Toxicological responses of the hard clam Meretrix meretrix exposed to excess dissolved iron or challenged by Vibrio parahaemolyticus

Aquatic Toxicology 156 (2014) 240–247

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Toxicological responses of the hard clam Meretrix meretrix exposed to excess dissolved iron or challenged by Vibrio parahaemolyticus Qing Zhou a,b , Yong Zhang c , Hui-Fang Peng a , Cai-Huan Ke b,∗ , He-Qing Huang a,b,c,∗∗ a

State Key Laboratory of Stress Cell Biology, School of Life Science, Xiamen University, Xiamen 361102, China State Key Laboratory of Marine Environmental Science, School of Ocean and Earth Science, Xiamen University, Xiamen 361102, China Department of Chemistry, College of Chemistry & Chemical Engineering, and the Key Laboratory of Chemical Biology of Fujian Province, Xiamen University, Xiamen 361102, China b c

a r t i c l e

i n f o

Article history: Received 11 December 2013 Received in revised form 26 August 2014 Accepted 5 September 2014 Available online 16 September 2014 Keywords: Iron Ferritin Iron homeostasis Oxidative stress Immune defense mechanism

a b s t r a c t The responses of genes encoding defense components such as ferritin, the lipopolysaccharide-induced tumor necrosis factor-alpha factor (LITAF), the inhibitor of nuclear factor-␬B (I␬B), metallothionein, and glutathione peroxidase were assessed at the transcriptional level in order to investigate the toxicological and immune mechanism of the hard clam Meretrix meretrix (HCMM) following challenge with iron or a bacterium (Vibrio parahaemolyticus). Fe dissolved in natural seawater led to an increase of Fe content in both the hepatopancreas and gill tissue of HCMM between 4 and 15 days of exposure. The ferritin gene responded both transcriptionally as indicated by real-time quantitative PCR and translationally as shown by western blotting results to iron exposure and both transcriptional and translational ferritin expression in the hepatopancreas had a positive correlation with the concentration of dissolved iron in seawater. Both iron and V. parahaemolyticus exposure triggered immune responses with similar trends in clam tissues. There was a significant post-challenge mRNA expression of LITAF and IB at 3 h, ferritin at 24 h, and metallothionein and glutathione peroxidase at 48 h. This behavior might be linked to their specific functions in physiological processes. These results suggested that similar signaling pathways were triggered during both iron and V. parahaemolyticus challenges. Here, we indicated that the ferritin of Meretrix meretrix was an intermediate in the pathway of iron homeostasis and in its innate immune defense mechanism. © 2014 Elsevier B.V. All rights reserved.

1. Introduction Ferritin is the major iron storage protein for providing reserves in times of iron deficiency and for sequestering potentially toxic excess of iron. Most ferritins in nature consist of a protein shell of 24 subunits surrounding a central core of up to 4500 iron atoms (Bou-Abdallah, 2010). In vertebrates, the ferritin shell is composed of H, M and L subunits. The H subunit, possessing the ferroxidase

Abbreviations: MmFer, ferritin from M. Meretrix; LITAF, lipopolysaccharideinduced tumor necrosis factor-alpha factor; NF-␬B, nuclear factor-kappa B; I␬B, inhibitor of NF-␬B; SOD, superoxide dismutase; V. parahaemolyticus, Vibrio parahaemolyticus; ICP-MS, inductively coupled plasma mass spectrometry; SDS-PAGE, sodium dodecyl sulfate polyacrylamide gel electrophoresis; IRE, iron responsive element; IRP, iron regulatory protein. ∗ Corresponding author. ∗∗ Corresponding author at: State Key Laboratory of Stress Cell Biology, School of Life Science, Xiamen University, Xiamen 361102, China. Tel.: +86 592 2184614; fax: +86 592 2181015. E-mail addresses: [email protected] (C.-H. Ke), [email protected] (H.-Q. Huang). http://dx.doi.org/10.1016/j.aquatox.2014.09.004 0166-445X/© 2014 Elsevier B.V. All rights reserved.

activity, is responsible for iron oxidization, which has been identified in a variety of species including bacteria, plants and invertebrates, while the L subunit has iron nucleation sites that facilitate iron hydrolysis and mineralization (Arosio et al., 2009; Bou-Abdallah, 2010; Wang et al., 2009). The M subunit, containing both the ferroxidase center of the H and iron nucleation site of the L subunit (Andersen et al., 1995; Giorgi et al., 2008; Hu et al., 2010), has been identified in lower vertebrates (mainly fish and amphibians). In vertebrates, ferritin synthesis caused by increased iron levels and oxidative stress has been demonstrated to be regulated at both the transcriptional and posttranscriptional level (Hintze and Theil, 2006). In contrast, it is still unclear in invertebrates, whether ferritin expression can be changed by excess iron and oxidative stress. Iron is a micronutrient and essential element for all living organisms, serving as an important cofactor for enzymes in, e.g., respiration, apoptosis and inflammation (Mackenzie et al., 2008; McLaughlin et al., 2005; Theil, 2003). However, iron at high levels may be toxic to marine invertebrates (Rainbow, 2002), since it causes oxidative injuries and abnormalities in iron metabolism, the effects of which may extend to various biological activities, such as

