Transcription of T cell-related genes in teleost fish, and the European sea bass (Dicentrarchus labrax) as a model

Fish & Shellfish Immunology 31 (2011) 655e662

Contents lists available at ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Transcription of T cell-related genes in teleost fish, and the European sea bass (Dicentrarchus labrax) as a model I. Boschi, E. Randelli, F. Buonocore, D. Casani, C. Bernini, A.M. Fausto, G. Scapigliati* Department of Environmental Sciences, Università della Tuscia, Largo dell’Università snc, 01100 Viterbo, Italy

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 July 2010 Received in revised form 24 September 2010 Accepted 6 October 2010 Available online 13 October 2010

In recent years the cloning of genes coding for immuno-regulatory peptides, as well as the sequencing of genomes, provided fish immunologists with a growing amount of information on nucleotide sequences. Research is now also addressed in investigating the functional immunology counterpart of nucleotide sequence transcripts in various fish species. In this respect, studies on functional immunology of T cell activities are still at their beginning, and much work is needed to investigate T cell responses in teleost fish species. In this review we summarise the current knowledge on the group of genes coding for main T cellrelated peptides in fish, and the expression levels of these genes in organs and tissues. Particular attention is paid to European sea bass (Dicentrarchus labrax), a marine species in which some information on functional immunology has been obtained, and we reassume here the expression of some T cellrelated genes in basal conditions. In addition, we provide original data showing that T cells purified from the intestinal mucosa of sea bass with a specific mAb, express transcripts for TRb, TRg, CD8a, and RAG-1, thus showing similarities with intra-epithelial leucocytes of mammals. Ó 2010 Elsevier Ltd. All rights reserved.

Keywords: Fish T cells T cell transcrips TCR beta TCR gamma Dicentrarchus labrax

1. Introduction Teleost fish is the oldest Vertebrates displaying all main features of the immune system as they are known in mammals, with the lacking of bone marrow and lymph nodes. Acquired immune responses are well represented in teleost fish, and all main molecular components of adaptive responses, like those regulating in Vertebrates the capability of being vaccinated and maintain an immune memory, have been identified. These components include major histocompatibility complex (MHC), recombinationactivating genes (RAG), T cell receptors (TR), B cell receptors (BCR), and B and T lymphocytes. Despite almost 70 years of knowledge on B cell activities in fish [1], T cells and their activities have been more elusive to be investigated for a cronical lack of specific monoclonal antibody markers for T cells of teleosts. The existence of T cell populations has been known within bony fish since the 1970s [2], as demonstrated in vitro by the proliferation induced with mitogens [3e5], by the responses in the

* Corresponding author. Tel./fax: þ390761357029. E-mail address: [email protected] (G. Scapigliati). 1050-4648/$ e see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.fsi.2010.10.001

mixed-leukocyte reaction [6], and by the function as helper cells in antibody production against thymus-dependent antigens [7]. The sea bass is, at present, the only marine species for which a specific anti-T cell marker is available, namely the mAb DLT15, specific for thymocytes and peripheral T cells [8]. This antibody is able to recognize both live cells and tissue sections, and its use in indirect immunofluorescence (IIF) and cytofluorimetric analysis of leucocyte fractions permitted the first evaluation of a T cell population in a fish species (sea bass), consisting of 3% of PBL, 9% of splenocytes, 4% of head-kidney cells, 75% of thymocytes, 51% of GALT, and 60% of gill-associated lymphoid tissue [9]. In a demand for oral delivery of antigens in fish, the gut-associated lymphoid tissue has been the subject of particular research, since it revealed a striking abundance of T cells [10], and a remarkable precocity of their appearance during development [11]. The mAb DLT15 was used in immunocytochemistry to show in fish the first T cell activity in vivo, in which muscle transplants grafted onto allogenic recipient fish showed that many cells infiltrating the tissue were DLT15-positive [12]. The antibody was also employed to purify T cells from blood and gut-associated lymphoid tissue [13], and the recovery of DLT15-purified cells was >90% for gut-associated lymphoid tissue, and >80% for blood leucocytes. Subsequently, it was reported the first direct quantitative determination of an in vitro T cell activity by measuring an increase

656

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662

of T cells during a mixed leucocyte reaction (MLR) [14]. The increase of T cells in MLR cultures was also confirmed by RT-PCR analysis of TRb gene expression. As previously reported in mammals [15], the addition of cyclosporin A to the MLR caused a significant decrease of sea bass T-cell proliferation, thus suggesting the presence of IL-2-like molecules in fish. Moreover, leucocytes from MLR cultures displayed an enhanced cytotoxic activity against xenogeneic target cells, raising the possibility of the presence of cytotoxic-like T lymphocytes. These above reported in vivo and in vitro activities have been the first T cell activities ever evidenced in fish by a direct labelling of T lymphocytes [16]. At present and as compared with mammals, an almost complete set of genes coding for T cell markers and of genes coding for molecules related to T cell activities have been cloned in teleost fish species, including receptors TRab, TRgd, co-receptors and surface markers CD3, CD4, CD8, CD25, CD28, CTLA4, MHCII, soluble factors IL-2, IL-4, IL-10, IL-17, IFN-g, and T cell-related molecules RAG-1, Foxp3, stat6, t-bet. The cloning of these genes allowed an analysis of their basal transcription levels in vivo and in vitro in organs and tissues of investigated species. Despite these impressive achievements, data on proliferation capabilities of leucocytes in healthy fish and upon stimulation are scarce. Considering that in mammals the T cell subsets are differentially located in anatomical districts and may have diverse regional specialisations [17], here we summarise the knowledge on the gene expression levels of main T cell-related genes in basal condition in organs and tissues of various fish species. Considering also that the thymus is a producer of T cells, the gene expression of T cell-related genes is obviously the highest in this organ and the corresponding transcritpion levels in thymus will be not presented.

