Transcription factor Sp1 is involved in the regulation of Varicella-zoster virus glycoprotein E

Virus Research 69 (2000) 69 – 81 www.elsevier.com/locate/virusres

Transcription factor Sp1 is involved in the regulation of Varicella-zoster virus glycoprotein E Markus Rahaus, Manfred H. Wolff * Institute of Microbiology and Virology, Uni6ersity of Witten/Herdecke, Stockumer Straße 10, 58448 Witten, Germany Received 25 April 2000; received in revised form 9 June 2000; accepted 13 June 2000

Abstract Varicella-zoster virus glycoprotein E (ORF 68) belongs to the group of late genes. It is a major component of the virion envelope and can be found complexed with glycoprotein I on the infected host cell surface. Glycoprotein E (gE) expression is activated by IE4 and IE62. Also, cellular transcription factors, like Sp1, are able to influence the gE expression. Performing quantitative reverse transcription-polymerase chain reaction, we found no decrease in Sp1 mRNA levels at different times post-infection, indicating that Sp1 mRNA evade virion host shutoff effects. In addition, the Sp1 protein was detectable in highly infected cells. Electrophoretic mobility shift assays have shown a binding of Sp1 to both GC elements within the gE-5%untranslated region (5%UTR). Additional shift assays have notified a binding of TATA box binding protein to the TATA box of the gE promoter, which is characterized by an untypical TATACA motif. Promoter–reporter constructs have been made using mutated variants of the gE-5%UTR as promoters. In transfection studies, we found that the TATA deletion, as well as inactivations of both GC boxes, reduced the basal activity of the promoter. A complete loss of activity did not become measurable until eliminating both GC elements and the TATA box, indicating that these cis-elements substitute for each other in initiation of transcription of the gE-5%UTR. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Varicella-zoster virus; Glycoprotein E; Sp1; TATA box binding protein; Cis/trans-interaction studies

1. Introduction Varicella-zoster virus (VZV), a member of the human herpesvirus family, causes a lytic primary infection of epithelial cells of the skin during childhood, known as varicella (chickenpox). Afterwards, the virus establishes a latent infection in dorsal root ganglia and reactivation occurs after a * Corresponding author. Tel.: + 49-2302-669107; fax: +492302-669220. E-mail address: [email protected] (M.H. Wolff).

variable amount of time, leading to zoster (shingles). The clinical spectrum of VZV disease is well defined, but the biochemical and molecular processes controlling the mechanisms of the replication cycle and gene regulation are just being clarified. Much of the knowledge of VZV has arisen from comparisons with the better known herpesviruses, such as HSV-1, and from predictions based upon the VZV DNA sequence (Davison and Scott, 1986).

0168-1702/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 7 0 2 ( 0 0 ) 0 0 1 8 0 - 5

70

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

Lytic expression of the viral genome occurs in a temporal fashion with three distinct classes of genes: immediate–early (IE), early (E) and late (L). The immediate – early genes are transcribed first, following penetration of the virus in the absence of de novo protein synthesis (for an overview, see Sadzot-Delvaux et al., 1999). The immediate–early proteins (of ORF 4, ORF 61, ORF 62 and ORF 63) play an important role in viral gene regulation. All of them except the IE 61 protein are reported to be transcriptional activators (Inchauspe et al., 1989; Nagpal and Ostrove, 1991; Baudoux et al., 1995; Defechereux et al., 1997). Early gene expression occurs next and provides most of the products necessary for the viral DNA replication. After DNA synthesis has occurred, late genes are expressed, which mainly encode virion structural protein and the glycoproteins. Until now, seven glycoproteins have been identified in VZV: gC (ORF14), gB (ORF31), gH (ORF37), gL (ORF60), gI (ORF67), gE (ORF68) (Cohen and Straus, 1996) and gK (ORF5) (Mo et al., 1999). In infected cells, VZV gE is the predominant glycoprotein expressed on the surface of infected cells and forms a noncovalently linked complex with gI. Both gE and gI are targets for neutralizing antibodies and induce cellular immunity in animal models (Arvin et al., 1987; Forghani et al., 1990; Huang et al., 1992). gE serves as an Fc receptor for human immunoglobulin (Ig)G (Litwin and Grose, 1992). Information about the regulation of gene expression of gE is poor. It is reported that the immediate–early transactivators IE 4 and IE 62 are able to activate expression of gE (Inchauspe et al., 1989). The ORF4 gene product (51 kD) is expressed as an IE protein during the VZV infectious cycle. Unlike its HSV-1 homolog ICP27, the ORF4 product does not exhibit any trans-repressing activities but is capable of stimulating gene expression either alone or in synergy with the major VZV regulatory protein IE62 (Inchauspe et al., 1989; Nagpal and Ostrove, 1991; Defechereux et al., 1997). The ORF62 protein (IE62; 175 kD), identified as the major regulatory protein, has been shown to be the major component of the

