can play dual role

17

based on the formation of homodimers and heterodimer with other WRKYs that facilitate binding to W-boxes (Fukushima et al. 2016). Moreover, gene transcription of one WRKY can directly or indirectly be regulated by the transcript of other WRKYs. Notably, stomata not only act as the prime exit for water loss, but also function as entry channels for atmospheric CO2 required for photosynthesis. Thus, different regulatory mechanisms occur in guard cells for potential adaptation to abnormal environmental conditions, including drought. Although a number of genes involved

of

in ABA response and stomatal closure were upregulated by drought in both tomato genotypes (Fig.

ro

7B), it is highly likely that plants may need to maintain the transcription of some genes to mediate stomatal opening that may adequately operate stomatal aperture to bring a balance between CO 2

-p

intake and water loss under drought conditions (Ding et al. 2014). Therefore, we assume that

re

SlWRKY81 might play such a role that involves massive transcriptional reprogramming, leading to a ‘trade-off’ between growth and defense through regulation of stomatal movement.

lP

To sum up, we reveal that SlWRKY81, a group III nuclear localized WRKY TF in tomato, plays a critical role in drought response by regulating stomatal movement (Fig. 8). Drought

ur na

increases ABA content and SlWRKY81 expression in tomato leaves alongside gradual decreases in leaf water potential and stomatal conductance. However, silencing of SlWRKY81 attenuated drought-induced reduction in leaf water potential by inducing the transcript levels of SlRBOH1 and subsequent H2O2 accumulation in guard cells, which eventually mediates stomatal closure and

Jo

plant tolerance to drought. Taken together, our results suggest that SlWRKY81 acts as a negative regulator for plant tolerance to drought. These data may be useful for the improvement of plant tolerance to stress through genetic manipulation. Author contributions Conceived and designed the experiments: YC and GJA; Performed the experiments: YC, GJA, XL,

18

YY and CL; Analyzed the data: HW, YC, and GZ; Wrote the draft manuscript: YC and GJA. Reviewed and edited the manuscript: GJA and YC. All authors have read and approved the manuscript.

Conflicts of interest

of

The authors declare that they have no conflict of interest.

ro

Acknowledgements

This research was partially supported by National Key Research and Development Program of

-p

China (2018YFD1000800); National Natural Science Foundation of China (31950410555,

re

31772294, 3191101316); State Key Laboratory Breeding Base for the Zhejiang Sustainable Pest and Disease Control (2010DS700124-ZZ1903); National Key Research and Development

lP

Program (2018YCGC005); Zhejiang Provincial major Agricultural Science and Technology Projects of New Varieties Breeding (2016C02051); Zhejiang Provincial Natural Science

ur na

Foundation of China (LY18C150008); General Program from the National key research and development program (2017YFD0101902); The earmarked fund for China Agriculture Research System (CARS-23-G-44) and Henan University of Science and Technology (HAUST) Research

Jo

Start-up Fund for New Faculty (13480058).

19

References Agurla, S., Raghavendra, A.S., 2016. Convergence and divergence of signaling events in guard cells during stomatal closure by plant hormones or microbial elicitors. Front. Plant Sci. 7, 1332. Ahammed, G.J., Wen, X., Liu, A.R., Chen, S.C. 2018. COMT1 silencing aggravates heat stressinduced reduction in photosynthesis by decreasing chlorophyll content, photosystem II activity, and electron transport efficiency in tomato. Front. Plant Sci. 9, 998.

ro

resistance to aphids and nematodes in tomato. Planta 235, 299-309.

of

Atamian, H.S., Eulgem, T., Kaloshian, I. 2012. SlWRKY70 is required for Mi-1-mediated

Bai, Y., Sunarti, S., Kissoudis, C., Visser, R.G.F., van der Linden, C.G. 2018. The role of tomato

-p

WRKY genes in plant responses to combined abiotic and biotic stresses. Front. Plant Sci. 9,

re

801.