mammals are mostly expressing the TRab receptor, whereas the T cells present in tissues in potential direct contact with the external environment, or mucosal tissues (skin, gills, respiratory tract, intestine), mostly express the TRgd receptor, with the intestine particularly rich of gdþ-T cells. A first work on the gene expression of TRab on fish tissues was reported by northern blotting in cod [18], showing expression in spleen and kidney, and later a study was performed in unstimulated catfish [19], showing a high gene expression of the gene in the intestine, spleen, kidney and PBL. In the sea bass the basal gene expression of TRb resulted high in the intestine, followed by spleen and, at lesser extent, in gills, liver, and PBL. The lowest TRb gene expression was observed in head kidney and brain (Fig. 1a). Very interestingly, it should be noted that in the intestine of sea bass the number of TRbexpressing T cells decreases from the anterior to the posterior part [20], thus revealing a differential distribution of T cell subtypes likely related to physiological activities. In the sea bream a similar gene expression profile of TRb was measured, with highest expression in intestine and gills, and lower in spleen, head kidney and liver [16]. In this work, an up regulation of TRb gene expression was measured in head-kidney leucocytes after 4 h of LPS stimulation. In the Antarctic icefish Chionodraco hamatus the gene expression profile of TRb was measured and, interestingly, a very high expression was found in the gills, followed by spleen and head kidney, whereas the intestine showed a very low expression [21].

1.1. T cell receptors The classes of TR chains present in mammals are TRab, TRbb, TRgd, and the corresponding T cell subpopulations display diverse biological activities and may be found in diverse anatomical locations. The a,b,g,d TR chains have been identified in fish, and the genes coding for TRab have been among the first cellular immune receptors cloned in fish [13]. All TRs derive from a germline immunoglobulin-type sequence composed of constant, variable (V), diverse (D), and joining (J) segments that rearrange somatically, giving almost endless VeDeJ possibilities of sequence variability each one expressed in a clone of T cells that get selected during thymic education, and become ready to respond to non-self stimulation. The lymphocytes expressing TRab and TRgd receptors display peculiar differences both in their function and in their origin. Different to T cells expressing TRab that in mammals originate in bone marrow, are educated in the thymus, and require antigen presentation by MHC to perform their activities, T cells of mammals having a TRgd phenotype have a broader specificity and can be cytotoxic independently from antigen presentation, thus behaving as innate immunity cell performers. This argument is the subject of intense discussion in mammals, and the origin of gd-TR expressing cells is still unknown. All T cells express on their surface the complex of CD3 coreceptor molecules, and T cells can be divided in subpopulations on the base of their biological activity and anatomical location. Cytotoxic T cells (Tc) display on the cell surface the CD8 co-receptor, and upon binding to a different MHC class I become activated and lyse target cells by secreting membrane-perforing enzymes. Helper T cells (Th) display on the cell surface the CD4 co-receptor, became activated upon binding to MHC class II and secrete regulatory cytokines directed towards leucocytes. Circulating T cells of

Fig. 1. Quantitative expression of TCRb and TCRg costant chains in organs and tissues of sea bass. Transcription levels of the genes coding for TCRb and TCRg in sea bass are shown in Fig. 1a and b, respectively. Bars indicate the mean  S.D. fold increase of expression from three different fish individuals. The housekeeping gene reference for quantitative PCR was the 18 S rRNA. Insets are the same graph with a different scale on the Y-axis.

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662

TRg basal gene expression was investigated in carp [22], and showed a high expression in gills, surprisingly higher than in thymus, a barely detectable expression in spleen and kidney, and no detectable expression in liver and intestine. In Atlantic salmon, TRg basal gene expression showed a widespread high expression in gills, spleen, intestine, kidney and liver, and no expression in muscle and brain [23]. In this paper the basal gene expression of TRd was also studied, showing highest expression in gills, followed by kidney, intestine and spleen. The TRg chain has been recently cloned in sea bass (accession number GenBank: FN357279.1; GI:269912726), and analysing the gene expression of the gene coding for TRg constant region, the highest expression was found in the intestine, followed by spleen, PBL, and gills, whereas lower expression was measured in kidney, liver, and brain (Fig. 1b). Reassuming, the availability of TR and co-receptors gene sequences give the opportunity to study in more detail T cellrelated immune responses and to investigate if teleosts fishes are endowed with T cell subsets comparable in function, distribution, and phenotype with those of mammals.

