Toxicity of the mycotoxin fumonisin B1 on the insect Sf9 cell line

Toxicon 129 (2017) 20e27

Contents lists available at ScienceDirect

Toxicon journal homepage: www.elsevier.com/locate/toxicon

Toxicity of the mycotoxin fumonisin B1 on the insect Sf9 cell line He Zhang 1, Liyang Zhang 1, Xue Diao, Na Li, Chenglan Liu* Key Laboratory of Natural Pesticide and Chemical Biology, Ministry of Education, Key Laboratory of Bio-Pesticide Innovation and Application of Guangdong Province, South China Agricultural University, 510642, Guangzhou, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 October 2016 Received in revised form 21 January 2017 Accepted 23 January 2017 Available online 31 January 2017

Fumonisins are a type of mycotoxin produced by Fusarium spp., mainly F. proliferatum and F. vertieilliodes, and represent a potential hazard to the health of animals and human beings. The toxicity and mechanism of action of fumonisins is ambiguous, and it is unclear whether fumonisins are toxic to insect cells. This study examines the toxicity of fumonisin B1 (FB1) and its mechanism of action in the Spodoptera frugiperda Sf9 cell line. We found that FB1 inhibited Sf9 cellular proliferation and arrested cell growth at the G2/M phase. Morphological observation showed that FB1 induced swelling, vacuole formation, and loss of adhesion in Sf9 cells. Flow cytometry analysis showed that FB1 caused depolarization of the cell membrane potential and hyperpolarization of the mitochondrial membrane potential. To uncover potential genes associated with the molecular mechanisms of FB1, 41 differentially expressed genes were identified by transcriptome analyses after FB1 treatment. These genes are putatively involved in detoxification metabolism, insect hormone regulation, cell apoptosis, and other related processes. Finally, six differentially expressed genes were chosen and validated by quantitative real-time PCR (QRT-PCR). Our test could provide a reference for other kinds of insect cells studies on FB1 stress. At the same time, our studies try to provide a possible for FB1 as a precursor compounds of biological insecticide. © 2017 Elsevier Ltd. All rights reserved.

Keywords: Fumonisin B1 Sf9 cell lines Toxicity Genes

1. Introduction Fumonisins are mycotoxins mainly produced by Fusarium vertieilliodes and Fusarium proliferatum, which area worldwide corn contaminants. Animal and human health problems related to these mycotoxins are almost exclusively associated with the consumption of contaminated maize or maize products. It is well known that FB1 is the most prevalent fumonisin and can cause equine leukoencephalomalacia (ELEM) (Marasas et al., 1988a, 1988b), porcine pulmonary oedema (PPE) (Harrison et al., 1990), hepatotoxicity and nephrotoxicity in rodents (Gelderblom et al., 1991), and hepatocarcinomas and oesophageal cancers in humans (Marasas et al., 1988a, 1988b). Many studies have shown that FB1 is toxic to many cell types. Myburg found that FB1 induced dose-dependent apoptosis and necrosis of the human oesophageal carcinoma cell line SNO. Treatment of SNO cells with 4 mM and 8 mM FB1 resulted in blebbing or vesiculation of the plasma membrane and broke up the cells into smaller bodies with no swelling. At higher concentrations of FB1 (16 mM), SNO cells exhibited gross pathology such as

* Corresponding author. E-mail address: [email protected] (C. Liu). 1 These two authors contributed equally to this work. http://dx.doi.org/10.1016/j.toxicon.2017.01.018 0041-0101/© 2017 Elsevier Ltd. All rights reserved.

swelling (Myburg et al., 2009). Qureshi reported that FB1 exposure induced morphological and functional alterations in a chicken peritoneal macrophage cell line, MQ-NCSU, exposed in vitro to various doses of FB1(10e100 mg/kg) (Qureshi and Hagler, 1992). It has been shown that FB1 can induce programmed cell death (PCD) in various plants, such as corn, tobacco, Arabidopsis thaliana, tomatoes, and duckweed and so on (Abbas et al., 1998; Asai et al., 2000; Eugenia De La Torre-Hernandez et al., 2010; Hong Wang, 1996; Kritzinger et al., 2006). However, it is unclear whether fumonisins are toxic to insect cells. The Sf9 cell line is composed of ovarian cells of Spodoptera frugiperda. It is easy to cultivate and can provide appropriate information at the cellular level. The Sf9 cell line has always been regarded as a useful and reliable tool for drug toxicity studies. Our assay takes the Sf9 cells as the research object, aiming to study fumonisin B1's toxicity and its mechanism of action on insect cells. In addition, a large number of cell tests have shown that the cell toxicity of FB1 is associated with treatment time, concentration, and cell type (Domijan, 2012). So our test could provide a reference for other kinds of insect cells studies on FB1 stress. At the same time, our studies try to provide a possible for FB1 as a precursor compounds of biological insecticide. This study examines the toxicity and mechanism of action of FB1 in Sf9 cells. We analyzed cell