virion tegument (Kinchington et al., 1992). It transactivates a number of VZV genes, including those encoding gE and gI (Inchauspe et al., 1989; Ling et al., 1992; Perera et al., 1992). A reinforcement of gE expression can be detected by an activation in synergy with IE4 (Perera et al., 1992). In addition to the regulating effects of viral proteins, the influence of cellular transcription factors also becomes important. Concerning cellular proteins involved in viral replication cycles and regulation mechanisms, it has to be guaranteed that these factors are available in the infected cell. In the case of HSV-1, the virion host shutoff factor UL41 causes a massive indiscriminant degradation of mRNA (Schek and Bachenheimer, 1985; Kwong and Frenkel, 1987; Strom and Frenkel, 1987; Kwong et al., 1988). The function of cellular spliceosoms is inhibited and the maturation of cellular mRNA is blocked by ICP27 (Hardwicke and Sandri-Goldin, 1994; Hardy and Sandri-Goldin, 1994; Sandri-Goldin et al., 1995). Nevertheless, Khodarev et al. (1999) reported an accumulation of specific mRNAs encoding transcriptional factors and stress response proteins against a background of severe depletion of cellular RNAs in cells infected with HSV-1. Relating to VZV, many investigators have reported an influence of cellular transcription factors on the regulation of expression of VZV genes. The cellular transcription factor USF cooperates with VZV IE62 to activate the bidirectional promoter of ORF 28 and ORF 29 (Meier et al., 1994). Kinchington et al. (1994) described the presence of cis-elements in the ORF 4 and ORF 63 promoters, which are recognized by the Sp family of transcription factors. In the case of HSV-1, transcription factor Sp1 is known to activate immediate–early gene transcription (Jones and Tjian, 1985) as well as the thymidine kinase promoter (Jones et al., 1985). In general, Sp1 is an ubiquitous activator of numerous TATA-containing and TATA-less promoters. This factor activates transcription by interacting with specific GC-rich DNA elements (GC boxes) present in a wide variety of cellular and viral promoters (Kadonaga et al., 1986). The DNA binding activity of Sp1 is mediated by a

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

zinc finger region near the C-terminus (Courey and Tjian, 1988). Physical interactions have been detected between Sp1 and components of human TFIID (Chiang and Roeder, 1995). Sp1 may also interact with other components of the pol II pre-initiation complex (Choy and Green, 1993). Sp1 recognition sequences are often found near binding sites for other transcription factors, such as CTF/NF-I (Jones et al., 1985) and Ap-1 (Lee et al., 1987), which suggest that these factors may act in conjunction with each other to modulate transcription. Recently, we showed that different cellular transcription factors like LAP − 21, LIP, YY1, Sp1 and NF-E2 are also able to influence the VZV gEand gI-5%untranslated region (5%UTR) activity (Rahaus and Wolff, 1999). In this study, we provide evidence that the mRNA of the transcriptional activator Sp1 as well as the mature protein can be detected in unchanged amounts in highly infected cells. We show that Sp1 is able to bind both GC boxes identified within the gE promoter. In addition,

Table 1 Oligonucleotides used for EMSAsa Designation

Sequence (5%“ 3%)

With rhSp1 Probe 1: GC 1+2 GTTAACACGCCCACATTTGGGCGG GGATGT Probe 2: DGC 2 GTTAACACGCCCACATTTGGTGAG GGATGT Probe 3: DGC 1 GTTAACACATACACATTTGGGCGG GGATGT Probe 4: GTTAACACATACACATTTGGTGAG DGC 1+2 GGATGT With rhTBP gE-TATA Control

GAGCTGGTATACACGAGAG GCAGAGCATATAAGGTGAGGTAG G

71

Sp1 seems to be involved in transcriptional initiation and upregulation of gE expression.

2. Materials and methods

2.1. Total RNA isolation and quantitati6e re6erse transcriptase-polymerase chain reaction analysis Confluent monolayers of human skin fibroblasts were infected with VZV strain ‘Ellen’ (ATCC VR-568) and harvested at 0, 6, 12, 24, 48 and 72 h post-infection. Total RNA was isolated using the RNeasy Mini Kit (Qiagen, Germany) and purified from DNA contaminations as recommended by the manufacturer. Quantitative reverse transcriptase-polymerase chain reaction (RT-PCR) was performed using ‘RT-PCR beads’ (Pharmacia Biotech), mixed with 1.5 mg respective RNA, 0.5 mg pd(T)12 – 18, 50 pmol primers that amplified a 418 bp fragment of the human Sp1 gene (primers: Sp1-RTA, 5%-GGCTGCCGCTCCC-AACTTACA-3%; and Sp1-RTB, 5%-AGCTGCTGATCGTGACTGCCTGAG-3%) and 100 ng internal standard. Cycle conditions: 45 min at 42°C (RT reaction), 4 min at 94°C; 30 s at 51.6°C, 1 min at 72°C, 30 s at 94°C; 25 cycles. The internal standard was designed corresponding to the hybrid-primer technique (Fo¨rster, 1994). Briefly, the target sequence within the Sp1 gene was PCR amplified with primer Sp1-RTA and the hybrid-primer consisting of Sp1-RTB, and a sequence annealing 122 bp upstream of the RTB position (5%-AGCTGCTGATCGTGACTGCGTCCTGAGAGTACATTATTAGCCA-3%; cycle conditions, 4 min at 94°C; 30 s at 51.6°C, 1 min at 72°C, 30 s at 94°C; 30 cycles). The product was reamplified by the original primers Sp1-RTA and Sp1-RTB, and resulted in a 316 bp fragment. PCR products were separated on a 6% polyacrylamide gel, and the densitometric evaluation of the resulting signals was carried out by ‘MOLECULAR ANALYST’ software (version 1.5; BioRad).

2.2. Labeling of double-stranded oligonucleotides

a

Double-stranded probes were used in the experiments, but only the first strand is shown. The respective binding site is underlined.

