Transcription factor GATA-3 in Atlantic salmon (Salmo salar): Molecular characterization, promoter activity and expression analysis

Molecular Immunology 46 (2009) 3099–3107

Contents lists available at ScienceDirect

Molecular Immunology journal homepage: www.elsevier.com/locate/molimm

Transcription factor GATA-3 in Atlantic salmon (Salmo salar): Molecular characterization, promoter activity and expression analysis Jaya Kumari ∗ , Jarl Bogwald, Roy A. Dalmo ∗∗ Department of Marine Biotechnology, Norwegian College of Fishery Science, University of Tromsø, N-9037 Tromsø, Norway

a r t i c l e

i n f o

Article history: Received 5 March 2009 Received in revised form 27 May 2009 Accepted 4 June 2009 Available online 2 July 2009 Keywords: GATA-3 Transcription factor T-cell Promoter Atlantic salmon

a b s t r a c t GATA-3 is a T cell-specific transcription factor and is essential for the development of the T cell lineage and differentiation of T helper type 2 cells. We have identified and characterized the full-length Atlantic salmon GATA-3 cDNA (3074 bp), having two zinc finger domains which are fully conserved within teleosts and higher vertebrates. RT-PCR analysis revealed that the Atlantic salmon GATA-3 (AsGATA-3) is strongly expressed in gills, thymus, and brain. Moreover, the involvement of GATA-3 in Atlantic salmon immune response was demonstrated by investigating the early time dependent expression profile of GATA-3 in spleen and head kidney following intraperitoneal injection of live Aeromonas salmonicida, LPS, and ␤glucan. Furthermore, we have determined 1.9 kb of upstream promoter sequence and found a number of sequence motifs which match those of known transcription factor binding sites and the AsGATA-3 promoter is a TATA-less promoter. Activities of presumptive regulatory regions of this gene were assessed by transfecting different 5 deletion constructs and the result showed the basal promoter and positive transcriptional regulator activity of AsGATA-3 gene is determined by sequences located between +58 and −199 bp upstream of the transcriptional start site (TSS). This study provides further insights into the transcriptional regulation of AsGATA-3. © 2009 Elsevier Ltd. All rights reserved.

1. Introduction GATA-3 belongs to the hematopoietic subfamily of GATA zinc finger transcription factors and is a key factor for Th2 cell differentiation (Zheng and Flavell, 1997). The six mammalian GATA proteins (GATA-1 to GATA-6) share related Cys-X2-Cys-X17-CysX2-Cys (where X represents any amino acid residue) and bind to the consensus motif 5 -(A/T)GATA(A/G)-3 (Orkin, 1992). GATA-3 possesses N-terminal transactivation domains and two zinc fingers, namely the N-terminal zinc finger and the C-terminal zinc finger. The C-terminal zinc finger is essential for DNA binding, whereas the N-terminal zinc finger stabilizes this binding and physically interacts with other zinc finger proteins such as the Friends of GATA (FOG) (Fox et al., 1998; Tevosian et al., 1999). The C-terminal region of GATA-3 is highly conserved among the GATA family proteins. The amino acid motif (YxKxHxxxRP), adjacent to the C-terminal zinc finger domain of GATA-3, is important for GATA-3 DNA binding and GATA-3 functions, including the transcriptional activity and the ability to induce chromatin remodeling of the T-helper cell

∗ Corresponding author. Tel.: +47 776 46023; fax: +47 776 45110. ∗∗ Corresponding author. Tel.: +47 776 44482; fax: +47 776 45110. E-mail addresses: [email protected], jaya [email protected] (J. Kumari), [email protected] (R.A. Dalmo). 0161-5890/$ – see front matter © 2009 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2009.06.008

type 2 (Th2) cytokine gene loci leading to Th2 cell differentiation (Shinnakasu et al., 2006). The N-terminal zinc finger and C-terminal zinc finger thus play different roles in the induction of IL-4, IL-13, and IL-5 (Takemoto et al., 2002). GATA-3 was first identified as a transcription factor that binds to the TCR␣ gene enhancer (Ho et al., 1991). Expression of GATA-3 in the hematopoietic lineages is restricted to T-cells and NK cells (Ho et al., 1991). Consensus GATA-3 binding sites are required for the expression of multiple T cell genes (Ho et al., 1991). In teleosts, GATA transcription factors have been well studied using transgenic or mutant zebrafish (Heicklen-Klein et al., 2005). It has been shown that zebrafish GATA-3 is expressed in the central nervous system and thymus at early development (Neave et al., 1995; Trede et al., 2001). However, there is only one report in crucian carp on the role of GATA-3 in the fish immune system (Takizawa et al., 2008). Moreover, in salmon, several Th1/Th2 cytokine genes, such as IFN-␥, IL-15 and IL-10 have been identified. This recent progress in genomic sequencing of Atlantic salmon encouraged us to isolate and characterize the GATA-3 gene, which is essential for the expression of Th2 cytokines, in order to investigate the presence of Th1 and Th2 cells and the Th1/Th2 balance and regulation in fish. In the present study, we isolated full-length cDNA of Atlantic salmon GATA-3 (AsGATA-3) and also performed the promoter and expression analysis of GATA-3 with the aim to delineate the regulation of GATA-3 in teleosts for the first time.