H. Zhang et al. / Toxicon 129 (2017) 20e27

proliferation inhibition and morphological changes and used flow cytometry to investigate cell cycle arrest and the membrane potential of the cell and mitochondrial membranes. To detect changes in the gene expression profile, we performed transcriptomic studies using 200 mg/mL FB1to treat cells. 2. Materials and methods 2.1. Chemicals Fumonisin B1 (FB1, 98% pure) was purchased from Pribolab (Singapore) and dissolved in dimethyl sulfoxide (DMSO). DMSO and propidium iodide (PI) were purchased from Sigma Chemical Co. (St. Louis, MO, USA). Phosphate-buffered saline (PBS) contained the following: 8.0 g NaCl, 0.2 g KCl, 0.24 g KH2PO4, and 3.628 g Na2HPO4$12H2O at pH 7.4. SFX-INSECT culture medium was purchased from HyClone (Logan, USA). Foetal bovine serum (FBS) was purchased from Gibco (Milan, Italy). Other reagents and kits used were purchased locally. 2.2. Cell culture Sf9 cells were obtained from the College of Animal Science, South China Agricultural University (Guangzhou, China), and cultivated at 27
C in 25 cm2 flasks in 3 mL of SFX-insect cell culture medium (HyClone, USA)containing 5% FBS. Cells were harvested twice a week and maintained at up to 80e90% confluence. 2.3. Cell proliferation assay Sf9 cell suspensions (1  105 cells/mL) were seeded into 96-well plates (100 mL/well). After 24 h of incubation, the old medium was discarded, and FB1 was added to the new medium at final concentrations of 25, 50, 100, 200, and 400 mg/mL. DMSO (0.1%) was used as the control. After 48 h of treatment, 10 mL of WST-8 was added to the plates, and the plates were incubated in darkness for 3 h at 27
C. The absorbance was measured at 450 nm using a Benchmark microplate reader (Bio-Rad, California). The inhibitory rates were calculated with the following formula: cell viability (%) ¼ (ODtreatment/ODcontrol)  100%. 2.4. Morphological changes FB1 was added to the culture medium at 25, 50, and 200 mg/mL, and 0.1% DMSO was used as the control. Morphological characteristics of Sf9 cells were recorded with an inverted phase-contrast microscope. 2.5. Cell cycle analysis Sf9 cells were seeded and plated at a density of 3  105 cells/mL in 35-mm cell culture plates, the cells were incubated for 24 h, the old medium was discarded; FB1 was added to final concentrations of 25, 50, and 200 mg/mL with new medium; and 0.1% DMSO was used as the control. Cells were collected after 48 h, washed with PBS twice, resuspended with a small amount of PBS, and fixed on ice for 4 h with 70% ethanol. The fixed cells were washed with PBS twice again and then incubated for 30 min at 37
C in 50 mg/mL RNAse. The cells were finally incubated for 30 min at 4
C with 50 mg/mL propidium iodide. The DNA content of the cells was measured by FACS, and the population of each phase was calculated using ModFit software (Becton Dickinson, USA).

21

2.6. The effect of FB1 on Sf9 cell membrane potential Cells were collected at a density of 1  105 cells/mL; incubated for 24 h in 6-well plates; and exposed to 25, 50, and 200 mg/mL of FB1 for 48 h. The cells were then washed with PBS twice. The cells were dyed by DiBAC4(3) staining at a concentration of 5 mg/mL and incubated for 30 min at 27
C in darkness. The samples were immediately analyzed using flow cytometry, and the data were analyzed using CellQuest software (Becton Dickinson, USA).

2.7. The effect of FB1 on Sf9 cell mitochondrial membrane potential Briefly, Sf9 cells were treated with FB1 for 48 h, harvested, resuspended in PBS, washed twice, and then stained with Rhodamine 123 at a final concentration of 5 mg/mL for 30 min at 27
C in darkness. Subsequently, the samples were analyzed using flow cytometry. Finally, the data were analyzed using CellQuest software (Becton Dickinson, USA).