A pair of complementary oligonucleotides (Table 1) was boiled at 90°C for 5 min and

72

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

allowed to cool down to room temperature slowly. The labeling reaction was carried out using the DIG-oligonucleotide-tailing kit (Roche Diagnostics) according to the manufacturer’s instructions. Alternatively, radioactive end-labeling of 50 pmol double-stranded oligonucleotides was carried out by use of 20 mCi 32P-gATP and 10 U T4-PNK (MBI Fermentas). Probes were purified by filtration through Sephadex G-50 columns (Pharmacia-Biotech).

2.4. Sp1 immunoblotting

2.3. Electrophoretic mobility shift assays

2.5. Immunofluoresence study

Electrophoretic mobility shift assay (EMSA) with rhSp1 was performed in a total volume of 10 ml with 125 ng recombinant human Sp1 (rhSp1; Promega), which were incubated in a reaction mixture containing 10 mM Tris – HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl2, 0.5 mM ethylenediamine tetraacetic acid (EDTA), 0.5 mM dithiothreitol (DTT), 4% glycerol, 0.5 mg poly(dI-dC) (as a non-specific competitor), 0.1 mg bovine serum albumen, and 5 pmol digoxygenin-labeled double-stranded oligonucleotide probe at 25°C for 20 min. For competition experiments, the reaction mixtures were incubated together with unlabeled oligonucleotides at a 100-fold molar excess. DNA–protein complexes were resolved on a 4.7% polyacrylamid gel in 1 × TNANA (6.7 mM Tris, 1 mM EDTA, 3.3 mM sodium acetate; pH 7.5) and transferred onto nylon membrane. Blocking and DIG detection was performed as described in the DIG-oligonucleotide-tailing Kit (Roche Diagnostics). Oligonucleotides are shown in Table 1. EMSA with rhTBP was carried out using 20 ng recombinant human TATA box binding protein (RhTBP; Promega) in reaction buffer (10% glycerol, 20 mM Tris–HCl (pH 8), 80 mM KCl, 10 mM MgCl2, 2 mM DTT) and 2× 105 cpm radiolabeled probe (Table 1) in a total volume of 10 ml. After incubation for 25 min at 25°C, DNA – protein complexes were resolved on a 5% polyacrylamide gel in 0.5×TBE and detected by autoradiography. Competition experiments were carried out using unlabeled oligonucleotides at a 100-fold molar excess.

Human skin fibroblasts, 48 h post-infection, were fixed in 3% PFA and 3% PFA/0.1% Triton X-100. A monoclonal antibody directed against Sp1 (mouse IgG, Pharmingen) and a a-VZV IE63 polyclonal antibody from rabbit (kindly provided by B. Rentier, Lie´ge) was used at a 1:50 dilution. Cells were then stained with a goat-a-mouse Cy3 conjugated IgG, a goat-a-rabbit Cy2 conjugated IgG (Jackson Immuno Research) and DAPI before examination by fluorescence microscopy. Photographs were taken using Kodak Ektachrom 400.

Nuclear extracts of uninfected and infected (70% CPE) human skin fibroblasts were prepared and transferred onto nitrocellulose as described by Sambrook et al. (1989). Detection of Sp1 was carried out by the use of a mouse-a-human Sp1 monoclonal antibody (Pharmingen), an alkaline phosphatase conjugated secondary antibody and NBT/BCIP.

2.6. Plasmid construction and mutagenesis PCR The plasmids pDCMV-bGal and pgE-5%UTRbGal were cloned as described recently (Rahaus and Wolff, 1999). The plasmid pgE-5%UTRDTATAbGal, containing the VZV sequence from positions 115 561–115 722 (161 bp) was cloned identically, but by the use of the lower primer 5%-CGCTCGAGAGCTCGGCCTTTAAGG-3%. SOE-PCR (Intine and Nazar, 1998) was performed in order to mutate the GC boxes of the gE-5%UTR. Briefly, two pre-templates with overlapping ends were amplified from the VZV-SmaE fragment using an outer primer and a corresponding inner primer bearing the mutated GC sequence (oligonucleotides used as inner primers were identical to those designated ‘probe 4: DGC 1+ 2’ used for EMSA with rhSp1; see Table 1). Cycle conditions: 4 min at 94°C; 30 s at 94°C, 30 s at 50°C, 1 min at 72°C; 30 cycles). After purification of the pre-templates, a subsequent PCR was performed. Ten cycles were carried out with-

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

out primers to allow an annealing of overlapping sequences of the pre-templates followed by a fillin reaction by the polymerase (Pfu-Turbo DNA polymerase; Stratagene) to obtain a new template spanning the complete sequence of interest (cycle conditions: see earlier). Afterwards, outer primers were added and the PCR was continued for further 20 cycles (cycle conditions: see earlier). The resulting product was cloned into the EcoR1/ Xho1-site of pCMV-bGal (Clontech). The plasmid was named pgE-5%UTRGC1 + 2-bGal. GC1 + 2/DTATA pgE-5%UTR -bGal was cloned by a further amplification of the gE-5%UTRGC1 + 2 fragment using the same primers and PCR conditions as described for pgE-5%UTRDTATA-bGal.