Chen, F., Hu, Y., Vannozzi, A., Wu, K., Cai, H., Qin, Y., Mullis, A., Lin, Z., Zhang, L., 2018. The

lP

WRKY transcription factor family in model plants and crops. Crit. Rev. Plant Sci. 36, 311-335. Cheng, Y., Zhou, Y., Yang, Y., Chi, Y.J., Zhou, J., Chen, J.Y., et al. 2012. Structural and functional

ur na

analysis of VQ motif-containing proteins in Arabidopsis as interacting proteins of WRKY transcription factors. Plant Physiol. 159, 810-825. Chinnapandi, B., Bucki, P., Braun Miyara, S., 2017. SlWRKY45, nematode-responsive tomato WRKY gene, enhances susceptibility to the root knot nematode; M. javanica infection. Plant

Jo

Signal. Behav. 12, e1356530.

Chinnapandi B, Bucki P, Fitoussi N, Kolomiets M, Borrego E, Braun Miyara S (2019) Tomato SlWRKY3 acts as a positive regulator for resistance against the root-knot nematode Meloidogyne javanica by activating lipids and hormone-mediated defense-signaling pathways. Plant Signal. Behav. 1-16. doi: 10.1080/15592324.2019.1601951.

20

Clough, S.J., Bent, A.F. 1998. Floral dip: a simplified method for Agrobacterium mediated transformation of Arabidopsis thaliana. Plant J. 16, 735–743. Ding, Z.J., Yan, J.Y., Xu, X.Y., Yu, D.Q., Li, G,X., Zhang, S.Q., Zheng, S.J. 2014. Transcription factor WRKY46 regulates osmotic stress responses and stomatal movement independently in Arabidopsis. Plant J 79, 13-27. Fukushima, S., Mori, M., Sugano, S., Takatsuji, H. 2016. Transcription factor WRKY62 plays a

of

role in pathogen defense and hypoxia-responsive gene expression in Rice. Plant Cell Physiol.

ro

57, 2541-2551.

Gao, Y.F., Liu, J.K., Yang, F.M., Zhang, G.Y., Wang, D., Zhang, L., Ou, Y.B., Yao, Y.A. 2019.

-p

The WRKY transcription factor SlWRKY8 promotes resistance to pathogen infection and

re

mediates drought and salt stress tolerance in Solanum lycopersicum. Physiol Plant. doi: 10.1111/ppl.12978.

lP

Geng, R., Ke, X., Wang, C., He, Y., Wang, H., Zhu, Z., 2017. Genome-wide identification and expression analysis of transcription factors in Solanum lycopersicum. Agri Gene 6, 14-23.

ur na

Gilbert, M.E., Medina, V. 2016. Drought adaptation mechanisms should guide experimental design. Trend Plant Sci. 21, 639-647. Hichri, I., Muhovski, Y., Žižková, E., Dobrev, P.I., Gharbi, E., Franco-Zorrilla, J.M., LopezVidriero, .I, Solano, R., Clippe, A., Errachid, A., Motyka, V., Lutts, S. 2017. The Solanum

Jo

lycopersicum WRKY3 transcription factor SlWRKY3 is involved in salt stress tolerance in tomato. Front. Plant Sci. 8, 1343.

Huang, S., Gao, Y., Liu, J., Peng, X., Niu, X., Fei, Z., Cao, S., Liu, Y. 2012. Genome-wide analysis of WRKY transcription factors in Solanum lycopersicum. Mol. Genet. Genomics 287, 495513.