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247

growth, morphology, behavior and reproduction (Baker et al., 1997; El-Shenawy, 2004; Kucuksezgin et al., 2006; Szefer et al., 2006). Moreover, the iron bioaccumulated after being transferred from seafood to humans through the food chain is suggested to be an important remote cause of disorder pathogenesis including cancer and neurodegenerative diseases (Linehan et al., 2010; Rouault, 2013; Zecca et al., 2004). Iron is commonly added to the culturing system for enhancing the immunity of mollusk larvae and enriching the microalgal growth for feeding the larvae (Chandia et al., 2012; Hu and Richmond, 2004). Any excess iron added to the culture system will increase the mortality of both fish and shellfish larvae (Chandia et al., 2012; Debnath et al., 2012; González et al., 2010; Wei et al., 1999). Marine filter-feeding organisms are able to ingest Fe bound to the dissolved and particulate matter in the water column and near the sediment surface, and bioaccumulate it in their tissues. An elevation of iron content in the soft tissues of aquatic animals has been observed in species such as the shell clam Laternula elliptica, the soft shell clam Mya arenaria, the ocean sunfish Mola mola and red abalone Haliotis rufescens (González et al., 2010; Perrault et al., 2013; Susana Estevez et al., 2002; Tynan et al., 2005), resulting in potential iron toxicity to the cells and tissues. Recent studies demonstrate that Fe exposure can cause tissue abnormalities and affect oxidative status in the bivalves H. rufescens and M. arenaria (Chandia et al., 2012; González et al., 2010). On the other hand, Fe bioaccumulation in bivalves may be significantly promoted through the metal-microalgae-bivalves food chain (Liu et al., 2008; Richmond, 2008; Zhang et al., 2013). Therefore, understanding the defense mechanism of HCMM against Fe-toxicity would give new insights into health management in molluscan aquaculture. The toxicity mechanism of excess iron in mammals has been widely studied using various analytical methods, but its metabolism is less known in invertebrates. Vibrio parahaemolyticus, a pathogenic bacterium of M. meretrix, which occupies an important position amongst the shellfish consumed by humans, has caused serious losses to the clam farming industry from Asia to the United States (Chuang et al., 2009; Ho and Zheng, 1994; McLaughlin et al., 2005). V. parahaemolyticus can be transferred through the ingestion of raw seafood (usually oysters and clams) and triggers acute gastrointestinal illness in humans. It is hypothesized that ferritin is involved in the natural powerful defense mechanism against invaders (Beck et al., 2002; Bullen et al., 2005; Wright et al., 1981) owing to its role of sequestrating iron in a soluble, bioavailable and nontoxic form (Andrews et al., 1992), since iron acquisition is indispensable for bacterial growth and pathogenicity (Bullen, 1981; Bullen et al., 2005). Previous research has focused on studying the response of a single gene against Vibrio challenge. Our work focused on the transcriptional response of ferritin against acute toxicity in order to achieve a good understanding of its role in the toxicological mechanism of excess iron. In addition, we were also interested in knowing and comparing the transcriptional response of various functional genes in different tissues against pathogenic microorganisms to gain further understanding of the immune defense mechanism in marine mollusks, thus giving new insight into disease control and the sustainable culture of hard clams. We seeked to find correlation between ferritin and proteins/peptides in the innate immune defense against both iron and Vibrio challenges. 2. Materials and methods 2.1. Animal collection and maintenance Similarly sized hard clams (M. meretrix, Bivalvia: Meretrix) (3.5–4.5 cm shell length, 1–2 years old) were fished by the

241

fisherman from the coastal waters of Xiamen, China. Clams were selected for experimental use based on their specific morphological features (equal size between the anterior and posterior margins, and the convex posterior dorsal margin), and were acclimated in laboratory conditions for more than 2 weeks, in two aquaria (75 L) containing fully aerated seawater with 30‰ salinity at 22 ± 2 ◦ C, and fed daily with 0.5% of their body weight Isochrysis galbana. 2.2. Fe exposure in vivo In a Fe concentration gradient experiment, 150 clams with similar size were randomly divided into five groups. Each group of 30 specimens was placed into three replicate tanks of 10 clams, containing 20 L of filtered seawater. One group of 30 was used as the control, and the other four groups contained a final concentration of 1, 2, 3 and 4 mg L−1 Fe by adding Fe3+ stock solution. The preparation of Fe3+ stock solution followed the procedure in previous studies (González et al., 2010). In the Fe incubation treatments, seawater was replaced with a fresh solution every day in order to assure both the water quality and a constant Fe content in the medium. 10 mL of seawater from each Fe-treated group (including the control) was sampled for quantitative analysis of the dissolved Fe content. After 96 h exposure, hepatopancreas tissue of five clams (one randomly selected from each of the five treatments) was sampled for RNA extraction. In the case of the time-dependent experiment, 270 clams of similar size were randomly divided into nine groups of 30, and each group was divided into three replicates of 10 clams each. Five individuals of each treatment group were randomly sampled at 0, 6, 12, 24, 36, 48, 72 and 96 h, and both the hepatopancreas and gill tissues were collected for RNA extraction. In the 4 mg L−1 Fe-treated group, hepatopancreas and gill tissues of five clams were collected for total Fe analysis after 0, 4 and 15 days of exposure. Hepatopancreas and gill tissues were also dissected and stored in liquid nitrogen for the next experiment. The minimum concentration (1 mg L−1 ) for the iron exposure test was chosen based on the results described in Chandia et al. (2012) and González et al. (2010). The iron concentration in the experimental seawater was controlled following a report in the Environment Quality Bulletin of Chinese Coastal Waters (unpublished data) and the results (0.05–10 ␮mol L−1 ) described in Li et al. (2011). A relatively high iron concentration was chosen for the 96 h acute exposure. 2.3. Vibrio challenge experiment The V. parahaemolyticus used to challenge the hard clams was obtained from the Third Institute of the State Oceanic Administration in China. The bacterial strain was cultured in liquid 2216E broth (Tryptone 0.5%, yeast extract 0.1%, ferric phosphate 0.01%, and pH 7.6) at 28 ◦ C until the OD600nm value reached 0.7. Cultures were harvested using centrifugation (1000 g for 10 min) and resuspended in filtered artificial seawater before determining the concentration of Vibrio using the dilution-plate method. 240 clams of similar size were randomly divided into eight groups and were exposed to bacteria via immersion by adding Vibrio to the seawater (Fang et al., 2013) at a final bacterial concentration of 5 × 1011 CFU L−1 (the median lethal concentration). Throughout the experiment, the seawater was constantly aerated and changed daily. The clams were fed 2 h before the water change, and the corresponding concentrations of bacteria were added after the seawater change. Five individuals were randomly sampled from each group after 0, 3, 6, 12, 24, 48, 72 and 96 h, and hemocyte, gill, adductor muscle and hepatopancreas tissues from each group were dissected out under sterile conditions. The tissues of identical size and weight from each treatment group were mixed for the mRNA

242

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247

Table 1 Sequence of oligonucleotide primers used in PCR. Primer name

Sequence (5 -3 )

Fer-f1 Fer-r1 Fer-f2 Fer-r2 LATNF-␣-f1 LATNF-␣-r1 I␬B -f1 I␬B-r1 Gpx-f1 Gpx-r1 MT-f1 MT-r1 ␤-Actin-f1 ␤-Actin-r1