2.7. Cell culture, transfection and reporter gene assay Lung fibroblasts of the Chinese hamster (V79) were grown in the appropriate medium at 37°C and 5% CO2. Transfection was performed by electroporation: 1.2×106 V79 cells and different amounts of PEG-precipitated DNA (6 mg pEGFP-N1; Clontech; 6 mg promoter – reporter construct and 12 mg pCMV-Sp1). After electroporation (conditions: 960 mFd, 200 V, 320 V) the cells were split into 12-well plates (1 ×105 cells per well) and incubated at 37°C/5% CO2. Then, 48 h post-transfection, cells were lysed and 100 ml protein extracts were set into a b-galactosidase assay using the substrate ONPG (2-nitrophenyl-bD-galactopyranoside) as described recently (Rahaus and Wolff, 1999). Relative b-galactosidase activity was calculated as follows: relative units= [(1000× OD420)/(V× t × OD595)]. The significance of resulting data was checked by the t-test (type 3) using Microsoft Excel 97.

3. Results

3.1. Quantification of Sp1 mRNA in VZV-infected cells Recently, we found a great set of eucaryontic cis-elements within the gE and gI promoters, including GC boxes (Rahaus and Wolff, 1999).

73

Focusing on the cellular transcription factor Sp1, which is able to activate the gE promoter, we designed a quantitative RT-PCR to clarify whether Sp1 mRNA was still present in VZV-infected cells. In contrast to HSV-1, knowledge about a VZV-released shutoff effect is poor and therefore it was a well-founded attempt to check Sp1 mRNA levels relating to increasing times post-infection. Results of the quantitative assay were evaluated using a truncated form of the target sequence within the Sp1 gene as an internal standard. It was imprudent to design an external standard, because of the missing insights into cellular RNA and protein degradation by VZV products. Total RNA of human skin fibroblasts was analyzed 0, 6, 12, 24, 48 and 72 h post-infection. After reverse transcription, a 418 bp fragment (positions 180–598 related to the translational start site) within the Sp1 gene was amplified. The amplification of the internal standard resulted in a 316 bp product. Data were obtained by densitometric evaluation and are summarized in Fig. 1. No significant changes of Sp1 mRNA levels became measurable during the period of time tested. In conclusion, mRNA of the transcription factor Sp1 seemed to be available during VZV infection. The next objective was to prove the translated product in VZV-infected cells.

3.2. Detection of Sp1 protein in VZV-infected cells To scrutinize the production of Sp1 protein in VZV-infected cells, nuclear extracts of uninfected and highly infected human skin fibroblasts (at least 70% CPE) were used for Western blotting. In both cases the characteristic doublet of Sp1 bands (95 and 105 kD) became obvious (Fig. 2A). Using the nuclear extract of VZV-infected cells, another band belonging to a protein of approximately 90 kD was also found. This signal at 90 kD corresponded to the findings of other groups. A similar pattern was found after infection of cells with SV40 (Jackson et al., 1990). To be sure that Sp1 detected by Western blot was not derived solely from uninfected areas of the monolayer cell cultures used to prepare nuclear extracts, immu-

74

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

Fig. 1. RT-PCR analysis of the Sp1 mRNA levels in cells 0, 6, 12, 24, 48 and 72 h post-infection with VZV. A Sp1 fragment of 418 bp was amplified and the number of molecules was compared with known amounts of an internal standard generated by hybrid primer PCR. Using the internal standard, a shortened fragment of 316 bp was amplified. (A) Combination of resulting PCR products from 0 and 72 h post-infection showed that no changes in the pattern of the amplified products became obvious. The purified 418 bp Sp1 fragment (3 × 109 molecules) was amplified as control (K). (B) Amounts of Sp1mRNA molecules at different times post-infection. Again, no significant changes became obvious. Evaluations were carred out by densitometric analysis followed by calculations using the ‘MOLECULAR ANALYST’ software (version 1.5; BioRad).

nofluorescence studies were performed. Again, uninfected and highly infected human skin fibroblasts (at least 70% CPE) were examined. From other reports, it was known that late genes were strongly expressed at this stage of infection (Mainka et al., 1998). Results are shown in Fig. 2B – D. In areas characterized by clearly visible CPE (Fig. 2B), both VZV IE63 and Sp1 were detected in the same cells. The Sp1 protein was mainly localized in the nucleus, whereas VZV IE63 was distributed over the entire cell (Fig. 2C, D). In conclusion, both Sp1 and VZV IE63 were detectable in VZV-infected cells. DAPI staining was carried out to check the integrity of the cells (not shown). Summarizing, data from these experiments provide evidence of the availability Sp1 during VZV infection. Subsequently, Sp1 will be present in the late phase of the VZV replication cycle and could be able to take part in the regulation of late gene expression.

3.3. Interaction between the GC elements within the gE-5 %UTR and Sp1 As described recently (Rahaus and Wolff, 1999), two GC-rich regions were identified within the gE-5%UTR. They were localized at positions 115 673–115 679 (CACGCCC; named GC-1) and 115 686–115 693 (GGGCGGGG; named GC-2). Both were separated from each other by only seven base pairs. In order to check if both GC elements were able to bind purified human Sp1 protein, EMSAs were performed using a set of different doublestranded oligonucleotides in which one or both of the GC boxes were mutated (Table 1). Fig. 3 shows that both GC-1 and GC-2 were able to bind recombinant human Sp1. As expected, the mutations of the GC boxes lead to a loss of binding ability. To confirm the specificity of the signals, competition experiments were carried out using unlabeled probes in a 100-fold molar excess.

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

Due to the fact that the results of this experiment were not quantifiable, information concerning the binding affinity of Sp1 to the GC boxes could not be given. Nevertheless, in summary, recombinant human Sp1 is able to interact with GC-1 as well as with GC-2. According to these findings, it was of interest whether Sp1 could act only as a transcriptional activator or also as a factor involved in initiation of transcription of gE.