3100

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

2. Materials and methods 2.1. Fish Atlantic salmon weighing 70–100 g were kept at the Aquaculture Research Station (Tromsø, Norway) in circular 200 L tanks supplied with re-circulating freshwater at an ambient temperature of approximately 10 ◦ C with 12/12 h illumination and fed a commercial pellet diet. Prior to treatment, fish were anaesthetised in 0.005% benzocaine. Fish were sacrificed using 0.01% benzocaine prior to collection of different tissues. The experimental protocols used for Atlantic salmon in this study have been reviewed and approved by the Ethics and Animal Welfare Committee of Norway (FDU). 2.2. Molecular cloning and sequencing of AsGATA-3 cDNA A partial salmon EST sequence homologous to vertebrate GATA3 was identified based on nucleotide and amino acid sequence homology to zebrafish and Japanese medaka GATA-3 sequence in GenBank using the BLAST program (http://www.ncbi.nlm.nih. gov/BLAST). Internal primers were designed from the AsEST sequence and AsGATA-3 clones were obtained from the cDNA library obtained from the stimulated spleen tissue and sequenced. 3 - and 5 -RACE was performed using a GeneRacerTM Kit (Invitrogen, Carlsbad, CA, USA) according to manufacturer’s instruction. Total RNA (3 ␮g) isolated from Atlantic salmon (∼80 g) spleen tissue using TRIZOL® Reagent (Invitrogen) was used as a template and reverse transcribed using SuperscriptTM III RT and the GeneRacerTM Oligo dT primer. Primers used for the 5 - or 3 -RACE are listed in Table 1. PCR products were gel purified using MinElute Gel Extraction kit (QIAgen, Hilden, Germany) and cloned in a TOPO vector (Invitrogen). Plasmid DNA from at least six independent clones

was purified using QIAprep Spin Miniprep kit and sequenced using M13F and M13R primers (Invitrogen Life Technologies) and Big Dye Terminator v 3.1. The full-length nucleotide sequence obtained by 3 /5 -RACE was reconfirmed by PCR amplification using the primers situated at the extreme ends (AsGATA-3-F1/AsGATA-3NF2 and AsGATA-3-R1/AsGATA-3-NR2). The cDNA sequence and deduced amino acid sequence of Atlantic salmon GATA-3 were analysed using the BLAST program, the ExPASy Molecular Biology server (http://us.expasy.org) and Pfam (Finn et al., 2008). Amino acid identity and similarity were done with the Matrix Global Alignment Tool (MatGAT) program v 2.0 (Campanella et al., 2003) using default parameters. Multiple amino acid sequence alignments were constructed with ClustalW2 program and further edited using GeneDoc, version 2.7. Phylogenetic tree was constructed using the neighbour-joining method using the MEGA v 4.0 program (Tamura et al., 2007). The topological stability of the tree was evaluated by 10 000 bootstrap re-samplings. 2.3. Isolation of 5 -flanking region of the AsGATA-3 gene by genome walking The 5 -flanking region of the GATA-3 gene was isolated using the Universal GenomeWalker Kit (Clontech, Palo, Alto, CA, USA). Four GenomeWalker libraries were constructed according to the manufacturer’s instructions. For each genome walker experiment two adjacent reverse primers were designed in the 5 -UTR region of the target gene (Table 1), and used in two PCRs in combination with the forward adaptor primers AP1 and AP2 (Clontech) for each library. The resulting PCR products from four different libraries were cloned in TOPO vector (Invitrogen), sequenced and analysed as described above. In order to verify this new sequence, a forward primer (AsGATA3F) was designed within this new sequence and used with a

Table 1 List of primers and their designated applications. Primer name

Sequence 5 –3

Application

AsGATA-3-F AsGATA-3-R AsGATA-3-NR AsGATA-3-F1 AsGATA-3-NF2 AsGATA-3-R1 AsGATA-3-NR2 AsGATA-3-PriR AsGATA-3-SecR AP1 AP2 AsGATA-3F AsGATA-3R AsGATA-3-F AsGATA-3-R AsGATA-3-probe As18S-F As18S-R As18S-Probe AsGATA-3KpnIF1 AsGATA-3KpnIF2 AsGATA-3MluIF AsGATA-3BglIIR AsGATA-3SalIF1 AsGATA-3SalIF2 AsGATA-3SalIF3 AsGATA-3SacIIR M13 F M13 R T3 F T7 R pMetLuc-R pSEAP2-F pSEAP2-R