GATCCATGGCAGATTCAAGACCT AAGCTTTTAGGATTGCAGTTCTCT CATCTGAGGAGGAACGAG GGGACTGGTTGACGGTTT CAGGAACTGAGAAGGGTGG AATGACGAAGCAGGCAAC GGATTTGGGGAGTGATACAG ATAGCCAGACGAATACCTTG TAAAGTACGTCCGTCCAGG AAACATTCGGGCAAAGAG TAAATGTTCCGAGGACTGT ACTTTAGCCCATCACTTACA GCCCATCTATGAAGGTTAC CAGTGGTGGTGAAAGAATAA

extraction. All the samples were frozen in liquid nitrogen and stored at −80 ◦ C if not used immediately. 2.4. Total Fe content determined using ICP-MS Total Fe content was analyzed using ICP-MS. After washing six times with ddH2 O, the hepatopancreas and gill tissue were dried to a constant dry weight at 105 ◦ C before being ground into powder ready for use. 0.02 g dry weight of each sample was completely dissolved in 10 mL nitric acid (Merck, Germany) using microwave digestion or in a 60 ◦ C water bath overnight. A standard curve was prepared using concentrations of 0, 0.1, 1, 10, 50 and 150 ␮g L−1 ferric iron in 2% nitric acid. The samples were diluted 100 or 1000fold, and then filtered through 0.22 ␮m filter membranes before measuring in triplicate with an Agilent 7700 Series ICP-MS. Seawater samples from the control and Fe-treated group were first centrifuged (10000 g for 30 min), and the supernatant liquids were diluted 10-fold before being filtered by 0.22 ␮m filtered membrane to leach out the particulate iron for determination. 2.5. RNA extraction and ferritin cDNA synthesis Total RNA extraction was performed using the Simple Total RNA Extraction Kit (Tiangen, China), following the protocol recommended by the supplier. cDNA synthesis was performed using the Rever Tra Ace® qPCR RT Kit (Toyobo, Japan) for reverse transcription following the manufacturer’s protocol. If not used immediately, the cDNA was stored at −20 ◦ C. 2.6. Cloning of the MmFer gene The sequences of the genes for specific primer design were obtained in the NCBI database (GenBank: DQ069277.1), and the specific primer sequences (Fer-f1 and Fer-r1) are shown in Table 1. The PCR reaction was performed using a PCR Amplification Kit (Takara, Japan) in a final volume of 50 ␮L following the recommended protocol. The PCR program was 1 cycle of 95 ◦ C for 5 min for denaturation; followed by 35 cycles of 95 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 1 min; then 1 cycle at 72 ◦ C for 7 min, and finally 4 ◦ C. The PCR products were sequenced by Invitrogen, China. 2.7. Distribution of ferritin The tissue-specific profile of ferritin was analyzed using realtime quantitative PCR in an Applied Biosystem StepOne fast RT-PCR System (Applied Biosystems, USA). Gene-specific primers Fer-f2 and Fer-r2 (Table 1) were designed to amplify a 180 bp product. A pair of M. meretrix ␤-actin primers was used to amplify a 150 bp fragment as the internal control. Each sample was run in

triplicate along with the internal control. The total RNA extraction, cDNA synthesis, reaction component were conducted as previously described in Section 2.5. The real-time quantitative PCR program was 1 cycle of 95 ◦ C for 30 s for denaturation; followed by 35 cycles of 95 ◦ C for 5 s, 60 ◦ C for 30 s then 1 cycle at 72 ◦ C for 7 min, and finally 4 ◦ C. All data were given in terms of relative mRNA expression as means ± S.D. 2.8. Quantification of the mRNA expression of the gene encoding ferritin and four other genes The mRNA expression of genes encoding ferritin, LITAF, I␬B, glutathione peroxidase and metallothionein after Vibrio or iron exposure was analyzed using real time PCR. (Whenever the phrase gene expression is used in the present article, it is taken to be synonymous to mRNA expression, although it is acknowledged that in addition to transcription, gene expression is also regulated, e.g., at mRNA stability, translational and protein stability level). All the primers designed to amplify a PCR fragment ranging 150–200 bp are shown in Table 1. ˇ-Actin was used as the internal control. The total RNA extraction, cDNA synthesis, and reaction components were conducted as previously described in Sections 2.5 and 2.6. The amplified reaction followed the protocol of the SYBR ExScript qRTPCR Kit (Takara, Japan). The 2−Ct method was used to analyze the relative expression level of the five genes. The formula was defined as follows: Cttreatment (the threshold cycle of ferritin treatment clams) = Ctferritin treatment − Ctactin treatment ; Ctcontrol (the threshold cycle of ferritin treatment clams) = Ctferritin control − Ctactin control ; and Ct = Cttreatment − Ctcontrol . One-way analysis of variance was performed on all data using SPSS 16.0 statistical software. The least significant difference method was performed to determine the significant difference between treated and control groups. P values less than 0.05 were considered statistically significant (*), and P values less than 0.01 were considered extremely significant (**). 2.9. Western blotting analysis Tissues were defrosted on ice and homogenized in RIPA buffer (50 mmol L−1 Tris–HCl pH 8.0, 150 mmol L−1 NaCl, 0.1% (v/v) NP-40, 0.5% (w/v) sodium deoxycholate, 0.5% (w/v) SDS). Tissue lysates were run on a 12% SDS-PAGE gel and transferred onto a PVDF membrane (0.45 ␮m) blocked with 5% (w/v) nonfat milk in TBST (50 mmol L−1 Tris–HCl pH7.6, 150 mmol L−1 NaCl, 0.1% (v/v) Tween 20) for 1 h, and then incubated overnight at 4 ◦ C with a 1:2000 dilution of primary anti-ferritin monoclonal antibody (Roche, Switzerland). The ferritin antibody was detected using a 1:2000 dilution of IgG conjugated to HRP (Boster, China) and developed with ECL western blotting substrate (Pierce, USA). 3. Results 3.1. Tissue-specific MmFer expression Real time PCR was carried to examine the expression profile of MmFer in the hemocyte, adductor muscle, hepatopancreas, gill, and mantle tissues. The results showed that MmFer expression was detected in all the tissues tested, with highest levels in the adductor muscle and hepatopancreas, a moderate level in the mantle and gill tissues, and lowest levels in the hemocytes (Fig. 1). 3.2. Accumulation of Fe in the hepatopancreas and gill The results in Table 2 showed that the concentration of dissolved iron in the seawater of the Fe-treated group accounted for approximately 5.0% of the total Fe content. An evident time-dependent increase of the total Fe content in hepatopancreas and gill tissues

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247

243

Fig. 3. MmFer mRNA expression levels under different Fe concentration exposure. The temporal relative expression of MmFer in hepatopancreas tissue was analyzed using quantitative real time PCR. The mRNA level of MmFer was normalized to that of ˇ-actin. Values are shown as means ± S.D. (n = 4).