75

3.4. Interaction between the gE-TATA element and human TBP Conspicuously, all the promoters of VZV glycoproteins analyzed up to now are characterized by untypical TATA motifs, e.g. TATACA in the case of the gE promoter (Rahaus and Wolff, 1999). Various canonical TATA boxes were found within the promoter regions as well, but they all

Fig. 2. Detection of the Sp1 protein in VZV-infected cells. (A) Both isoforms of Sp1 (95 and 105 kD) were found in nuclear extracts of uninfected and VZV-infected human skin fibroblasts. The third band detected in the nuclear extract of VZV-infected cells is discussed to be a partial degradation product (R. Tjian, personal communication). Of the respective extracts, 100 mg were electrophoresed on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto nitrocellulose. A monoclonal mouse-a-human Sp1 antibody (Pharmingen) was used. (B) VZV-infected human skin fibroblasts showing a typical CPE. The same area was analyzed by immunofluorescence microscopy using the a-Sp1 monoclonal antibody (C) or a a-VZV IE63 polyclonal antibody (D). Cell integrity was checked by DAPI staining (not shown).

76

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

Fig. 3. EMSA using 125 ng rhSp1 and a set of different double-stranded oligonucleotides containing the GC elements of the gE-5%UTR in original or mutated forms. (A) Summary of the probes used for EMSA; only the first strand sequence of the respective GC box is shown (complete sequence of oligonucleotides presented in Table 1). Mutations are indicated by grey letters. Probes were labeled using DIG. (B) Results from the shift assays. Both GC boxes within the gE-5%UTR were able to bind transcription factor Sp1. Using unlabeled probes in a 100-fold molar excess confirmed the selectivity of the signals.

were localized at unfavorable positions to be involved in initiation of transcription. In order to find whether the gE TATA element is able to interact with the TBP, EMSAs were performed. Double-stranded oligonucleotides containing the respective sequence of the gE-5%UTR or a canonical TATA box (Table 1) and recombinant human TBP were used. An unequivocal but weak signal was detected (Fig. 4). Competition

experiments proved the specificity of the signals. The use of a 100-fold molar excess of unlabeled probes resulted in a complete loss of signals (not shown). Similar results became obvious when the gI TATA motif (ATAA) was analyzed (not shown). In spite of its untypical design, the gE TATA motif is able to interact with TBP. Restrictively, the interaction seemed to be weak but specific.

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

3.5. Basal acti6ity of TATA- and/or GC-deficient gE promoter mutants To obtain further information about the importance of the TATA motif and GC elements concerning the basal activity of the gE promoter, promoter–reporter constructs were cloned in which either the TATA box or the GC elements or all of these binding sites were mutated. The construct pgE-5%UTRDTATA-bGal was characterized by a deletion of the TATA motif, in pgE5%UTRGC1 + 2-bGal both GC elements were inactivated, and in pgE-5%UTRGC1 + 2/DTATA-bGal neither the TATA box nor functional Sp1 binding sites were present. These constructs were transfected into V79 cells and the resulting data of the b-galactosidase assay were referred to the positive control ‘pgE-5%UTR-bGal’, which was set at 100%. Resulting data from the negative control

77

‘pDCMV-bGal’ were substracted from all other data. Fig. 5A summarizes the results of the TATA deletions. When the TATA motif was deleted but both GC elements were intact, the basal activity decreased to 39.6% compared with the gE-5%UTR activity. The supplementary deletion of the Sp1 binding sites resulted in a complete loss of the basal activity. Cotransfections of pgE-5%UTR-bGal and pCMV-Sp1 lead to a strong increase of reporter gene expression (300%), but after inactivation of both GC motifs, the activity diminished to 49.1% compared with pgE-5%UTR-bGal (Fig. 5B). Cotransfections of pgE-5%UTRGC1 + 2-bGal with pCMV-Sp1 did not change these results, indicating that both Sp1 binding sites were actually inactive. The significance of the above data was checked by t-test (type 3). All changes in reporter

Fig. 4. EMSA using 20 ng rhTBP and 2× 105 cpm of a radiolabeled oligonucleotide containing the TATA motif of the gE-5%UTR. (A) Summary of the probes used for EMSA; only the first strand sequence of the respective TATA box is shown (complete sequence of oligonucleotides presented in Table 1). (B) Results from the shift assays. The TATACA motif of the gE-5%UTR is able to bind TBP, but compared with the signal of the positive control in a significantly weak manner. Using unlabeled probes in a 100-fold molar excess confirmed the selectivity of the signals (not shown).

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

78

Fig. 5. Transfection studies using a set of promoter–reporter constructs and a Sp1 gene containing plasmid. The plasmid pgE-5%UTR-bGal was used as positive control and set at 100%. Resulting data from transfections using promoter mutants were related to the positive control. Each set of transfection consisted of a statistic evaluation of 12 attempts. Each attempt contained 0,5 mg respective promoter –reporter construct, 0.5 mg pEGFP-N1 (to monitor the transfection efficiency) and 1 mg pCMV-Sp1 if required. Transfection was performed by electroporation (960 mFd, 200 V, 320 V). 48 h post-transfection, cells were lysed and a b-galactosidase assay was carried out using ONPG as substrate. Error bars, s. (A) Analysis of the basal promoter activity when the TATA motif and GC elements were mutated. (B) Analysis of the basal promoter activity as well as transactivating effects of GC box deficient gE promoters when cotransfected with pCMV-Sp1.

gene expression after transfection of the gE5%UTR mutants were significant (Table 2). Combination of all data made us conclude that Sp1 seemed to be able to substitute for TBP in order to initiate basal transcription of VZV gE. Nevertheless, the strongest basal activity was found when the TATA motifs, as well as the GC elements, were functionally active.