CCCACGACAGCATGGACGACTTC GGTGATGATGGTGGGCGGAGGATT AGTTTCATGCTCTCGGCCAGGGACA CAGTCGCCAACAGGAGGAGAAAG GGTGTCCCTGGCCGAGAGCATG GCTGCTCTTCTCCATCAGGCTCTTG GGAGAAGTCGTCCATGCTGTCGTG GTCGTATCCAGTCCCACTCAAAAGTTCCTC GTAGGTGGCTTAGTGCAAACTGACTAGCAC GTAATACGACTCACTATAGGGC ACTATAGGGCACGCGTGGT CTGATGACACTGACAGACCCTCCTTAAG GAGGGGATACTGCGAGGGGTCCATGTA CCCAAGCGACGACTGTCT TCGTTTGACAGTTTGCACATGATG FAM-TTCCTGCCCGTCTTGC-NFQ GATCCATTGGAGGGCAAGTCT CGAGCTTTTTAACTGCAGCAACTTT FAM – TTGGAGCTGGAATTAC – NFQ CGGGGTACCCCTCATTGCATATGATGGATG CGGGGTACCCCTATAATAACGCGCCTGTCACCGCGAGAG CGACGCGTCGCCATCCTGAAAGAATGCCTTC GAAGATCTGTAGGTGGCTTAGTGCAAACTGACTAGCAC ACGCGTCGACCCTCATTGCATATGATGGATG ACGCGTCGACTATAATAACGCGCCTGTCACCGCGAGAG ACGCGTCGACCGCCATCCTGAAAGAATGCCTTC TCCCCGCGGGTAGGTGGCTTAGTGCAAACTGACTAGCAC CAG GAA ACA GCT ATG AC GTA AAA CGA CGG CCA G ATT AAC CCT CAC TAA AGG GA TAA TAC GAC TCA CTA TAG GG CACGATGTCGATGTTGGGG CTAGCAAAATAGGCTGTCCC CCTCGGCTGCCTCGCGGTTCC

3 -RACE 5 -RACE 5 -RACE 3 -RACE/full cDNA sequencing 3 -RACE/full cDNA sequencing 5 -RACE/full cDNA sequencing 5 -RACE/full cDNA sequencing Genome walking Genome walking Genome walking Genome walking Promoter check Promoter check Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR Real-time PCR SEAP construct SEAP construct SEAP construct SEAP construct pMet Luciferase construct pMet Luciferase construct pMet Luciferase construct pMet Luciferase construct Sequencing Sequencing Sequencing Sequencing Sequencing Sequencing Sequencing

Note. Restriction endonuclease site are underlined.

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

3101

Fig. 1. Nucleotide and deduced amino acid sequence of Atlantic salmon GATA-3 cDNA. The zinc fingers domains are underlined. Uppercase denotes the UTR’s and lowercase denotes the coding regions. Start and stop codons are shaded and marked with bold letters. The asterisk indicates the stop codon. The RNA instability motif (ATTTA) is marked with bold and underlined. The putative polyadenylation signal is bold and doubly underlined.

3102

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

reverse primer (AsGATA-3R) designed within the transcribed region of the GATA-3 gene (Table 1). PCR from the Atlantic salmon genomic DNA was performed and the products obtained were cloned and sequenced. Identification of transcription factor binding motives was performed with TRANSFAC® (Biobase International) and MatInspector version 6.2 (Cartharius et al., 2005).

ligated (T4 DNA ligase) to generate the above mentioned constructs for each basic reporter vector (pMet Luciferase and pSEAP2) in parallel. All plasmid DNA constructs were isolated using Plasmid Mini Kit (Qiagen) to have pure quality plasmid for transfection. All plasmid constructs were verified by restriction map analysis and DNA sequencing.