Fig. 1. MmFer expression levels in different tissues. Quantitative real time PCR was performed to analyze the gill, hepatopancreas, mantle, adductor muscles and hemocytes of adult M. meretrix. Vertical bars represent the mean ± S.D. (n = 4). ˇ-Actin was used as the internal control. Table 2 The dissolved Fe content in the seawater of the Fe-treated group. The total Fe content in treatment groups seawater (mg/L)

The actual dissolved Fe concentration in seawater (␮g/L)

Control 1 2 3 4

22.26 ± 2.44 74.38 ± 7.36 126.29 ± 8.98 176.29 ± 9.10 182.13 ± 12.58

was demonstrated. In the 4 mg L−1 treatment, where the total Fe content was 438 ± 64 ␮g/g and 657 ± 116 ␮g/g dry weight in the gill and hepatopancreas tissues, respectively, after 15 days of exposure; but the increment in the total Fe content in the former was lower than that in the latter (Fig. 2). 3.3. Protein expression of ferritin using western blotting and mRNA expression using real time PCR To investigate the expression of ferritin in vivo corresponding to the iron concentration in seawater, the hard clams were challenged with 1, 2, 3 and 4 mg L−1 Fe3+ . The results indicated that the ferritin expression induced by iron showed a significant increment within the hepatopancreas tissue at both transcriptional and translational level, which was closely related to the increasing trend of iron concentration in the environment (Figs. 3 and 4).

Fig. 4. Western blotting analysis of ferritin expression exposed to different Fe3+ concentrations. Samples were prepared from the hepatopancreas tissue of hard clams. The results shown in the figure from left to right are the control group, and the 1, 2, 3 and 4 mg L−1 Fe treatment groups.

3.4. Expression profiles of genes encoding five proteins after Fe exposure The transcriptional responses of genes encoding ferritin, LITAF, I␬B, metallothionein and glutathione peroxidase were analyzed using quantitative real time PCR in animals under iron stress (Fig. 5). After 4 mg L−1 iron exposure, the expression of genes encoding these five proteins was upregulated with a difference in the significant response time; 6 h in LITAF and IB, 24 h in ferritin, 36–72 h in metallothionein, and 72–96 h in glutathione peroxidase. In addition, a similar change in trend of the expression of the genes encoding these five proteins could be found in the hepatopancreas and gill tissues, whereas the ferritin expression profile significantly differed in the two tissues: the ferritin expression in hepatopancreas tissue was twice up-regulated and significantly increased 3.8-fold (P < 0.01) 24 h post-challenge compared to the control (Fig. 5A). On the other hand, a significant increase of ferritin expression in gill tissue was displayed 36 h post-challenge (2.5-fold, P < 0.01) (Fig. 5B). 3.5. mRNA expression of the genes encoding the five proteins in response to Vibrio challenge In order to examine whether the ferritin, LITAF, IB, glutathione peroxidase and metallothionein from M. meretrix were involved in the innate immune defense against V. parahaemolyticus challenge,

Fig. 2. The total Fe content in different tissues from M. meretrix exposed to seawater supplemented with 4 mg L−1 Fe3+ . (A) In hepatopancreas tissue; (B) in gill tissue. The total Fe content was assessed using ICP-MS. Measurement was performed for three duplicates. P values (P < 0.05) were considered statistically significant (*).

244

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247

Fig. 5. The temporal expression of the mRNA of genes encoding five proteins in response to Fe exposure. (A) In hepatopancreas tissues; (B) in gill tissues. ˇ-actin was the internal reference. Significant differences (P < 0.05) and extremely significant differences (P < 0.01) are indicated with one asterisk (*) or two asterisks (**), respectively.

Fig. 6. The temporal expression of the mRNA of genes encoding five proteins in response to V. parahaemolyticus challenge analyzed using quantitative real time PCR. (A) In hepatopancreas tissue; (B) in hemocyte; (C) in adductor muscle; (D) in gill tissue. The mRNA levels were normalized to that of ˇ-actin. Values are shown as mean ± S.D. (n = 4). Significant differences (P < 0.05) and extremely significant differences (P < 0.01) are indicated with one asterisk (*) or two asterisks (**).

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247

245

the mRNA expression in hepatopancreas, hemocyte, adductor muscles and gill tissues was quantified using quantitative real time PCR (Fig. 6). It was clearly seen that the mRNA expression of the genes encoding these five proteins (Fig. 6B) were upregulated to varying degrees following V. parahaemolyticus challenge, whereas the expression pattern of the genes encoding each protein was nearly similar in different tissues. The significantly different response times for LITAF and IB (3 h), ferritin (24 h), metallothionein (24–48 h) and glutathione peroxidase (48 h) could be observed post-challenge. The highest increase of the mRNA of the genes encoding ferritin (3.5fold), I␬B (3.1-fold), and glutathione peroxidase (11-fold) (P < 0.01) (Fig. 6B) was found in hemocytes, for that encoding metallothionein in hepatopancreas (10-fold, P < 0.01) and for that encoding LITAF in gill (5-fold, P < 0.01) (Fig. 6A and D). In addition, the expression level of genes encoding most proteins showed a similar trend of upregulation, downregulation and then gradual recovery to normal levels 96 h post-challenge. In contrast, the mRNA expression of LITAF continuously decreased from 3 h to 96 h post-challenge.