2.8. Total RNA isolation, cDNA library preparation and Illumina sequencing Total RNA from cells with different treatments was extracted using the Trizol Total RNA Isolation Kit (Takara, Japan) according to the manufacturer's instructions. The purity and concentration of total RNA were analyzed using the Nanodrop (Bio-Rad, USA) and 2100 Bioanalyzer (Agilent, USA), respectively. Poly-(A) RNA was separated from total RNA, and the cDNA library for transcriptome sequencing was prepared using the Ultra™ RNA Library Prep Kit (NEB,USA)following the manufacturer's recommendations. The cDNA library was sequenced on the Illumina sequencing platform (Hiseq4000). The raw reads were from cleaned adaptors, and unknown nucleotides larger than 5% were classified as low-quality reads. Unigene function was annotated based on the nr, NT, Swiss-Prot, KEGG, and COG databases using BLAST software. Gene Ontology annotations and COG classification of the unigenes were determined with the Blast2go program. Genes were classified as differentially expressed if the FDR was below 0.001 and the absolute value of the log2-foldchangewas greater than 1.

2.9. Quantitative real-time PCR Six genes that were significantly differentially expressed were chosen for QRT-PCR analysis. The primers were designed with Primer 5.0 software, and they are shown in Table 3. Total RNA was reverse-transcribed using the PrimeScript RT Reagent Kit with gDNA Eraser. The QRT-PCR was performed in triplicate using 200 ng of cDNA, 0.1 mM of primers and SYBR Premix Ex Taq (TaKaRa) on a BioRad iQ5 real-time PCR detection system. The relative expression of the different genes was analyzed according to the 2⊿⊿Ct method. The data analysis was conducted using SPSS20.0 software based on Duncan's multiple range test, with p < 0.05 representing significance.

2.10. Statistical analysis Data are expressed as means ± SD of three replications. Statistical analyses were performed using SPSS 20.0(SPSS, Inc., USA). Significant difference analyses were performed using Duncan's multiple rang test (P < 0.05).

22

H. Zhang et al. / Toxicon 129 (2017) 20e27

3. Results

3.4. FB1-induced Sf9 cell G2/M phase arrest

3.1. Inhibition of cellular proliferation

To evaluate the phase of the cell cycle in which cells were arrested after FB1 treatment, we used flow cytometry. After Sf9 cells were treated with different concentrations of FB1 for 48 h, the percentage of G2/M phase cells increased (Fig. 2a) compared to the control (Fig. 2b). The results suggest that FB1 induced cell cycle G2/ M phase arrest.

Cell viability was assessed with the WTS-8 test. The result showed that there was gradually increased in inhibition rate after 48 h with increasing concentrations of fumonisin B1 (Fig. 1a).

3.5. Mitochondrial membrane potential 3.2. Morphological changes Sf9 cells were treated with 25, 50, and 200 mg/mL FB1for 48 h. Under an inverted phase microscope, untreated cells showed a round shape and were in good growth condition. Following treatment with 25 mg/mL FB1, swelling appeared in some of the cells. The proportion of swollen cells increased, and vacuoles appeared in a portion of cells after treatment with 50 mg/mL FB1. The proportion of vacuoles cells increased after treatment with 200 mg/mL FB1 (Fig. 1b).

3.3. Cell membrane potential After the cells were incubated with FB1 for 48 h, the mean fluorescence intensity (MFI) values of DiBAC4(3) were 131.3, 165.3, 179.6, and 205.4, respectively (Fig. 1c). Compared with the results for the control, the MFI of the treated groups was higher. This result indicates that FB1 caused depolarization of the cell membrane potential.

To test whether there was a change in the mitochondrial membrane potential of Sf9 cells exposed to FB1 for 48 h, we used flow cytometry. The MFI values of Rhodamine 123 were significantly decreased compared to control, according to flow cytometry analysis (Fig. 2c). The results indicate that FB1 decreased the mitochondrial membrane potential of Sf9 cells. 3.6. FB1-induced differential expression of genes in Sf9 cells To uncover potential genes associated with the molecular mechanisms of FB1, we performed microarray experiments on Sf9 cells exposed to 200 mg/L FB1 for 48 h.After FB1 treatment, 41 genes were differentially expressed, with 27 overexpressed and 14 downregulated (Table 1). We found that the toxicity response of Sf9 cells to FB1 was mainly associated with metabolic, developmental, and immune system processes, as well as the response to a stimulus, biological adhesion, and membrane and transporter activity. In addition, genes encoding proteins that are form part of pathwaysdsuch as the metabolism of xenobiotics by cytochrome P450,