4. Discussion In this paper, we have analyzed the influence of VZV infection on mRNA levels of the transcription factor Sp1. We showed that the Sp1 protein is also detectable in highly infected cells. Additionally, we studied its role in upregulating the expression of glycoprotein E.

Table 2 Significance of transfection dataa Transfection

P (%)

pgE-5%-UTRDTATA-bGal pgE-5%-UTRDTATA/GC 1+2-bGal pgE-5%-UTR-bGal+pCMV-Sp1 pgE-5%-UTRGC 1+2-bGal pgE-5%-UTRGC 1+2-bGal+pCMV-Sp1

0.039 8.65×10−5 2.8×10−5 0.22 0.16

a

Significance + + + + +

P, probability of insignificant changes in transcription activation calculated by the t-test (type 3).

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

In general, studies on the mRNA levels of cellular factors after VZV infections are of interest because information about virion host shutoff effects and the resulting consequences is missing. In the case of HSV-1, it is known that the virion host shutoff factor UL41 leads to degradation of mRNA (Schek and Bachenheimer, 1985; Kwong and Frenkel, 1987; Strom and Frenkel, 1987; Kwong et al., 1988) and ICP27 inhibited the function of cellular spliceosoms as well as the maturation of cellular mRNA (Hardwicke and Sandri-Goldin, 1994; Hardy and Sandri-Goldin, 1994; Sandri-Goldin et al., 1995). In contrast to these findings, other workers reported a strong increase of mRNA encoding transcription factor Ap1 in cells after infection with CMV (Kim et al., 1999) and a significant accumulation of a small subset of cellular transcripts after infection with HSV-1 (Khodarev et al., 1999). These transcripts encode regulatory proteins as well as transcription factors (Id-2, Id-3, Egr-1, Ap-2a, CBP, ATF-4, HOX7 and tristetetraprolin) and one stress response protein (GADD45). Many of the transcription factors whose transcripts accumulated in infected cells regulate gene expression both negatively and positively, and are of potential benefit to both host and virus. In the case of the cellular transcription factor Sp1, no significant increase in its mRNA level became obvious following VZV infection but, as shown in Figs. 1 and 2, amounts of both Sp1 mRNA and protein seemed not to be reduced. That will be an important fact and, in conclusion, transcription factor Sp1 is present during the complete infectious cycle and will be able to intervene in regulation of expression of VZV late genes. The third band detected in the Western blot analysis (Fig. 2A) corresponded to the data of Jackson et al. (1990). This product of 90 kD was found in cells infected with SV40. It is discussed to be a partial degradation product (R. Tjian, personal communication). Glycoproteins E and I can be transactivated by Sp1 (Rahaus and Wolff, 1999) and, in addition, the untranslated regions of the glycoproteins H, C and B also contain GC-rich regions, which could be recognized by Sp1 (not shown). EMSAs showed that both GC elements within

79

the gE-5%UTR were able to bind Sp1. No difference in the intensity of the signals was found. According to the sequences of these elements, GC-1 could be classified as a high-affinity cis-element, whereas GC-2 is a regulatory element with a medium binding affinity to Sp1 (Kadonaga et al., 1986). Due to the fact that all signals being equal, it was concluded that there was an actual difference in the binding affinity of Sp1 to the GC boxes. Among transactivation, Sp1 is involved in initiation of transcriptions of numerous TATA-containing and TATA-less promoters within human and viral genes (Kadonaga et al., 1986). The gE promoter contains a functional TATA box but, in accordance with those of gI and gC, the functional TATA boxes are characterized by atypical motifs (Ling et al., 1992; Rahaus and Wolff, 1999), whereas many other canonical TATA sequences are located in various sites upstream of the transcriptional initiation codon (McKnight and Tjian, 1986). Electrophoretic mobility shift assays demonstrated that recombinant human TBP was able to bind the corresponding motif within the gE-5%UTR. A similar observation was made when analyzing the gI promoter (not shown). These data agree with the fact that numerous AT-rich sequences are capable of functioning as TATA boxes (Hahn et al., 1989; Zenzie-Gregory et al., 1993; Smale, 1997). Conspicuously, the binding of TBP to the gE TATA box seemed to be clearly weaker than the binding to a canonical motif used as positive control (Fig. 4). Due to this finding, we supposed another component next to TFIID/TBP participated in the initiation of transcription and maintenance of basal activity. It is known that transcription factor USF interacts cooperatively with TFIID, of which TBP is a component (Sawadogo and Roeder, 1985; Sawadogo, 1988), and Sp1 can direct activation in the presence of TFIID fractions (Hoey et al., 1990). In agreement with these facts, the gE basal activity was reduced but not inhibited when deleting the TATA box. A supplementary inactivation of the GC elements resulted in a complete loss of basal activity, indicating that Sp1 takes care of transcriptional initiation in the absence of a TBP binding site. In the reverse case, the inactivation of both GC elements without deleting the TATA box, a

80

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81

similar result became obvious: again the gE basal activity was reduced but not inhibited. Once more, these data underline the complexity of cellular regulatory network, because Sp1 and TBP seem to act in a cooperative manner and as substitutes for each other to keep a basal activity of the gE transcription. Following these events, Sp1 is able to strongly transactivate the gE expression. Current studies on the meaning of Sp1 are focused on an interaction with VZV transactivators like IE62. Due to the fact that IE62 transactivity on the gE-5%UTR was reduced when cotransfected with Sp1 (not shown), we investigate DNA–protein and protein – protein interactions of these factors in order to obtain further detailed insights in the mechanism of the virus – host regulatory network.