2.4. Construction of reporter gene plasmids

2.5. Cell culture, transfection and reporter activity assay

Deletion constructs with successive removal of the 5 -region were generated by PCR using the forward primers AsGATA-3KpnIF1, AsGATA-3KpnIF2, AsGATA-3MluIF having recognition sequences for restriction endonuclease KpnI, and MluI while the reverse primer (corresponds to region 58 bases downstream to TSS) AsGATA-3BglIIR (Table 1) had an BglII restriction site to generate the constructs p(1904/+58), p(854/+58), and p(−199/+58), respectively. Similarly, the same 5 -deletion construct was made in parallel using forward primers having SalI and reverse with SacII restriction sites (Table 1). The promoterless pMet Luciferase Reporter and pSEAP2-Basic Vectors were used as reporter plasmids for cloning. Both the PCR products of different 5 -deletion constructs and the basic reporter vectors were digested with their respective restriction enzymes (New England BioLab Inc., Ipswich, MA, USA) and

HeLa cells (obtained from the Medical faculty, Tromsø, Norway) were grown in Dulbecco’s modified Eagle’s medium (DMEM) with l-glutamine (Gibco, Grand Island, NY, USA) supplemented with 100 units/ml penicillin and 100 ␮g/ml streptomycin, 10% heatinactivated fetal calf serum (Gibco) and 1% non-essential amino acids at 37 ◦ C in a 5% humified CO2 incubator. The day before transfection, 2 × 104 cells were seeded per well of a 96-well plate (Nunc) in 100 ␮l growth medium. The cells were co-transfected with 0.3 ␮g of the different GATA-3 promoter-pMetLuc reporter constructs, promoterless pMetLuc Reporter, and pMetLuc control vector and 0.1 ␮g of different GATA-3 promoter-SEAP Reporter constructs, promoterless pSEAP basic, and pSEAP2 control vector (for normalizing transfection efficiency) using Polyfect Transfection Reagent (QIAgen) according to the manufacturer’s instructions. The plasmid DNA

Fig. 2. Multiple alignment of the deduced amino acid sequences of GATA-3 in salmon and other vertebrates by the ClustalW2 program. Residues shaded in black are completely conserved across all species aligned, and residues shaded in grey refer to 80–90% identity. Dashes indicate gaps. The zinc finger domains are indicated by solid lines below the alignment and the YxKxHxxxRP motif is indicated. The GenBank accession numbers of the GATA-3 sequences are as follows: medaka, NP 001098188; ginbuna, BAF98873; zebrafish, NP 571286; xenopus (African clawed frog), P23773; chicken, NP 001008444; mouse, NP 032117; Norway rat, NP 579827; pig, NP 001038032; cattle, NP 001070272; human, NP 001002295.

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

of each construct was prepared using the Plasmid Mini Kit (QIAgen). 24 h after transfection, the media was removed and replaced by media with or without 100 ng/ml Aeromonas salmonicida LPS (gift from Tim Bowden and Ian Bricknell, FRS Marine Laboratory, Scotland) to activate the signal transduction pathway. After 24 h of incubation with LPS, the culture medium was collected and analysed for Metridia luciferase using Ready-To-GlowTM Secreted Luciferase Reporter System (Clontech) and SEAP activity using Great EscAPeTM SEAP Chemiluminescence Detection Kit (Clontech) and then the luciferase and SEAP activity was assayed using a plate Luminometer, Luminoskan Ascent (Thermo Electron Corporation, Finland). The experiment was carried out in triplicate for each construct, and the Luciferase activity was normalized to the SEAP activity. 2.6. Tissue specific expression of AsGATA-3 The expression pattern of GATA-3 in different tissues was measured by real-time PCR. Total RNA from the tissues of liver

3103

spleen, head kidney, gill, thymus, intestine, heart, skin, brain, ovary and testis was extracted from Atlantic salmon by the TRIZOL® method. 2.7. In vivo infection and immunostimulation Atlantic salmon (80–100 g) were injected intraperitoneally (i.p.) with 0.1 ml suspension of 1.3 × 106 cells of live A. salmonicida (virulent strain, LFI 4017) in PBS. Head kidney, spleen were collected from six fishes 4 h, day 1, 2, and day 4 after injection. Two groups of Atlantic salmon (70–100 g) were injected intraperitoneally (i.p.) [0.1 ml/fish (1 mg/kg fish)] with LPS (from A. salmonicida) and ␤-glucan [(␤(1,3)-d-glucan (laminaran)], respectively and the fish controls were injected with PBS. Sampling of head kidney and spleen were performed 1, 2, 4, and 7 days postinjection from three fish per group. All organs were rapidly kept in RNA-later (Ambion, Austin, TX, USA) and processed for subsequent RNA isolation and quantitative real-time PCR analysis.

Fig. 3. Phylogenetic tree showing the relationship between AsGATA-3 and other vertebrate GATA-1, GATA-2 and GATA-3 amino acid sequences. The phylogram was constructed with the MEGA 4.0 software using the neighbour-joining method based on an amino acid alignment (ClustalW) of the full-length protein. Numbers beside the internal branches indicate bootstrap values based on 10 000 replications. The 0.05 scale indicates the genetic distance. Accession numbers for GATA-3 are listed in the legend of Fig. 2. The accession numbers of GATA-1 amino acid sequences are as follows: zebrafish, NP 571309; medaka, NP 001098355; frog, NP 001079109; Norway rat, NP 036896; mouse, NP 032115; human, NP 002040. The accession numbers of GATA-2 amino acid sequences are as follows: zebrafish, NP 571308; medaka, NP 001098356; frog, P23770; chicken, NP 001003797; Norway rat, NP 254277; mouse, NP 032116; pig, NP 999044; human, NP 116027.