4. Discussion 4.1. Response of MmFer in the treatment groups Iron exposure resulted in Fe accumulation in the hepatopancreas and gill tissues (Fig. 2). Excess iron accumulating in the tissues may disturb iron homeostasis and cause iron toxicity as well as tissue abnormalities (González et al., 2010). Numerous studies show the changes in ferritin content in mollusks experimentally challenged with metals or bacteria, and these changes are considered to be defense responses against pathogens and heavy toxicity (González et al., 2010; Li et al., 2012; Orino and Watanabe, 2008; Tynan et al., 2005; Zhu et al., 2011). Nevertheless, the effects of iron on ferritin expression in bivalves have been rarely reported. In our work, a significant increase of ferritin expression was induced by iron and by bacterial exposure. Interestingly, V. parahaemolyticus exposure caused a significant increase in ferritin 24 h post-challenge as well as iron exposure in all the tissues tested apart from gill (Figs. 5A and 6). This result suggested that ferritin was implicated in immune response defense against both Vibrio and iron challenges. Similar expression profiles between iron and Vibrio challenges could be related to the involvement of MmFer in regulation of the iron level and the resistance systems of redox stress in the innate immune systems. Fe(III) can be reduced back to Fe(II) through the Fenton reaction, resulting in an increase in the levels of ROS, such as hydroxyl radicals and superoxide which cause cell injuries by attacking macromolecular structures such as cell membrane, proteins and DNA (Fig. 7) (Arosio and Levi, 2010; De Almeida et al., 2004; Torti and Torti, 2002). Similarly, Vibrio can induce the ROS production as a result of respiratory bursts of hemocytes endocytosing and eliminating pathogens (Fig. 7) (De Zoysa et al., 2008; Ellis, 2001; Magnadóttir, 2006; Simon et al., 2000). Both oxidative stress and the level of cellular iron are important factors for regulating the IRP activity: when the levels of both the stress and the iron are increased, IRP cannot bind to IRE in the 5 untranslated region of ferritin, resulting in the promotion of translation to ferritin protein (Arosio and Levi, 2010). Thus, ferritin increase may be a cytoprotective response to mitigate the oxidative stress induced by iron overload or Vibrio challenge. On the other hand, ferritin increase may contribute to the defense mechanism against bacterial challenge by sequestering free iron from the cellular environment into the ferritin core to suppress the growth of pathogens, since iron acquisition is indispensible for bacterial growth and pathogenicity (Fig. 7) (Bullen, 1981; Bullen et al., 2005). In addition,

Fig. 7. Hypothetical pathway of hard clam defense against Vibrio and exposure to excess iron. The solid arrows indicate that the pathways have been previously verified and the dotted arrows indicate that the pathways have been proposed but that the mechanisms are unclear in hard clams. ROIs: reactive oxygen intermediates.

MmFer responded significantly faster transcriptionally in gill tissue (3 h post-challenge) than in other tissues, a result similar to that recorded for Atlantic cod and channel catfish challenged with the pathogens Aeromonas salmonicida and Edwardsiella ictaluri (Feng et al., 2009; Peatman et al., 2007). The reason may be that gill tissue is the direct and main interface with the aquatic environment and is the most sensitive one to environmental bacteria. In our study, the expression of ferritin in hepatopancreas tissue was positively correlated with the dissolved iron concentration in seawater, and similar results are also observed between ferritin expression and environmental Cd2+ concentration in the oyster (Zhu et al., 2011), suggesting a new perspective for ferritin being a potential biomarker for monitoring the level of environmental metals. 4.2. Response of genes encoding cytokine-related proteins in the treatment groups LITAF and I␬B are two important transcription factors involved in the regulation of TNF-␣ factor and NF-␬B which play major roles in diverse biological processes including immunity, inflammation, apoptosis, proliferation and cellular-stress response (Skaug et al., 2009; Tang et al., 2005; Vallabhapurapu and Karin, 2009). During V. parahaemolyticus or iron challenges, both LITAF and IB showed a similar expression pattern in all the tissues tested and significantly increased 3 h post-challenge (faster than ferritin), which was consistent with observations in the pacific oyster Crassostrea gigas, bay scallop Argopecten irradians and Haliotis discus discus (De Zoysa et al., 2010; Yu et al., 2012; Zhang et al., 2011). Provided that the mRNA level changes are reflected in the protein level changes these results suggest that both LITAF and I␬B are inducible acute-phase proteins, and primarily participate in the signaling pathways of the immune defense mechanism in M. meretrix. Activation of NF-␬B and TNF-␣ is essential for the initiation of host inflammation and an innate anti-microbial response (Naumann, 2000). However, overproduction of NF-␬B and TNF-␣ is lethal to the host (Beg et al., 1995; Naumann, 2000). Thus, upregulation of both LITAF and I␬B are likely to contribute to the suitable inhibition of TNF-␣ and NF-␬B activation upon Vibrio or iron challenges, which may be a mechanism for keeping balance between protecting the host and killing pathogens (Fig. 7) (Zhang

246

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247

et al., 2011). Further, it has been reported that NF-␬B regulates the expression of large numbers of downstream genes involved in the immune response and inflammation in different organisms. Similarly, ferritin could be implicated in ROS control via regulating the cellular iron levels. Considering that increase in ferritin significantly responded at 24 h, far behind IB and LITAF at 3 h post-challenge, we speculate that ferritin is induced downstream of NF-␬B and is involved in the process of NF-␬B-mediated control of ROS through iron sequestration in M. meretrix. (However, we know only transcriptional time course, not that of the resultant protein gene products). This is because infection by microorganisms induces phagocytosis and causes large amounts of ROS to be formed (Segal, 2005), which have stimulatory effects on NF-␬B through the activation of I␬B kinase (Gloire et al., 2006; Schoonbroodt and Piette, 2000). However, owing to the limited information regarding NF-␬B and TNF-␣ in hard clams, our speculation needs to be further verified after acquisition of more details about transcription factors in the hard clams. 4.3. Response of genes encoding detoxification-related proteins in the treatment groups Cysteine-rich metallothionein with low molecular weight plays important roles in metal absorption, accumulation, detoxification and homeostasis (Roesijadi, 1996), and has a strong affinity to bind class B metal cations such as Cd, Hg, Cu and Ag. Numerous studies show a change in metallothionein expression after experimental challenge with metals such as Cd and Hg (Serafim and Bebianno, 2010; Wang et al., 2010). In our study, both iron challenge and V. parahaemolyticus exposure induced a significant increase in metallothionein mRNA. Provided that the change is also seen at protein level, this indicates that the metallothionein from M. meretrix might be involved in iron metabolism and immune defense against V. parahaemolyticus. The trend of metallothionein expression induced by Vibrio exposure was in line with that in previous studies on other bivalves (Canesi et al., 2010; Jenny et al., 2006). However, the specific mechanism of Fe inducing metallothionein mRNA expression remains unclear. A direct evidence of Fe binding to metal-responsive elements of metallothionein gene has not been confirmed. Binding has been demonstrated for some metals such as Cd2+ and Hg2+ . So what is the reason for the metallothionein increase induced by Fe exposure? We suggest that the induction of metallothionein limits the effects of hydroxyl (OH• ) and superoxide (O2 − ) radicals by scavenging them to reduce the oxidative stress in the immune defense mechanism of M. meretrix (Fig. 7), since metallothioneins are considered as radical scavengers through their reaction with superoxide and hydroxyl radicals generated in the Fenton reaction, and endocytosis of pathogens, as well ˜ as the respiratory burst of bivalves (Fan et al., 2007; Munoz et al., 2000; Thornalley and Vaˇsák, 1985). Furthermore, glutathione peroxidase may participate in the above described process through catalyzing the comversion of hydrogen peroxide to water with the oxidation of glutathione (Flohé and Günzler, 1984). Notably, the transcription of glutathione peroxidase gene of M. meretrix responds much faster to V. parahaemolyticus if the animals are injected with the bacterial suspension (6 and 12 h; Wang et al., 2011) than if they are immersed in water containing the bacteria (48 h). The difference in the significant response time may be related to the challenge approaches between immersion and injection. The involvement of antioxidant enzymes in regulating Fe and Vibrio effects, such as SOD and CAT, is also demonstrated in other bilvalves such as Crassostrea virginica (Fang et al., 2013; Liu et al., 2007; Wang et al., 2010). Therefore, the rapid increase in the transcription of the glutathione peroxidase gene in all tissues tested may be a direct result of eliminating peroxide toxicity for maintaining the redox state of the immune system of M. meretrix (Fig. 7).