Acknowledgements This work was supported by Galderma Fo¨rderkreis, Germany. We thank Judith Schmitt for excellent technical assistance. We are grateful to Robert Tjian for the gift of pCMV-Sp1 as well as a partial discussion on the results and to Bernhard Rentier for the a-IE63 antibody.

References Arvin, A.M., Solem, S.M., Koropchak, C.M., Kinney, T.E., Paryani, S.G., 1987. Humoral and cellular immunity to varicella-zoster virus glycoprotein gpI and to a non-glycosylated protein, p170, in the strain 2 guinea-pig. J. Gen. Virol. 68, 2449 – 2454. Baudoux, L., Defechereux, P., Schoonbroodt, S., Merville, M.P., Rentier, B., Piette, J., 1995. Mutational analysis of varicella-zoster virus major immediate–early protein IE62. Nucleic Acids Res. 23 (8), 1341–1349. Chiang, C.M., Roeder, R.G., 1995. Cloning of an intrinsic human TFIID subunit that interacts with multiple transcriptional activators. Science 267, 531–536. Choy, B., Green, M.R., 1993. Eukaryotic activators function during multiple steps of preinitiation complex assembly. Nature 366, 531 – 536. Cohen, J.H., Straus, S.E., 1996. Varicella-zoster virus and its replication. In: Fields, B.N., Knipe, D.M., Howley, P.M. (Eds.), Fields’ Virology, vol. 2. Lippincott-Raven, Philadelphia, PA, pp. 2525 – 2545.

Courey, A.J., Tjian, R., 1988. Analysis of Sp1 in vivo reveals multiple transcriptional domains, including a novel glutamine-rich activation motif. Cell 55, 887 – 898. Davison, A.J., Scott, J.E., 1986. The complete DNA sequence of varicella-zoster virus. J. Gen. Virol. 67, 1759 – 1816. Defechereux, P., Debrus, S., Baudoux, L., Rentier, B., Piette, J., 1997. Varicella-zoster virus reading frame 4 encodes an immediate – early protein with posttranscriptional regulatory properties. J. Virol. 71, 7073 – 7079. Forghani, B., Dupuis, K.W., Schmidt, N.J., 1990. Epitopes functional in neutralization of varicella-zoster virus. J. Clin. Microbiol. 28, 2500 – 2506. Fo¨rster, E., 1994. An improved general method to generate internal standards for competitive PCR. Biotechniques 16, 18 – 20. Hahn, S., Buratowski, S., Sharp, P.A., Guarente, L., 1989. Yeast TATA-binding protein TFIID binds to TATA elements with both consensus and nonconsensus DNA sequences. Proc. Natl. Acad. Sci. USA 86 (15), 5718 – 5722. Hardwicke, M.A., Sandri-Goldin, R.M., 1994. The herpes simplex virus regulatory protein ICP27 contributes to the decrease in cellular mRNA levels during infection. J. Virol. 68 (8), 4797 – 4810. Hardy, W.R., Sandri-Goldin, R.M., 1994. Herpes simplex virus inhibits host cell splicing, and regulatory protein ICP27 is required for this effect. J. Virol. 68 (12), 7790 – 7799. Hoey, T., Dynlacht, B.D., Peterson, M.G., Pugh, B.F., Tjian, R., 1990. Isolation and characterization of the Drosophila gene encoding the TATA box binding protein, TFIID. Cell 61 (7), 1179 – 1186. Huang, Z., Vafai, A., Lee, J., Mahalingam, R., Hayward, A.R., 1992. Specific lysis of targets expressing varicellazoster virus gpI or gpIV by CD4 – human T-cell clones. J. Virol. 66, 2664 – 2669. Inchauspe, G., Nagpal, S., Ostrove, J.M., 1989. Mapping of two varicella-zoster virus-encoded genes that activate the expression of viral early and late genes. Virology 173, 700 – 709. Intine, R.V.A., Nazar, R.N., 1998. PCR-mediated mutagenesis in sequences recalcitrant to homogeneous amplification. BioTechniques 25, 364 – 366. Jackson, S.P., MacDonald, J.J., Lees-Miller, S., Tjian, R., 1990. GC box binding induces phosphorylation of Sp1 by a DNA-dependent protein kinase. Cell 63 (1), 155 – 165. Jones, K.A., Tjian, R., 1985. Sp1 binds to promoter sequences and activates herpes simplex virus ‘immediate – early’ gene transcription in vivo. Nature 317, 179 – 182. Jones, K.A., K.R., Y., Tjian, R., 1985. Two distinct transcription factors bind to the HSV thymidine kinase promoter in vitro. Cell 42, 559 – 572. Kadonaga, J.T., Jones, K.A., Tjian, R., 1986. Promoter-specific activation of RNA polymerase II transcription by Sp1. Trends Biochem. Sci. 11, 20 – 23. Khodarev, N.N., Advani, S.J., Gupta, N., Roizman, B., Weichselbaum, R.R., 1999. Accumulation of specific RNAs encoding transcriptional factors and stress response proteins against a background of severe depletion of cellu-