3104

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

2.8. RNA isolation, reverse transcription and TaqMan® real-time PCR Total RNA was extracted by TRIZOL® (Invitrogen) according to manufacturer’s instruction. To remove any contaminating genomic DNA, samples were treated with DNase (TURBO DNA-freeTM , Ambion). Purified RNA was confirmed to be intact by gel electrophoresis while RNA concentration and purity were measured spectrophotometrically (Nano-Drop Technologies, Wilmington, USA). The synthesis of cDNA was performed with TaqMan®

RT Reagents (Applied Biosystems, CA, USA) using random hexamers and 500 ng total RNA as template in a 50 ␮l reaction volume. Real-time PCR was performed in duplicates with an ABI PRISM 7500 Fast Real-Time PCR System (Applied Biosystems) using TaqMan® Fast Universal PCR Master Mix (2×), No AmpErase® UNG and TaqMan® primers (18 ␮M) and probe (5 ␮M) according to manufacturer’s instruction. Real-time primers and probes for target gene GATA-3 and the endogenous control 18S are listed in Table 1. The following amplification program was used: Hotstart at 95 ◦ C

Fig. 4. Gene sequence of the AsGATA-3 promoter. The nucleotide sequence of promoter regions (1.9 kb) was determined. The transcription start site is designated as +1 is boxed. Transcription factor binding sites were predicted by MatInspector and TRANSFAC® . Consensus elements of transcription factor binding sites are underlined, while (−) sign indicates the binding sites identified on the negative strand. Bold letter indicates several GA boxes. Doubly underlined region indicates CACCC box.

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

for 20 s followed by 40 cycles of denaturation for 3 s and annealing/extension for 30 s at 60 ◦ C. In all cases amplifications were specific and no amplification was observed in negative controls (non-template control and non-reverse transcriptase control). The Ct values for each sample were converted into fold differences according to the relative quantification method (Pfaffl, 2001). 18S rRNA was found to be the most stable reference gene and it was highly expressed and required high dilution (1:10 000) of the template. 2.9. Statistical analysis The results were expressed as the mean ± S.E.M. of the results obtained from six fishes. Where applicable the data were analysed by one-way analysis of variance (ANOVA) followed by Duncan’s multiple range test using SPSS 16.0 software. Differences were considered statistically significant when P < 0.05. 3. Results 3.1. Sequencing and characterization of salmon GATA-3 To obtain full-length cDNA of AsGATA-3, 5 - and 3 -RACE were performed using spleen derived cDNA as template. The full-length AsGATA-3 cDNA sequence (GenBank accession no. EU418015) was found to be 3074 bp in length, including a 492 bp 5 -untranslated region (UTR), a 1326 bp open reading frame, and a 1256 bp 3 -UTR. Within the 3 -UTR, a polyadenylation signal (AATAAA) and a mRNA instability motif (ATTTA) were found (Fig. 1). The putative GATA-3 protein in Atlantic salmon is predicted to be 441 aa long, with a calculated molecular weight of 48.1 kDa and a pI of 9.49. The multiple alignment analysis revealed that the AsGATA-3 shared high amino acid identities ranging from 88% to 79% compared to other vertebrates. The amino acid sequence of the two zinc finger domains (N- and C-finger) seemed to be completely conserved from fish to mammals (Fig. 2). The phylogenetic analysis (Fig. 3) clearly showed the divergence within the GATA family. GATA-3 forms a separate cluster different from GATA-1 and GATA-2. The tree also revealed that the evolution of the GATA-3 gene in teleosts follows the same route with mammalian, avian and amphibians suggesting that the evolution of GATA-3 gene is very much conserved. 3.2. Structure of 5 -flanking region of AsGATA-3 gene As the first step towards understanding the transcriptional regulation of the salmon GATA-3 gene, a sequence of 1904 bp lying 5 to the TSS was determined (GenBank accession no. FJ360616).

3105

Sequence analysis using the transcription factor binding site prediction program MatInspector and TRANSFAC® revealed several notable features. First, there is no TATA or CCAAT motif around the TSS, instead a HIP1 binding site and YY1 (activator/repressor binding to TSS) is present near the TSS. An AT rich region exists between nt −370 and −734 which includes one consensus TATA box and several TATA like sequences. Secondly, GA rich region exists from nt −26 to −161. Third, two CCAAT and several GC box sequences were found. GATA consensus sequences are also present within this region. E-box, NF-␬B and ETS-binding sites, known to be enriched in T cell-specific gene regulatory regions, are also found in this region. Lastly, CACCC box is present at position nt −933 which is also known to be important for transcriptional regulation of genes in T cells. Other putative transcription factor-binding sites are shown in Fig. 4.