The differential expression of the mRNA of the genes encoding the five proteins implied complexity in the mechanism of M. meretrix defense against acute Fe toxicity and Vibrio challenge. Based on the results described here and previously, we summarized the basic mechanism pathway as shown in Fig. 7. 5. Conclusions The Fe accumulated in the hepatopancreas tissue of M. meretrix induced a significant increase in both the mRNA and protein expression of ferritin, which was positively correlated with the concentration of environmental dissolved iron. The ferritin, LITAF, I␬B, metallothionein and glutathione peroxidase from M. meretrix play different roles in response to iron or V. parahaemolyticus exposure. LITAF and I␬B are involved in host defense in the immune response to kill pathogens, whereas ferritin is an intermediate for regulating cellular iron levels. In addition, metallothionein and glutathione peroxidase respond synchronously and perform antioxidant functions to counteract ROS toxicity. Our results present a comprehensive blueprint of the molecular response to defend against excess Fe or Vibrio exposure, and contribute to our understanding of the innate immune mechanism which benefits disease control in the aquaculture of hard clams. The level of ferritin expression in vivo has a strong potential for use in monitoring iron contamination in seawater. Acknowledgements This study was supported by funds of the 973 National Key Fundamental Research Program (No. 2010CB12643) from the Chinese Ministry of Science and Technology. Professor John Hodgkiss is thanked for his help with the English in this manuscript. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.aquatox. 2014.09.004. References Andersen, O., Dehli, A., Standal, H., Giskegjerde, T., Karstensen, R., Rørvik, K., 1995. Two ferritin subunits of Atlantic salmon (Salmo salar): cloning of the liver cDNAs and antibody preparation. Mol. Mar. Biol. Biotechnol. 4, 164–170. Andrews, S.C., Harrison, P.M., Yewdall, S.J., Arosio, P., Levi, S., Bottke, W., von Darl, M., Briat, J.F., Laulhère, J.P., Lobreaux, S., 1992. Structure, function, and evolution of ferritins. J. Inorg. Biochem. 47, 161–174. Arosio, P., Ingrassia, R., Cavadini, P., 2009. Ferritins: a family of molecules for iron storage, antioxidation and more. Biochim. Biophys. Acta: Gen. Subj. 1790, 589–599. Arosio, P., Levi, S., 2010. Cytosolic and mitochondrial ferritins in the regulation of cellular iron homeostasis and oxidative damage. Biochim. Biophys. Acta: Gen. Subj. 1800, 783–792. Baker, R., Martin, P., Davies, S., 1997. Ingestion of sub-lethal levels of iron sulphate by African catfish affects growth and tissue lipid peroxidation. Aquat. Toxicol. 40, 51–61. Beck, G., Ellis, T.W., Habicht, G.S., Schluter, S.F., Marchalonis, J.J., 2002. Evolution of the acute phase response: iron release by echinoderm Asterias forbesi coelomocytes, and cloning of an echinoderm ferritin molecule. Dev. Comp. Immunol. 26, 11–26. Beg, A.A., Sha, W.C., Bronson, R.T., Baltimore, D., 1995. Constitutive NF-kappa B activation, enhanced granulopoiesis, and neonatal lethality in I kappa B alphadeficient mice. Genes Dev. 9, 2736–2746. Bou-Abdallah, F., 2010. The iron redox and hydrolysis chemistry of the ferritins. Biochim. Biophys. Acta: Gen. Subj. 1800, 719–731. Bullen, J., 1981. The significance of iron in infection. Rev. Infect. Dis. 3, 1127–1138. Bullen, J.J., Rogers, H.J., Spalding, P.B., Ward, C.G., 2005. Iron and infection: the heart of the matter. FEMS Immunol. Med. Microbiol. 43, 325–330. Canesi, L., Barmo, C., Fabbri, R., Ciacci, C., Vergani, L., Roch, P., Gallo, G., 2010. Effects of vibrio challenge on digestive gland biomarkers and antioxidant gene expression in Mytilus galloprovincialis. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 152, 399–406.