Fig. 1. a: Effects of FB1 on cell proliferation. Note: Data in the figure represent mean ± SD. of three replications. b: Effects of FB1 on the morphology of Sf9 cells. 1e4: Effects of FB1 on the morphology of Sf9 cells at 0, 25, 50, and 200 mg/mL c: Effects of FB1on cell membrane potential of Sf9 cells. Compared with the control, the treatments showed significant differences. And there were also significant differences between the treatment groups. Note: Data in the figure represent mean ± SD. of three replications. Different letters indicate significant differences (p < 0.05, Duncan's test).

H. Zhang et al. / Toxicon 129 (2017) 20e27

23

Fig. 2. a: Cell-cycle analysis of Sf9 cells by flow cytometry and DNA content analysis using ModFit software. 1e4: Effects of FB1 on cell cycle of Sf9 cells at 0, 25, 50, and 200 mg/mL b: Analysis of cell-cycle phases distribution after treatment with FB1. FB1-treated group presented a high percentage of cells in G2/M phase as compared to the control group. Note: Data in the figure represent mean ± S.D. of three replications. Different letters indicate significant differences (p < 0.05, Duncan's test). c: Effects of FB1 on mitochondrial membrane potential of Sf9 cells. Treatments showed significant differences compared to the control, but Treatment of 50 mg/mL had no significant differences compared to 25 mg/mL. Note: Data in the figure represent mean ± SD. of three replications.Different letters indicate significant differences (p < 0.05, Duncan's test).

24

H. Zhang et al. / Toxicon 129 (2017) 20e27 Table 1 Differentially expressed genes after Sf9 treatment by FB1.

Ecdysone oxidase Heat shock protein 70 (Hsp70) Glutathione S-transferase s3 protein Dual 30 ,5'-cyclic-AMP and -GMP phosphodiesterase 11-like Nicotinic acetylcholine receptor subunit alpha 7 Anion exchange protein 2 Microsomal glutathione S-transferase 1e3 Juvenile hormone esterase-like Transcription factor MafK-like Toll-like receptor 3 Mitogen-activated protein kinase 15 NADH dehydrogenase (ubiquinone) 1 alpha Spodoptera frugiperda cytochrome P450 Sodium-independent sulfate anion transporter-like tubulin-specific Chaperone cofactor E-like protein Bombyx mori UDP-galactose 4-epimerase Bombyx mori oxidative stress-induced growth inhibitor 1-like Bombyx mori organic cation transporter protein-like Ubiquitin carboxyl-terminal hydrolase UDP-glucuronosyl transferase Circadian clock-controlled protein E3 ubiquitin-protein ligase Siah1-like isoform X1 Ubiquitin carboxyl-terminal hydrolase Maltase-glucoamylase ATP-binding cassette sub-family G member 1 CalmodmLin Retinal dehydrogenase 1-like Bombyx mori RNA-binding protein 12B-like Titin Microtubule-associated protein 1 Down syndrome cell adhesion molecule-like protein Dscam2 Growth factor-like protein Small heat shock protein (Hsp20.4) Arginine kinase Spodoptera frugiperda 40S ribosomal protein S11 Neutral ceramidase Lipase member I-like Myosin-13-like Probable chitinase 3 Serpin B3 Cathepsin B

ubiquitin-mediated proteolysis, starch and sucrose metabolism, glutathione metabolism, the Toll-like receptor signaling pathway, insect hormone biosynthesis, the MAPK signaling pathway, sphingolipid metabolism, and phagosomesdwere also activated after treatment with FB1(Table 2). 3.7. Quantitative real-time PCR analysis To verify the differences in genes expression, we tested transcriptional levels of these genes by QRT-PCR. The result indicated that the 6 differentially expressed genes expression level at transcriptional level exhibited the same trend as genes expression (Fig. 3), conferming the data of transcriptome sequencing was reliable. 4. Discussion As previously determined, FB1 is neurotoxic, hepatotoxic, and nephrotoxic in animals, induces programmed cell death (PCD), and causes diseases in plants. However, little is known about the toxicity and mechanisms of FB1 in insects. In this study, we evaluated the mechanisms involved in FB1cytotoxicityin Sf9 cells in vitro. WST-8 is a compound similar to MTT but has better detection sensitivity and repeatability. Moreover, WST-8 has little toxic effect on cells. This method has been widely used for the large-scale