21

Hwang, S.H., Kwon, S.I., Jang, J.Y., Fang, I.L., Lee, H., Choi, C., Park, S., Ahn, I., Bae, S.C., Hwang, D.J., 2016. OsWRKY51, a rice transcription factor, functions as a positive regulator in defense response against Xanthomonas oryzae pv. oryzae. Plant Cell Rep. 35, 1975-1985. Islam, M.M., Ye, W., Matsushima, D., Rhaman, M.S., Munemasa, S., Okuma, E., Nakamura, Y., Biswas, M.S., Mano, J.i., Murata, Y., 2019. Reactive carbonyl species function as signal mediators downstream of H2O2 production and regulate [Ca2+]cyt elevation in ABA signal

of

pathway in Arabidopsis guard cells. Plant Cell Physiol. 60, 1146-1159.

responses to stresses. J. Integr. Plant Biol. 59, 86-101.

ro

Jiang, J., Ma, S., Ye, N., Jiang, M., Cao, J., Zhang, J., 2017. WRKY transcription factors in plant

-p

Joshi-Saha, A., Valon, C., Leung, J. 2011. A brand new START: abscisic acid perception and

re

transduction in the guard cell. Sci. Signal. 4, re4. doi: 10.1126/scisignal.2002164. Karkute, S.G., Gujjar, R.S., Rai, A., Akhtar, M., Singh, M., Singh, B. 2018. Genome wide

Plant Gene 13, 8-17.

lP

expression analysis of WRKY genes in tomato (Solanum lycopersicum) under drought stress.

ur na

Li, J., Besseau, S., Toronen, P., Sipari, N., Kollist, H., Holm, L., Palva, E.T. 2013. Defense-related transcription factors WRKY70 and WRKY54 modulate osmotic stress tolerance by regulating stomatal aperture in Arabidopsis. New Phytol. 200, 457-472. Lim, C.W., Kim, J.H., Baek, W., Kim, B.S., Lee, S.C. 2012. Functional roles of the protein

Jo

phosphatase 2C, AtAIP1, in abscisic acid signaling and sugar tolerance in Arabidopsis. Plant Sci. 187, 83–88.

Livak, K.J., and Schmittgen, T.D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-delta delta C(T)) method. Methods 25, 402–408. Rushton, D.L., Tripathi, P., Rabara, R.C., Lin, J., Ringler, P., Boken, A.K., Langum, T.J., Smidt,

22

L., Boomsma, D.D., Emme, N.J. et al. 2012. WRKY transcription factors: key components in abscisic acid signalling. Plant Biotechnol. J. 10, 2–11. Shi, K., Li, X., Zhang, H., Zhang, G., Liu, Y., Zhou, Y., Xia, X., Chen, Z., Yu, J. 2015. Guard cell hydrogen peroxide and nitric oxide mediate elevated CO2-induced stomatal movement in tomato. New Phytol. 208, 342-353. Smirnoff, N., Arnaud, D. 2019. Hydrogen peroxide metabolism and functions in plants. New

of

Phytol. 221, 1197-1214.

ro

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and

-p

maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.

re

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., and Higgins, D.G. 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by

lP

quality analysis tools. Nucleic Acid Res. 25, 4876–4882.

Wang, X., Zeng, J., Li, Y., Rong, X., Sun, J., Sun, T., Li, M., Wang, L., Feng, Y., Chai, R., Chen,

ur na

M., Chang, J., Li, K., Yang, G., He, G. 2015. Expression of TaWRKY44, a wheat WRKY gene, in transgenic tobacco confers multiple abiotic stress tolerances. Front. Plant Sci. 6: 615. Yin, Y., Adachi, Y., Nakamura, Y., Munemasa, S., Mori, I.C., Murata, Y., 2016. Involvement of OST1 protein kinase and PYR/PYL/RCAR receptors in methyl jasmonate-induced stomatal

Jo

closure in Arabidopsis guard cells. Plant Cell Physiol 57, 1779-1790.

Yoshida, T., Fernie, A.R. 2018. Remote control of transpiration via ABA. Trend Plant Sci. 23, 755-758.