M. Rahaus, M.H. Wolff / Virus Research 69 (2000) 69–81 lar RNAs in cells infected with herpes simplex virus 1. Proc. Natl. Acad. Sci. USA 96 (21), 12062–12067. Kim, S., Yu, S.S., Lee, I.S., Ohno, S., Yim, J., Kang, H.S., 1999. Human cytomegalovirus IE1 protein activates AP-1 through a cellular protein kinase(s). J. Gen. Virol. 80 (Pt 4), 961 – 969. Kinchington, P.R., Hougland, J.K., Arvin, A.M., Ruyechan, W.T., Hay, J., 1992. The varicella-zoster virus immediate– early protein IE62 is a major component of virus particles. J. Virol. 66 (1), 359 –366. Kinchington, P.R., Vergnes, J.P., Defechereux, P., Piette, J., Turse, S.E., 1994. Transcriptional mapping of the Varicella-zoster virus regulatory genes encoding open reading frames 4 and 63. J. Virol. 68, 3570–3581. Kwong, A.D., Frenkel, N., 1987. Herpes simplex virus-infected cells contain a function(s) that destabilizes both host and viral mRNAs. Proc. Natl. Acad. Sci. USA 84 (7), 1926 – 1930. Kwong, A.D., Kruper, J.A., Frenkel, N., 1988. Herpes simplex virus virion host shutoff function. J. Virol. 62 (3), 912–921. Lee, W., Haslinger, A., Karin, M., Tjian, R., 1987. Activation of transcription by two factors that bind promoter and enhancer sequences of the human metallothionein gene and SV40. Nature 325, 368–372. Ling, P., Kinchington, P.R., Sadeghi-Zadeh, M., Ruyechan, W.T., Hay, J., 1992. Transcription from varicella-zoster virus gene 67 (Glycoprotein IV). J. Virol. 66, 3690–3698. Litwin, V., Grose, C., 1992. Herpesviral Fc receptors and their relationship to the human Fc receptors. Immunol. Res. 11 (3-4), 226 – 238. Mainka, C., Fuss, B., Geiger, H., Hofelmayr, H., Wolff, M.H., 1998. Characterization of viremia at different stages of varicella-zoster virus infection. J. Med. Virol. 56 (1), 91– 98. McKnight, S., Tjian, R., 1986. Transcriptional selectivity of viral genes in mammalian cells. Cell 46, 795–805. Meier, J.L., Luo, X., Sawadogo, M., Straus, S.E., 1994. The cellular transcription factor USF cooperates with Varicella-zoster virus immediate–early protein 62 to symmetrically activate a bidirectional viral promoter. Mol. Cell. Biol. 14, 6896 – 6906. Mo, C., Suen, J., Sommer, M., Arvin, A., 1999. Characterization of Varicella-Zoster virus glycoprotein K (open reading frame 5) and its role in virus growth. J. Virol. 73 (5), 4197 – 4207. Nagpal, S., Ostrove, J.M., 1991. Characterization of a potent

.

81

varicella-zoster virus encoded trans-repressor. J. Virol. 65, 5289 – 5296. Perera, L.P., Mosca, J.D., Ruyechan, W.T., Hay, J., 1992. Regulation of varicella-zoster virus gene expression in human T lymphocytes. J. Virol. 66 (9), 5298 – 5304. Rahaus, M., Wolff, M.H., 1999. Influence of different cellular transcription factors on the regulation of Varicella-zoster virus glycoproteins E (gE) and I (gI) UTR’s activity. Virus Res. 62 (1), 77 – 88. Sadzot-Delvaux, C., Baudoux, L., Defechereux, P., Piette, J., Rentier, B., 1999. Overview of the replication cycle of varicella-zoster virus. In: Wolff, M.H., Schu¨nemann, S., Schmidt, A. (Eds.), Varicella-Zoster Virus: Molecular Biology, Pathogenesis and Clinical Aspects. In: Contributions to Microbiology, vol. 3. Karger, Basel, pp. 21 – 42. Sambrook, M.H., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning. A Laboratory Manual. Cold Spring Harbour Laboratory Press, New York. Sandri-Goldin, R.M., Hibbard, M.K., Hardwicke, M.A., 1995. The C-terminal repressor region of herpes simplex virus type 1 ICP27 is required for the redistribution of small nuclear ribonucleoprotein particles and splicing factor SC35; however, these alterations are not sufficient to inhibit host cell splicing. J. Virol. 69 (10), 6063 – 6076. Sawadogo, M., Roeder, R.G., 1985. Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43 (1), 165 – 175. Sawadogo, M., 1988. Multiple forms of the human gene-specific transcription factor USF. II. DNA binding properties and transcriptional activity of the purified HeLa USF. J. Biol. Chem. 263 (24), 11994 – 12001. Schek, N., Bachenheimer, S.L., 1985. Degradation of cellular mRNAs induced by a virion-associated factor during herpes simplex virus infection of Vero cells. J. Virol. 55 (3), 601 – 610. Smale, S.T., 1997. Transcription initiation from TATA-less promoters within eukaryotic protein-coding genes. Biochim. Biophys. Acta 1351 (1-2), 73 – 88. Strom, T., Frenkel, N., 1987. Effects of herpes simplex virus on mRNA stability. J. Virol. 61 (7), 2198 – 2207. Zenzie-Gregory, B., Khachi, A., Garraway, I.P., Smale, S.T., 1993. Mechanism of initiator-mediated transcription: evidence for a functional interaction between the TATA-binding protein and DNA in the absence of a specific recognition sequence. Mol. Cell. Biol. 13 (7), 3841 – 3849.