3.3. Functional mapping of AsGATA-3 promoter To analyse the promoter activity of the obtained 5 -flanking region of the salmon GATA-3 gene, the promoter-reporter plasmid p(−1900/+58) construct was transfected into the HeLa cell line and the putative promoter driven luciferase activity was measured. A 57-fold increase of normalised luciferase activity compared to promoter-less controls (pMetLuc-Reporter) was recorded, indicating that the cloned 5 -flanking region represented the functional promoter of the AsGATA-3 gene. To precisely define the 5 -end of TSS of salmon GATA-3 that is required for the induced activation, progressive deletion constructs of the AsGATA-3 promoter region were generated and transiently transfected into HeLa cells that were subsequently stimulated with LPS. This experiment showed that the LPS inducible promoter activity was chiefly dependent on the cis-elements located in the DNA region of the smaller construct (Fig. 5). This was supported by the observation that further deletions of the GATA-3 promoter DNA did not affect the reporter activity. In other way, the LPS-stimulated group showed significant increase in reporter activity compared to its respective control group for all reporter constructs, but with no significant differences within the different promoter constructs.

3.4. Tissue distribution of AsGATA-3 expression in healthy salmon As shown in inset in Fig. 6A, the expression of AsGATA-3 was widely distributed in all the tissues examined, with the highest level of expression in the gills, thymus and brain. Moderate transcript levels were observed in skin and spleen, whereas weak expression was detected in the head kidney, heart, intestine, testis and ovary, with the lowest expression in the liver.

Fig. 5. The structural and functional analysis of the 5 -upstream region of the salmon GATA-3 gene. HeLa cells were transiently transfected with 0.3 ␮g of GATA-3 promoter/luciferase plasmid and 0.1 ␮g of GATA-3 promoter/SEAP plasmid (internal control). HeLa cells were stimulated with LPS and after 24 h, luciferase activities were measured. Units of luciferase activity were normalised to activity of cotransfected pSEAP (relative luciferase activity). The error bars represent S.E.M. values (n = 3). Asterisks (*) above the bars show significant difference (P < 0.05) compared to control. The bent arrow represents the salmon GATA-3 transcriptional start site.

3106

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

Fig. 6. Tissue specific expression of GATA-3 in Atlantic salmon at different time-points. (A) Expression analysis after A. salmonicida infection. Inset figure shows expression characterization of AsGATA-3 in different organs as detected by real-time PCR using liver as a calibrator. The value above the bars shows average real-time CT values of six fish. Data represented as mean ± S.E.M. (n = 6). Statistical differences (P < 0.05) between different time-points are indicated by different letters (a and b) and asterisks (inset figure) above the bars. (B and C) Expression of GATA-3 at different time-points after ␤-glucan and LPS injection in spleen and head kidney, respectively. Each bar represents the mean ± S.E.M. (n = 3). Statistical differences between different treatment and control are indicated by asterisks (*) above the bars. For all experiments, data were normalized to 18S rRNA expression.

3.5. In vivo regulation of the expression of AsGATA-3

4. Discussion

mRNA expression levels of AsGATA-3 at different time intervals following bacterial infection were examined in the spleen and head kidney. In the spleen, the increase in GATA-3 mRNA expression level was at its maximum at day 1 post-challenge, where after the expression decreased to “resting” level at days 2 and 4. In contrast to the spleen, a consistent high head kidney expression was found with no significant differences within each time period following infection (Fig. 6A). In another experiment, expression of GATA-3 mRNA was induced in a time-dependent manner in both spleen and head kidney by LPS and ␤-glucan injections. Significant (P < 0.05) increase in GATA-3 mRNA expression was found at day 1 post-␤-glucan injection in spleen, and high levels of expression (not significant) was found at day 7 post-LPS injection. In the head kidney, significant increase in GATA-3 expression was observed at day 1 post-LPS injection (Fig. 6B and C). On the other hand, ␤-glucan injection showed no significant increase in head kidney AsGATA-3 expression with respect to controls at any time points.