log2 Ratio

Up or Down

1.06 1.09 2.53 2.35 12.03 4.32 3.04 2.29 2.88 1.46 1.27 1.66 6.33 3.73 1.91 1.66 1.87 1.68 2.32 1.12 2.09 1.27 2.32 1.95 2.88 3.00 2.17 1.15 1.36 1.32 3.20 1.36 1.19 1.09 2.02 1.33 1.99 1.94 1.27 1.22 1.33

Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Up Down Down Down Down Down Down Down Down Down Down Down Down Down Down

screening of anticancer drugs, cell proliferation assays, cytotoxicity tests, and susceptibility tests. The WST-8 results show that FB1inhibits cell growth and viability. Many cytotoxic agents arrest the cell cycle at the G1, S, or G2/M phase and then induce apoptotic cell death (Lu et al., 2006). In animal experiments, DE Marin et al. found that swine peripheral blood mononuclear cells were arrested at the G0/G1 phase of the cell cycle by FB1 (Marin et al., 2007). A similar result suggested that FB1arrested CV-1 cells at the G1 phase and resulted in cell cycle arrest in vitro(Wang et al., 1996a, 1996b). To investigate the effect of FB1 on the cell cycle of the normal human liver cell line HL-7702, Wang et al. discovered that the percentage of cells in the G0/G1 phase was significantly increased by FB1 (Wang et al., 2013). In Sf9 cells, the present study shows that inhibition of cellular proliferation associated with FB1treatment induces a modest accumulation of cells in the G2/M phase. The progression through the cell cycle is controlled by cyclins and cyclin-dependent kinases (CDK) (Giraudo et al., 2011). However, our transcriptomic sequencing microarray results did not show differentially expressed genes associated with cyclins. On the other hand, we observed differentially expressed transcripts that are consistent with an arrest of the cell cycle; microtubule associated protein 1 (EB1) was overexpressed in our experiments and plays an important role during the process of mitosis (Rogers et al., 2002). Genes that affect cell growth and development, such as cell adhesion molecule-like protein and

H. Zhang et al. / Toxicon 129 (2017) 20e27

25

Table 2 KEGG pathway of differentially expressed genes. KEGG pathway

Pathway ID

Metabolism of xenobiotics by cytochrome P450 Drug metabolism other enzymes Retinol metabolism Steroid hormone biosynthesis Linoleic acid metabolism Ubiquitin mediated proteolysis Starch and sucrose metabolism Pentose and glucuronate interconversions Neuroactive ligand-receptor interaction Glycerolipid metabolism Ascorbate and aldarate metabolism Fat digestion and absorption Glutathione metabolism Pancreatic secretion Toll-like receptor signaling pathway Galactose metabolism Insect hormone biosynthesis Pyruvate metabolism Other types of O-glycan biosynthesis Arginine and proline metabolism Steroid biosynthesis Pyrimidine metabolism CytosolicDNA-sensing pathway RNA polymerase Biotin metabolism beta-Alanine metabolism MAPK signaling pathway Sphingolipid metabolism Purine metabolism ABC transporters Cysteine and methionine metabolism Phagosome Folate biosynthesis Neurotrophin signaling pathway

ko00980 ko00983 ko00830 ko00140 ko00591 ko04120 ko00500 ko00040 ko04080 ko00561 ko00053 ko04975 ko00480 ko04972 ko04620 ko00052 ko00981 ko00620 ko00514 ko00330 ko00100 ko00240 ko04623 ko03020 ko00780 ko00410 ko04010 ko00600 ko00230 ko02010 ko00270 ko04145 ko00790 ko04722

growth factor-like protein, are overexpressed (Crossin et al., 1997). In addition, our study found that two insect hormone enzymes are differentially expressed after treatment with FB1, with ecdysone oxidase (EO) and juvenile hormone esterase (JHE) upregulated. Previous results have indicated an important role of EO and JHE in the regulation of 20ehydroxyecdysone and JH titre, thus, in the regulation of development (Campbell et al., 1998; Sun et al., 2012). Therefore, our data suggest that FB1-induced Sf9 cell G2/M phase arrest might be mediated by proteins related to insect growth and development and insect hormones. Morphological observation showed that FB1 induces swelling, vacuole formation, and loss of adhesion in Sf9 cells. Sphingolipid is an important component of the cell membrane and, as a