Zhang, H., Pan, C., Gu, S., Ma, Q., Zhang, Y., Li, X., Shi, K. 2018. Stomatal movements are involved in elevated CO2 -mitigated high temperature stress in tomato. Physiol Plant. doi:

23

10.1111/ppl.12752. Zhang, L., Zhao, T., Sun, X., Wang, Y., Du, C., Zhu, Z., Gichuki, D.K., Wang, Q., Li, S., Xin, H. 2019. Overexpression of VaWRKY12, a transcription factor from Vitis amurensis with increased nuclear localization under low temperature, enhances cold tolerance of plants. Plant Mol Biol. doi: 10.1007/s11103-019-00846-6. Zhou, J., Wang, J., Li, X., Xia, X.J., Zhou, Y.H., Shi, K., Chen, Z., Yu, J.Q., 2014a. H2O2 mediates

of

the crosstalk of brassinosteroid and abscisic acid in tomato responses to heat and oxidative

ro

stresses. J. Exp. Bot. 65, 4371-4383.

Zhou, J., Xia, X.J., Zhou, Y.H., Shi, K., Chen, Z., Yu, J.Q., 2014b. RBOH1-dependent H2O2

-p

production and subsequent activation of MPK1/2 play an important role in acclimation-

Jo

ur na

lP

re

induced cross-tolerance in tomato. J. Exp. Bot. 65, 595-607.

24

Figure captions Fig. 1 Phylogenetic analysis and genome/protein structure of SlWRKY81 based on bioinformatics. A. Phylogenetic tree of the group III WRKY proteins from Tomato and Arabidopsis. The tree was inferred using the neighbor-joining method. Phylogenetic analyses were conducted in MEGA5. Bootstrap values from 1,000 replicates were used to assess the robustness of the tree. B. The cDNA and its corresponding amino acid sequence diagram of Tomato

of

SlWRKY81. Nucleus localization site prediction was conducted based on NLStradamus database

ro

(http://www.moseslab.csb.utoronto.ca/NLStradamus/), and the predicted Nuclear Localization Site (NLS) was marked with grey background. The conserved structures of WRKY domain, the

-p

heptapeptide WRKYGQK and CCHC zinc-finger structure were labeled with black underline and

structure

of

SlWRKY81

was

re

red font, respectively. The fragment used for VIGS was marked with red underline C. The tertiary constructed

online

tool

SWISS-MODEL

Jo

ur na

lP

(https://swissmodel.expasy.org/interactive).

by

25

of ro -p re lP

Fig. 2 Effect of genetic manipulation of SlWRKY81 on drought tolerance. A. Transcript levels

ur na

of SlWRKY81 and SlWRKY80 in SlWRKY81-silenced tomato plants (TRV:SlWRKY81). B. Phenotype of the SlWRKY81-silenced plants after 12 days of drought treatment (No irrigation). C. Transcript level of SlWRKY81 in 35S driven transgenic SlWRKY81 over-expressing Arabidopsis lines (35S:SlWRKY81-L1, 35S:SlWRKY81-L2) under normal condition. D. Phenotype of the

Jo

SlWRKY81 over-expressing Arabidopsis lines after 15 days of drought treatment (No irrigation). The data of gene expression represent mean values ± SD from three biological replicates. Different letters at the top of bar graphs indicate significant differences between treatments (P < 0.05) according to Tukey’s test.

26

of ro -p re lP

Fig. 3 The expression pattern of SlWRKY81 under drought treatment. A. Transcript levels of

ur na

SlWRKY81 in SlWRKY81-silenced plants (TRV:SlWRKY81) and control plants (TRV:TRV) under 4d, 8d and 12d drought treatment (No irrigation). B. Phenotypes of two tomato genotypes under different duration of drought treatment. (C) Relative electrolyte leakage (%) and (D) leaf water potential in SlWRKY81-silenced plants (TRV:SlWRKY81) and control plants (TRV:TRV) at 4d, 8d

Jo

and 12d after initiation of water withholding, respectively. The results are presented as mean values and error bars indicate standard deviations (SD); n = 3. Different letters at the top of bar graphs indicate significant differences between treatments (P < 0.05) according to Tukey’s test.