Q. Zhou et al. / Aquatic Toxicology 156 (2014) 240–247 Chandia, L.A.P., Alfaro, A.C., Aguilar, R.F., Godoy, M., Venegas, A.G., 2012. Histological evidence of accumulation of iron in postlarvae of red abalone, Haliotis rufescens. Aquacult. Res. 43, 1635–1642. Chuang, G., Chen, J., Zhou, Y., Huang, C.G., Chen, H., 2009. The cause of massive mortality of clam Meretrix meretrix Linnaeus in Qidong city, Jiangsu province. Fish. Sci. (Dalian) 28, 656–658. De Almeida, E.A., Miyamoto, S., Bainy, A.C.D., de Medeiros, M.H.G., Di Mascio, P., 2004. Protective effect of phospholipid hydroperoxide glutathione peroxidase (PHGPx) against lipid peroxidation in mussels Perna perna exposed to different metals. Mar. Pollut. Bull. 49, 386–392. Debnath, M., Saha, R.K., Kamilya, D., Saikia, D., Saha, H., 2012. Effects of water borne iron on spawn of Indian major carps (Catla catla (Ham.), Labeo rohita (Ham.) and Cirrhinus mrigala (Ham.)). Bull. Environ. Contam. Toxicol. 89, 1170–1174. De Zoysa, M., Nikapitiya, C., Oh, C., Whang, I., Lee, J.S., Jung, S.J., Choi, C.Y., Lee, J., 2010. Molecular evidence for the existence of lipopolysaccharide-induced TNF␣ factor (LITAF) and Rel/NF-kB pathways in disk abalone Haliotis discus discus. Fish Shellfish Immunol. 28, 754–763. De Zoysa, M., Pushpamali, W.A., Oh, C., Whang, I., Kim, S.J., Lee, J., 2008. Transcriptional up-regulation of disk abalone selenium dependent glutathione peroxidase by H2 O2 oxidative stress and Vibrio alginolyticus bacterial infection. Fish Shellfish Immunol. 25, 446–457. El-Shenawy, N.S., 2004. Heavy-metal and microbial depuration of the clam Ruditapes decussatus and its effect on bivalve behavior and physiology. Environ. Toxicol. 19, 143–153. Ellis, A., 2001. Innate host defense mechanisms of fish against viruses and bacteria. Dev. Comp. Immunol. 25, 827–839. Fan, Z., Yang, A., Lv, Z., Liu, Z., 2007. Effects of Vibrio anguillarum on immune activities of Chlamys farreri. South China Fish. Sci. 3, 52–55. Fang, Y., Yang, H., Liu, B., Zhang, L., 2013. Transcriptional response of lysozyme, metallothionein, and superoxide dismutase to combined exposure to heavy metals and bacteria in Mactra veneriformis. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 157, 54–62. Feng, C.Y., Johnson, S.C., Hori, T.S., Rise, M., Hall, J.R., Gamperl, A.K., Hubert, S., Kimball, J., Bowman, S., Rise, M.L., 2009. Identification and analysis of differentially expressed genes in immune tissues of Atlantic cod stimulated with formalinkilled, atypical Aeromonas salmonicida. Physiol. Genomics 37, 149–163. Flohé, L., Günzler, W.A., 1984. Assays of glutathione peroxidase. Methods Enzymol. 105, 114. Giorgi, A., Mignogna, G., Bellapadrona, G., Gattoni, M., Chiaraluce, R., Consalvi, V., Chiancone, E., Stefanini, S., 2008. The unusual co-assembly of H-and M-chains in the ferritin molecule from the Antarctic teleosts Trematomus bernacchii and Trematomus newnesi. Arch. Biochem. Biophys. 478, 69–74. Gloire, G., Legrand-Poels, S., Piette, J., 2006. NF-␬B activation by reactive oxygen species: fifteen years later. Biochem. Pharmacol. 72, 1493–1505. González, P.M., Abele, D., Puntarulo, S., 2010. Exposure to excess dissolved iron in vivo affects oxidative status in the bivalve Mya arenaria. Comp. Biochem. Physiol. C: Toxicol. Pharmacol. 152, 167–174. Hintze, K., Theil, E., 2006. Cellular regulation and molecular interactions of the ferritins. Cell. Mol. Life Sci. 63, 591–600. Ho, J.S., Zheng, G.X., 1994. Ostrincola koe (Copepoda, Myicolidae) and mass mortality of cultured hard clam (Meretrix meretrix) in China. Hydrobiologia 284, 169–173. Hu, Y.H., Zheng, W.j., Sun, L., 2010. Identification and molecular analysis of a ferritin subunit from red drum Sciaenops ocellatus. Fish Shellfish Immunol. 28, 678–686. Hu, Q., Richmond, A., 2004. Handbook of microalgal culture. Biotechnol. Appl. Phycol., 83–94. Jenny, M.J., Warr, G.W., Ringwood, A.H., Baltzegar, D.A., Chapman, R.W., 2006. Regulation of metallothionein genes in the American oyster (Crassostrea virginica): ontogeny and differential expression in response to different stressors. Gene 379, 156–165. Kucuksezgin, F., Kontas, A., Altay, O., Uluturhan, E., Darılmaz, E., 2006. Assessment of marine pollution in Izmir Bay: nutrient, heavy metal and total hydrocarbon concentrations. Environ. Int. 32, 41–51. Li, J., Li, L., Zhang, S., Li, J., Zhang, G., 2012. Three ferritin subunits involved in immune defense from bay scallop Argopecten irradians. Fish Shellfish Immunol. 32, 368–372. Li, Y.P., Liu, X.Q., Pan, X.J., Yan, W., 2011. Evaluation of the iron concentration in seawater using flame atomic absorption spectrometry. Chin. J. Spectrosc. Lab. 28, 1283–1286. Linehan, W.M., Srinivasan, R., Schmidt, L.S., 2010. The genetic basis of kidney cancer: a metabolic disease. Nat. Rev. Urol. 7, 277–285. Liu, C.H., Tseng, M.C., Cheng, W., 2007. Identification and cloning of the antioxidant enzyme, glutathione peroxidase, of white shrimp, Litopenaeus vannamei, and its expression following Vibrio alginolyticus infection. Fish Shellfish Immunol. 23, 34–45. Liu, Z.Y., Wang, G.C., Zhou, B.C., 2008. Effect of iron on growth and lipid accumulation in Chlorella vulgaris. Bioresour. Technol. 99, 4717–4722. Mackenzie, E.L., Iwasaki, K., Tsuji, Y., 2008. Intracellular iron transport and storage: from molecular mechanisms to health implications. Antioxid. Redox Signal. 10, 997–1030. Magnadóttir, B., 2006. Innate immunity of fish (overview). Fish Shellfish Immunol. 20, 137–151. McLaughlin, J.B., DePaola, A., Bopp, C.A., Martinek, K.A., Napolilli, N.P., Allison, C.G., Murray, S.L., Thompson, E.C., Bird, M.M., Middaugh, J.P., 2005. Outbreak of Vibrio