In the present study we report on the isolation, molecular characterization and expression of a novel T cell transcription factor, GATA-3 in Atlantic salmon. Based on the obtained sequence information we delineate for the first time the putative transcription start site of the AsGATA-3 mRNA, identifying the regions required for the basal expression and LPS-induced up-regulation of the GATA-3 gene. We obtained the full-length cDNA of GATA-3 and the tissue expression was analysed. AsGATA-3 was strongly expressed in gills (a mucosa-associated lymphoid tissue), thymus, and brain which is in agreement with the reports on zebrafish (Neave et al., 1995), and in crucian carp (Takizawa et al., 2008) where GATA-3 was suggested to be involved in T-cell differentiation and maturation. Similarly, GATA-3 has been found to play a crucial role in T cell differentiation in mammalian species (Murphy and Reiner, 2002). Furthermore, AsGATA-3 transcript was highly expressed after infection and immunostimulation which suggests a role in the immune system of fish.

J. Kumari et al. / Molecular Immunology 46 (2009) 3099–3107

The GATA-3 protein sequences from the multiple aligned species showed a remarkable degree of amino acid sequence identity, indicating that the structure of this protein, even outside the zinc finger DNA-binding domain, has strongly been conserved throughout evolution (Fig. 2). In addition to the two zinc finger domains, the YxKxHxxxRP motif adjacent to the C-finger was found to be entirely conserved from teleosts to mammals. Therefore, salmon GATA-3 may act as a transcriptional factor for TCR (TCR alpha and delta) and Th2 cytokine (IL-4, IL-5 and IL-13) genes as has been shown for GATA-3 in mammals (Marine and Winoto, 1991; Murphy and Reiner, 2002) and AsGATA-3 would also be capable of interacting with FOG (Fox et al., 1998). Sequence analysis of 5 -flanking region of AsGATA-3 has revealed a number of notable putative transcription factor-binding sites such as: CACCC, YY1, GC box, E-box, NF-␬B (NF-kappaB), NFAT, GATA consensus sequences that are in accordance to the previous studies done in higher vertebrates (Das et al., 2001; Gregoire and Romeo, 1999; Ishihara et al., 1995; Labastie et al., 1994; Murphy and Reiner, 2002). Furthermore, GA rich region was present within the −162 bp to the TSS which was found to be conserved in GATA-3 gene with positional differences. In mouse and human GATA-3, the conserved GC box is present in the first exon instead of 5 to TSS in AsGATA-3 (Labastie et al., 1994). We found that there was no “obvious” TATA box, CCAAT boxes or GC boxes within 200 bp upstream of the TSS of AsGATA-3 gene. However, the AsGATA-3 gene promoter region further upstream contained typical eukaryotic promoter elements but these were located at least 270 bp upstream of the TSS. Based on the results of our experiments, we concluded that the TATA box located above −513 is unlikely to be active, as the reporter construct without the TATA-box, p(199/+58) were as efficient in driving luciferase expression as a full-length promoter containing the TATA-box (Fig. 5). Also, this is in agreement with the previous studies showing that the most active TATA-box is usually located very close to (mostly 25–30 bp upstream) the TSS (Sawadogo and Sentenac, 1990). Taken together, our data indicated that the salmon GATA-3 gene promoter is a “TATA-less” promoter – a feature prevalent for many housekeeping genes. Thus, the AsGATA-3 promoter lacks a TATA box or CAAT box, as already reported for the chicken (Ishihara et al., 1995), mouse and human GATA-3 genes (Labastie et al., 1994). However, we found a sequence starting at −11 to TSS in AsGATA-3 gene that shares extensive homology with the HIP1 binding site (Smale and Baltimore, 1989). Although this sequence is often found in housekeeping TATA-less genes, our result indicate that it might be also implicated in the transcription initiation of AsGATA-3 gene. This suggestion is in line with the findings on human and mouse GATA3 genes (Labastie et al., 1994). The current finding revealed that like chicken, mouse and human, AsGATA-3 promoter also share structural features often found in promoters of housekeeping gene. In contrast to the above statement, AsGATA-3 promoter does not seems to be embedded within the CpG island (Gregoire and Romeo, 1999). By PCR-generated deletion of the putative promoter region we found that the cis-elements responsible for both the basal promoter activity and the positive regulatory elements were located between +58 and −199 bp upstream of the TSS. This finding is a deviation from the previous studies conducted in higher vertebrates where the positive regulators are present distal to the basal promoter. Our analysis also uncovered that a GA rich region in the middle of the basal promoter i.e. in between −26 and −162 bp might be essential for the basal promoter activity. The results also outlines that first exon may also be involved in the transcriptional regulation of AsGATA-3 as has been argued earlier for higher vertebrates.