27

of ro -p re lP

Fig. 4 Stomatal conductance as influenced by SlWRKY81 silencing in tomato plants under

ur na

drought treatment. Stomatal conductance was measured in intact plants after the imposition of drought treatment at different time points (at 4d, 8d, and 12d of drought treatment) with LiCOR6400 (LI-COR, USA). The results are presented as mean values and error bars indicate standard deviations (SD); n = 3. Different letters at the top of bar graphs indicate significant

Jo

differences between treatments (P < 0.05) according to Tukey’s test.

28

of ro -p re lP

Fig. 5 Effect of SlWRKY81 silencing on stomatal density and drought-induced stomatal

ur na

closure. A. Photographs showing stomatal distribution in leaves of TRV:TRV and TRV:SlWRKY81 plants. Scale bar=50 μm. B. Stomatal density in abaxial epidermis of leaves of TRV:TRV and TRV:SlWRKY81 plants. C. Photographs of stomatal aperture after different duration of drought treatment. Stomatal aperture was measured by microscope. Scale bar=10 μm. D. Stomatal aperture

Jo

(Ratio of length/width) in TRV:TRV and TRV:SlWRKY81 plants as influenced by drought. Data were calculated from 50 stomata of five tomato plants for each treatment. Values are means ± SD (n = 5). Significant differences between means were indicated by an asterisk (*) or different smaller case letters according to Tukey’s test (P < 0.05).

29

of ro -p re lP

Fig. 6 The influence of ABA on the stomatal movement of SlWRKY81-silenced plants. A. ABA

ur na

content in TRV:TRV and TRV:SlWRKY81 plants as influenced by drought. All results shown above were obtained with similar results in three independent assays. B. Time course of stomatal conductance in TRV:TRV and TRV:SlWRKY81 plants following ABA (50 µM) treatment. Stomatal conductance was measured in 5-week old TRV:TRV and TRV:SlWRKY81 plants after 50 μM ABA

Jo

treatment from 9:00 am to 9:35 am, data were recorded every 3 minutes. C. Stomatal aperture (Ratio of length/width) in TRV:TRV and TRV:SlWRKY81 plants as influenced by 10 μM ABA. Data were calculated from 100 stomata of five different tomato plants for each genotype. D. Comparison of stomatal aperture under ABA (10 μM) treatment for 5, 10 and 15 min. Scale bar=10 μm. Significant differences between means were indicated by an asterisk (*) according to Tukey’s

30

lP

re

-p

ro

of

test (P < 0.05).

ur na

Fig. 7 ROS accumulation in guard cells and potential source of ROS production as influenced by SlWRKY81 under drought. A. H2O2 accumulation in guard cells of tomato leaves in TRV:TRV and TRV:SlWRKY81 plants as influenced by drought. H2O2 accumulation was visualized with the fluorescence dye 2’,7’–dichlorodihydrofluorescein diacetate (H2DCF-DA). Scale bar=10 μM. B.

Jo

Expression levels of different genes encoding ABA-stomatal pathway components as influenced by drought treatment. The data of gene expression represent mean values ± SD from three biological replicates. Different letters at the top of bar graphs indicate significant differences between treatments (P < 0.05) according to Tukey’s test. C. Prediction of translational start sites of the 8 genes encoding ABA-stomatal pathway components for the core W-box sequence.

31

of ro -p re lP

Fig. 8 A schematic model showing SlWRKY81-mediated regulation of drought tolerance in

ur na

tomato plants. Stomatal closure is compliantly induced by ABA and ROS signals. SlWRKY81 negatively regulates tomato tolerance to drought by modulating ABA-dependent stomatal closure through inhibiting SlRBOH1 encoding NADPH oxidase-derived H2O2 accumulation in the guard cells. The arrows indicate induction; The blunt-end arrows represent suppression. Arrow width

Jo

indicates relative extent of changes. ABA, abscisic acid; H2O2, hydrogen peroxide; SlRBOH1, RESPIRATORY BURST OXIDASE HOMOLOGUE 1; Ψleaf, leaf water potential; Gs, stomatal conductance.

32

33

of

ro

-p

re

lP

ur na

Jo