Number of genes Up-regulation

Down-regulation

17 6 7 5 0 20 21 10 13 5 7 7 7 4 4 9 2 5 6 4 2 1 0 2 0 3 6 1 6 8 1 8 0 2

0 1 0 0 3 0 0 0 1 0 0 0 0 6 0 0 0 1 0 0 1 10 6 6 1 0 2 1 2 0 2 0 2 0

constituent of lipoproteins, acts as a second messenger in the regulation of cell growth and differentiation (Stockmann-Juvala et al., 2008). The chemical structure of FB1 is similar to sphingosine and sphinganine (Domijan et al., 2012). Therefore, Wang et al. hypothesized that disruption of sphingolipid metabolism might be a target for fumonisins. They first showed that FB1 can inhibit de novo sphingolipid biosynthesis in primary rat liver hepatocytes (Wang et al., 1991). In a study by Osuchowski and Sharma, FB1 decreased sphingosine levels in murine N2A neuroblastomas after 4 days of treatment (Osuchowski and Sharma, 2005). Using flow

Table 3 Primers used in RT-QPCR. Genes

cDNA

SIAH1-F SIAH1-R Hsp70-F Hsp70-R GSTs3-F GSTs3-R ASK1-F ASK1-R RPS11-F RPS11-R CYP6AE44-F CYP6AE44-R GAPDHF-F GAPDHF-R

TGCCCCTTACAGAAGTCAGG AGTTTACCCTTCCAGTGGCA TACTGGCCACACTGTCTACG AATGTTCTTTGCCGCAGTGT AATTGGGGAGGCCTATGTCC TACCCAGCGTTCCAGAAAGT ATTTGTGGTTCTCGTGCCTG CCATCACTGTTTTGTCGCCA AAACGTCGGTAAAGGAGTGC CGGAACCGCGCAATAATTGA AAATGCACGCGAAGTCCTTT AGTACGAGTGTGTGACCGAG GTGCCCAGCAGAACATCAT GGAACACGGAAAGCCATAC

Fig. 3. Validation of differential gene expression levels by qRT-PCR. Note: Data in the figure represent mean ± SD. of three replications.

26

H. Zhang et al. / Toxicon 129 (2017) 20e27

cytometry analysis, our research indicates that FB1causes depolarization of the cell membrane potential, and the results suggest that FB1 can induce damage to Sf9 cell membranes. Genes and pathways involved in sphingolipid metabolism were identified, and genes related to sphingosine biosynthesis were differentially downregulated in our study. These data suggest that FB1inhibits sphingosine biosynthesis and thus disrupts sphingolipid metabolism and induces cell membrane damage. Apoptosis induced by FB1 has been observed in many cell types, including human fibroblasts (Galvano et al., 2002), rat glioblastoma cells (Mobio et al., 2003), human proximal tubule-derived cells (Seefelder et al., 2003), human neuroblastoma cells, and glioblastoma and hypothalamic cells (Stockmann-Juvala et al., 2006). However, some cell types do not undergo apoptosis when treated with FB1, such as human leukaemia cells and neoplastic monkey kidney cells (Ciacci-Zanella and Jones, 1999; Wang et al., 1996a, 1996b). Some studies have investigated the mechanisms by which FB1 may induce apoptosis. One study showed that the expression levels of Bcl-2 were increased in the mouse liver after exposure to FB1 (Bhandari et al., 2002). Another study found that caspase-8 was cleaved following FB1 treatment in CV-1 cells (Jones et al., 2001), and another indicated that FB1activated apoptosis via binding to TNF receptors (Zhang et al., 2001). Our flow cytometry analysis results showed that FB1 causes a decrease in mitochondrial membrane potential in Sf9 cells. Mitochondrial membrane potential decreased earlier than DNA cleavage and phosphatidylserine eversion, but also early changes in cell morphology, suggesting that a decrease in mitochondrial membrane potential is a nearly universal event in apoptosis. And that's why the effect of 25 mg/mL FB1 is very dramatic. Genes associated with the Mitogen Activated Protein Kinase (MAPKs) pathway and genes consistent with apoptosis were identified in our study. Thus, we think FB1 may induce apoptosis of Sf9 cells. 5. Conclusion In summary, our research showed that FB1 inhibited Sf9 cellular proliferation, induced significant morphogenetic changes, caused cell membrane damage and mitochondrial membrane potential decrease. We successfully identified 41differentially expressed genes which are putatively involved in detoxification metabolism, insect hormone regulation, cell apoptosis, and other related processes by transcriptome analyses. Our test lay the foundation for exploring the mechanism of FB1action and could provide a reference for other kinds of insect cells studies on FB1 stress. At the same time, our studies try to provide a possible for FB1 as a precursor compounds of biological insecticide. Ethical statement This is an original research article that no part of this paper has been published or submitted elsewhere. Conflict of interest The authors state they have no conflict of interest. Acknowledgements This work was supported by National Natural Science Foundation of China (31371959). References Abbas, H.K., Shier, W.T., Seo, J.A., et al., 1998. Phytotoxicity and cytotoxicity of the