247

parahaemolyticus gastroenteritis associated with Alaskan oysters. N. Engl. J. Med. 353, 1463–1470. ˜ ˜ R., Rodrı´ıguez, J., van der Knaap, W.P., Mialhe, E., Bachère, E., Munoz, M., Cedeno, 2000. Measurement of reactive oxygen intermediate production in haemocytes of the penaeid shrimp, Penaeus vannamei. Aquaculture 191, 89–107. Naumann, M., 2000. Nuclear factor-␬B activation and innate immune response in microbial pathogen infection. Biochem. Pharmacol. 60, 1109–1114. Orino, K., Watanabe, K., 2008. Molecular, physiological and clinical aspects of the iron storage protein ferritin. Vet. J. 178, 191–201. Peatman, E., Baoprasertkul, P., Terhune, J., Xu, P., Nandi, S., Kucuktas, H., Li, P., Wang, S., Somridhivej, B., Dunham, R., 2007. Expression analysis of the acute phase response in channel catfish (Ictalurus punctatus) after infection with a Gramnegative bacterium. Dev. Comp. Immunol. 31, 1183–1196. Perrault, J.R., Buchweitz, J.P., Lehner, A.F., 2013. Essential, trace and toxic element concentrations in the liver of the world’s largest bony fish, the ocean sunfish (Mola mola). Mar. Pollut. Bull. 79, 348–353. Rainbow, P.S., 2002. Trace metal concentrations in aquatic invertebrates: why and so what? Environ. Pollut. 120, 497–507. Richmond, A., 2008. Handbook of Microalgal Culture: Biotechnology and Applied Phycology. Blackwell Publishing, Australia. Roesijadi, G., 1996. Metallothionein and its role in toxic metal regulation. Comp. Biochem. Physiol. C: Pharmacol. Toxicol. Endocrinol. 113, 117–123. Rouault, T.A., 2013. Iron metabolism in the CNS: implications for neurodegenerative diseases. Nat. Rev. Neurosci. 14, 551–564. Schoonbroodt, S., Piette, J., 2000. Oxidative stress interference with the nuclear factor-␬B activation pathways. Biochem. Pharmacol. 60, 1075–1083. Segal, A.W., 2005. How neutrophils kill microbes. Annu. Rev. Immunol. 23, 197. Serafim, A., Bebianno, M., 2010. Effect of a polymetallic mixture on metal accumulation and metallothionein response in the clam Ruditapes decussatus. Aquat. Toxicol. 99, 370–378. Simon, H.U., Haj-Yehia, A., Levi-Schaffer, F., 2000. Role of reactive oxygen species (ROS) in apoptosis induction. Apoptosis 5, 415–418. Skaug, B., Jiang, X., Chen, Z.J., 2009. The role of ubiquitin in NF-␬B regulatory pathways. Annu. Rev. Biochem. 78, 769–796. Susana Estevez, M., Abele, D., Puntarulo, S., 2002. Lipid radical generation in polar (Laternula elliptica) and temperate (Mya arenaria) bivalves. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 132, 729–737. Szefer, P., Fowler, S., Ikuta, K., Osuna, F.P., Ali, A., Kim, B.S., Fernandes, H., Belzunce, M.J., Guterstam, B., Kunzendorf, H., 2006. A comparative assessment of heavy metal accumulation in soft parts and byssus of mussels from subarctic, temperate, subtropical and tropical marine environments. Environ. Pollut. 139, 70–78. Tang, X., Marciano, D.L., Leeman, S.E., Amar, S., 2005. LPS induces the interaction of a transcription factor, LPS-induced TNF-␣ factor, and STAT6 (B) with effects on multiple cytokines. Proc. Natl. Acad. Sci. U.S.A. 102, 5132–5137. Theil, E.C., 2003. Ferritin: at the crossroads of iron and oxygen metabolism. J. Nutr. 133, 1549S–1553S. Thornalley, P.J., Vaˇsák, M., 1985. Possible role for metallothionein in protection against radiation-induced oxidative stress. Kinetics and mechanism of its reaction with superoxide and hydroxyl radicals. Biochim. Biophys. Acta: Protein Struct. Mol. Enzymol. 827, 36–44. Torti, F.M., Torti, S.V., 2002. Regulation of ferritin genes and protein. Blood 99, 3505–3516. Tynan, S., Eggins, S., Kinsley, L., Welch, S., Kirste, D., 2005. Mussel shells as environmental tracers: an example from the Loveday Basin. Regolith, 314–317. Vallabhapurapu, S., Karin, M., 2009. Regulation and function of NF-␬B transcription factors in the immune system. Annu. Rev. Immunol. 27, 693–733. Wang, C., Huan, P., Yue, X., Yan, M., Liu, B., 2011. Molecular characterization of a glutathione peroxidase gene and its expression in the selected Vibrio-resistant population of the clam Meretrix meretrix. Fish Shellfish Immunol. 30, 1294–1302. Wang, Q., Wang, X., Wang, X., Yang, H., Liu, B., 2010. Analysis of metallotionein expression and antioxidant enzyme activities in Meretrix meretrix larvae under sublethal cadmium exposure. Aquat. Toxicol. 100, 321–328. Wang, X., Liu, B., Xiang, J., 2009. Cloning, characterization and expression of ferritin subunit from clam Meretrix meretrix in different larval stages. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 154, 12–16. Wei, W.Q., Li, A.J., Li, D.S., Zhang, S.L., Sun, Z.Z., 1999. Effects of iron added in fodder on the growth of juvenile Paralichthys olivaceus. J. Fisher. China 23, 100–103. Wright, A.C., Simpson, L.M., Oliver, J.D., 1981. Role of iron in the pathogenesis of Vibrio vulnificus infections. Infect. Immun. 34, 503–507. Yu, F., Zhang, Y., Yu, Z., 2012. Characteristics and expression patterns of the lipopolysaccharide-induced TNF-␣ factor (LITAF) gene family in the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol. 33, 899–908. Zecca, L., Youdim, M.B., Riederer, P., Connor, J.R., Crichton, R.R., 2004. Iron, brain ageing and neurodegenerative disorders. Nat. Rev. Neurosci. 5, 863–873. Zhang, Q.H., Huang, L., Zhang, Y., Ke, C.-H., Huang, H.Q., 2013. Proteomic approach for identifying gonad differential proteins in the oyster (Crassostrea angulata) following food-chain contamination with HgCl2 . J. Proteomics 94, 37–53. Zhang, Y., He, X., Yu, Z., 2011. Two homologues of inhibitor of NF-kappa B (I␬B) are involved in the immune defense of the Pacific oyster, Crassostrea gigas. Fish Shellfish Immunol. 30, 1354–1361. Zhu, B., Lin, Q., Ke, C.H., Huang, H.Q., 2011. Single subunit type of ferritin from visceral mass of Saccostrea cucullata: Cloning, expression and cisplatin-subunit analysis. Fish Shellfish Immunol. 31, 453–461.