3107

In summary, we have identified and characterized salmon GATA3 cDNA and its tissue expression in stimulated fish and controls. This work presents new knowledge about the promoter region and the promoter activity of GATA-3 gene in teleosts. This knowledge might ultimately result in a better understanding of the role and regulation of specific motif in the promoter region in Th2 response, and in the development of new diagnostics options by targeting GATA-3 in fish by vaccines and immunostimulants. Acknowledgements This work was supported by grants from the University of Tromsø and the European Commission grant IMAQUANIM (contract no. 007103) is acknowledged. References Campanella, J.J., Bitincka, L., Smalley, J., 2003. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinform. 4, 4. Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klingenhoff, A., Frisch, M., Bayerlein, M., Werner, T., 2005. MatInspector and beyond: promoter analysis based on transcription factor binding sites. Bioinformatics 21, 2933–2942. Das, J., Chen, C.H., Yang, L., Cohn, L., Ray, P., Ray, A., 2001. A critical role for NF-kappa B in Gata3 expression and TH2 differentiation in allergic airway inflammation. Nat. Immunol. 2, 45–50. Finn, R.D., Tate, J., Mistry, J., Coggill, P.C., Sammut, J.S., Hotz, H.R., Ceric, G., Forslund, K., Eddy, S.R., Sonnhammer, E.L., Bateman, A., 2008. The Pfam protein families database. Nucleic Acids Res. 36, D281–D288. Fox, A.H., Kowalski, K., King, G.F., Mackay, J.P., Crossley, M., 1998. Key residues characteristic of GATA N-fingers are recognized by FOG. J. Biol. Chem. 273, 33595–33603. Gregoire, J.M., Romeo, P.H., 1999. T-cell expression of the human GATA-3 gene is regulated by a non-lineage-specific silencer. J. Biol. Chem. 274, 6567–6578. Heicklen-Klein, A., McReynolds, L.J., Evans, T., 2005. Using the zebrafish model to study GATA transcription factors. Semin. Cell Dev. Biol. 16, 95–106. Ho, I.C., Vorhees, P., Marin, N., Oakley, B.K., Tsai, S.F., Orkin, S.H., Leiden, J.M., 1991. Human GATA-3: a lineage-restricted transcription factor that regulates the expression of the T cell receptor alpha gene. EMBO J. 10, 1187. Ishihara, H., Engel, J.D., Yamamoto, M., 1995. Structure and regulation of the chicken GATA-3 gene. J. Biochem. 117, 499. Labastie, M.C., Bories, D., Chabret, C., Grégoire, J.M., Chrétien, S., Roméo, P.H., 1994. Structure and expression of the human GATA3 gene. Genomics 21, 1–6. Marine, J., Winoto, A., 1991. The human enhancer-binding protein Gata3 binds to several T-cell receptor regulatory elements. Proc. Natl. Acad. Sci. 88, 7284–7288. Murphy, K.M., Reiner, S.L., 2002. The lineage decisions of helper T cells. Cell 51, 933–944. Neave, B., Rodaway, A., Wilson, S.W., Patient, R., Holder, N., 1995. Expression of zebrafish gata 3(gta 3) during gastrulation and neurulation suggests a role in the specification of cell fate. Mech. Dev. 51, 169–182. Orkin, S.H., 1992. GATA-binding transcription factors in hematopoietic cells. Blood 80, 575. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. Sawadogo, M., Sentenac, A., 1990. RNA polymerase-B (II) and general transcription factors. Annu. Rev. Biochem. 59, 711–754. Shinnakasu, R., Yamashita, M., Shinoda, K., Endo, Y., Hosokawa, H., Hasegawa, A., Ikemizu, S., Nakayama, T., 2006. Critical YxKxHxxxRP motif in the C-terminal region of GATA3 for Its DNA binding and function. J. Immunol. 177, 5801–5810. Smale, S.T., Baltimore, D., 1989. The “initiator” as a transcription control element. Cell 57, 103–113. Takemoto, N., Arai, K., Miyatake, S., 2002. Cutting edge: the differential involvement of the N-finger of GATA-3 in chromatin remodeling and transactivation during Th2 development. J. Immunol. 169, 4103–4107. Takizawa, F., Mizunaga, Y., Araki, K., Moritomo, T., Ototake, M., Nakanishi, T., 2008. GATA3 mRNA in ginbuna crucian carp (Carassius auratus langsdorfii): cDNA cloning, splice variants and expression analysis. Dev. Comp. Immunol. 32, 898–907. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Mol. Biol. Evol. 24, 1596–1599. Tevosian, S.G., Deconinck, A.E., Cantor, A.B., Rieff, H.I., Fujiwara, Y., Corfas, G., Orkin, S.H., 1999. FOG-2: a novel GATA-family cofactor related to multitype zinc-finger proteins Friend of GATA-1 and U-shaped. Proc. Natl. Acad. Sci. 96, 950–955. Trede, N.S., Zapata, A., Zon, L.I., 2001. Fishing for lymphoid genes. Trends Immunol. 22, 302–307. Zheng, W., Flavell, R.A., 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89, 587–596.