fumonisin C and P series of mycotoxins from Fusarium spp. Fungi. Toxicon 36 (12), 2033e2037. Asai, T., Stone, J.M., Heard, J.E., et al., 2000. Fumonisin B1-induced cell death in Arabidopsis protoplasts requires jasmonate-, ethylene-, and salicylatedependent signaling pathways. Plant Cell 12 (10), 1823e1835. Bhandari, N., Raghubir, P., Sharma, 2002. Modulation of selected cell signaling genes in mouse liver by fumonisin B1. Chem. Biol. Interact. 139 (3), 317e331. Campbell, P.M., Oakeshott, J.G., Healy, M.J., 1998. Purification and kinetic characterisation of juvenile hormone esterase from Drosophila melanogaster. Insect Biochem. Mol. Biol. 28, 501e515. Ciacci-Zanella, J.R., Jones, C., 1999. Fumonisin B1, a mycotoxin contaminant of cereal grains, and inducer of apoptosis via the tumour necrosis factor pathway and caspase activation. Food Chem. Toxicol. 37 (7), 703e712. Crossin, K.L., Tai, M., Krushel, L.A., et al., 1997. Glucocorticoid receptor pathways are involved in the inhibition of astrocyte proliferation. Proc. Natl. Acad. Sci. U. S. A. 94 (6), 2687e2692. Domijan, A., 2012. Fumonisin B1: a neurotoxic mycotoxin. Arh. I Toksikol. 63 (4), 531e544. Domijan, A.M., Kovac, S., Abramov, A.Y., 2012. Impact of fumonisin B1 on glutamate toxicity and low magnesium-induced seizure activity in neuronal primary culture. Neuroscience 202, 10e16. Eugenia De La Torre-Hernandez, M., Rivas-San Vicente, M., Greaves-Fernandez, N., et al., 2010. Fumonisin B1 induces nuclease activation and salicylic acid accumulation through long-chain sphingoid base build-up in germinating maize. Physiol. Mol. Plant Pathol. 74 (5e6), 337e345. Galvano, F., Campisi, A., Russo, A., et al., 2002. DNA damage in astrocytes exposed to fumonisin B1. Neurochem. Res. 27 (4), 345e351. Gelderblom, W.C., Kriek, N.P., Marasas, W.F., et al., 1991. Toxicity and carcinogenicity of the Fusariummoniliforme metabolite, fumonisin B1, in rats. Carcinogenesis 12 (7). Giraudo, M., Califano, J., Hilliou, F., et al., 2011. Effects of hormone agonists on Sf9 cells, proliferation and cell cycle arrest. PLoS One 6 (e2570810). Harrison, L.R., Colvin, B.M., Greene, J.T., et al., 1990. Pulmonary edema and hydrothorax in swine produced by fumonisin B1, a toxic metabolite of Fusariummoniliforme. J. Vet. Diagnos. Investig. Off. Publ. Am. Assoc. Vet. Lab. Diagnos. 2 (3). Hong Wang, J.L.R.M., 1996. Apoptosis: a functional paradigm for programmed plant cell death induced by a host-selective phytotoxin and invoked during development. Plant Cell 8, 375e391. Jones, C., Ciacci-Zanella, J.R., Zhang, Y.G., et al., 2001. Analysis of fumonisin B1induced apoptosis. Environ. Health Perspect. 1092, 315e320. Kritzinger, Q., Aveling, T., van der Merwe, C.F., 2006. Phytotoxic effects of fumonisin B1 on cowpea seed. Phytoparasitica 34 (2), 178e186. Lu, M.C., Yang, S.H., Hwang, S.L., et al., 2006. Induction of G2/M phase arrest by squamocin in chronic myeloid leukemia (K562) cells. Life Sci. 78 (20), 2378e2383. Marasas, W.F., Jaskiewicz, K., Venter, F.S., et al., 1988a. Fusariummoniliforme contamination of maize in oesophageal cancer areas in Transkei. South Afr. Med. J. 74 (3). Marasas, W.F., Kellerman, T.S., Gelderblom, W.C., et al., 1988b. Leukoencephalomalacia in a horse induced by fumonisin B1 isolated from Fusariummoniliforme. Onderstepoort J. Vet. Res. 55 (4), 197e203. Marin, D.E., Gouze, M.E., Taranu, I., et al., 2007. Fumonisin B1 alters cell cycle progression and interleukin-2 synthesis in swine peripheral blood mononuclear cells. Mol. Nutr. Food Res. 51, 1406e1412. Mobio, T.A., Tavan, E., Baudrimont, I., et al., 2003. Comparative study of the toxic effects of fumonisin B1 in rat C6 glioma cells and p53-null mouse embryo fibroblasts. Toxicology 183, 65e75. Myburg, R.B., Needhi, N., Chuturgoon, A.A., 2009. The ultrastructural effects and immunolocalisation of fumonisin B1 on cultured oesophageal cancer cells (SNO). South Afr. J. Sci. 105 (5e6), 217e222. Osuchowski, M.F., Sharma, R.P., 2005. Fumonisin B1 induces necrotic cell death in BV-2 cells and murine cultured astrocytes and is antiproliferative in BV-2 cells while N2A cells and primary cortical neurons are resistant. Neurotoxicology 26 (6), 981e992. Qureshi, M.A., Hagler, W.M.J., 1992. Effect of Fumonisin B1 Exposure on Chicken Macrophage Functions in Vitro, vol. 71. Rogers, S.L., Rogers, G.C., Sharp, D.J., et al., 2002. Drosophila EB1 is important for proper assembly, dynamics, and positioning of the mitotic spindle. J. Cell Biol. 158 (5), 873e884. Seefelder, W., Humpf, H.U., Schwerdt, G., et al., 2003. Induction of apoptosis in cultured human proximal tubule cells by fumonisins and fumonisin metabolites. Toxicol. Appl. Pharmacol. 192 (2), 146e153. Stockmann-Juvala, H., Naarala, J., Loikkanen, J., et al., 2006. Fumonisin B1-induced apoptosis in neuroblastoma, glioblastoma and hypothalamic cell lines. Toxicology 225 (2e3), 234e241. Stockmann-Juvala, H., Alenius, H., Savolainen, K., 2008. Effects of fumonisin B1 on the expression of cytokines and chemokines in human dendritic cells. Food Chem. Toxicol. 46 (5), 1444e1451. Sun, W., Shen, Y., Qi, D., et al., 2012. Molecular cloning and characterization of ecdysone oxidase and 3-dehydroecdysone-3 alpha-reductase involved in the ecdysone inactivation pathway of Silkworm, Bombyxmori. Int. J. Biol. Sci. 8 (1), 125e138. Wang, E., Norred, W.P., Bacon, C.W., et al., 1991. Inhibition of sphingolipid biosynthesis by fumonisins. Implications for diseases associated with

H. Zhang et al. / Toxicon 129 (2017) 20e27 Fusariummoniliforme. J. Biol. Chem. 266 (22). Wang, H., Jones, C., Ciacci-Zanella, J., et al., 1996a. Fumonisins and Alternariaalternatalycopersici toxins: sphinganine analog mycotoxins induce apoptosis in monkey kidney cells. Proc. Natl. Acad. Sci. U. S. A. 93 (8), 3461e3465. Wang, H., Li, J., Bostock, R.M., et al., 1996b. Apoptosis: a functional paradigm for programmed plant cell death induced by a host-selective phytotoxin and

27

invoked during development. Plant Cell 8 (3), 375e391. Wang, S., Liu, S., Yang, L., et al., 2013. Effect of fumonisin B1 on the cell cycle of normal human liver cells. Mol. Med. Rep. 7 (6), 1970e1976. Zhang, Y., Jones, C., Dickman, M.B., 2001. Identification of differentially expressed genes following treatment of monkey kidney cells with the mycotoxin fumonisin B1. Food Chem. Toxicol. 39 (1), 45e53.