1.2. T cell co-receptors The TR costimulatory receptor CD3 is a marker of all T cell subtypes, it was first identified in fish in 2001 [24], then the set of CD3 genes present in mammals, including CD3z CD33 and CD3gd, have been found in Japanese pufferfish [25], Fugu [26,27], Atlantic 350

a

Expression relative to 18S RNA

300

12 10 8

250

6

200

4 2

150

0 Bra

100

Gil

Gut

HK

Liv

PBL

Spl

Thy

50 0

140

Expression relative to 18S RNA

120

b

Gil

Gut

HK

Liv

Spl

Thy

8 7

80

6

100

PBL

b

5 4

80

3 2

60

1

40

0 Bra

Gil

Gut

HK

Liv

PBL

Spl

Thy

20 0 Bra

salmon [28], carp [29], Atlantic halibut [30], and the costimulatory activity for the TR receptor was shown in trout [31], thus showing that in fish main functional activities of T cells are present. Tissue distribution of CD3 chains was reported in salmon [28], showing for all subunits highest gene expression in spleen, a minor expression in head kidney, and nearly detectable expression in brain, muscle, and liver. Surprisingly, in this work no attention was paid in measuring CD3 gene expression in mucosal tissues. The CD3g/d basal gene expression was investigated in sea bass (unpublished), and transcription levels showed an almost homogeneous and high expression of the gene in all tissues considered excluding the brain, with the PBL, gills and spleen accounting for a slight higher expression of CD3g/d. The CD4 is a T cell co-receptor transmembrane glycoprotein that increases the avidity of association between a T cell and an antigenpresenting cell by interacting with portions of the complex between MHC class II and TR molecules. In teleost fish, CD4 cDNAs have been obtained from Japanese pufferfish (Takifugu rubripes) [32], rainbow trout (Oncorhynchus mykiss) [33,34] channel catfish (Ictalurus punctatus) [35], and Atlantic salmon [36]. In Japanese pufferfish the CD4 contains four extracellular Ig-like domains, as in mammals, but lacks the Cys residue pairs of the first Ig-like domain, and the predicted CD4 gene is composed of 12 exons, compared with 10 in mammals and birds. Regarding the fish species investigated, in Japanese pufferfish the highest basal gene expression of CD4 was observed in spleen, gills and skin, lower expression in head kidney and gonads, and a barely detectable expression in intestine, PBL, and muscle [32]. In the trout, the gene expression of CD4 and the related molecule CD4rel was observed to be maximal in spleen, followed by head kidney, and barely detectable in PBL and liver [34]. In catfish the CD4L1 gene encodes a protein containing four immunoglobulin domains, and the CD4L2 gene encodes for a protein with three immunoglobulin domains. The gene expression of CD4L1 was measured to be high in spleen, gills and kidney, and low in PBL, intestine and liver, whereas the expression of CD4L2 was detected in all organs investigated [35]. In Atlantic salmon, two homologues of mammalian CD4 have been discovered: CD4-1 with four extracellular domains and CD4-2a and CD4-2b with two extracellular domains [36]. In this work, the gene expression of these CD4 genes was found to be maximal in spleen, followed by intestine, gills, and head kidney. The sea bass CD4 cDNA consists of 2071 bp that translates in one reading frame to give the entire molecule containing 480 amino acids [37]. Basal gene expression of CD4 has been investigated in sea bass and shown in Fig. 2a, the highest expression was found

Expression relative to 18S RNA

Bra

657

Gil

Gut

HK

Liv

PBL

Spl

Thy

Fig. 2. Quantitative expression of CD8a and CD4 in organs and tissues of sea bass. Transcription levels of the genes coding for CD8a and CD4 in sea bass are shown in Fig. 2a and b, respectively. Bars indicate the mean  S.D. fold increase of expression from three different fish individuals. The housekeeping gene reference for quantitative PCR was the 18 S rRNA. Insets are the same graph with a different scale on the Y-axis.

IL-10

70 60 50 40 30 20 10 0

Bra

Gil

Gut

HK

Liv

PBL

Spl

Thy

Fig. 3. Quantitative expression of IL-10 in organs and tissues of sea bass. Transcription levels of the genes coding for IL-10 in sea bass are shown. Bars indicate the mean  S.D. fold increase of expression from three different fish individuals. The housekeeping gene reference for quantitative PCR was the 18 S rRNA.

658

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662

Fig. 4. RT-PCR of DLT15-purified intestinal T cells. The figure shows an RT-PCR (25 cycles) using specific primers for the indicated genes in cDNA prepared from DLT15purified cells (þ), and from DLT15-negative cells ().

in the intestine and gills, followed by spleen, PBL, head kidney, liver, and the lowest in the brain [37]. When stimulating in vitro head-kidney leucocytes with 5 mg/ml LPS or 1 microgr/ml PHA, a significant increase in CD4 expression was found after 4 h [37]. Taken together, available data on CD4 suggest that the highest constitutive expression is located in the spleen. Cytotoxic reactions and cellular equivalents of CD8 cytotoxic cells have been reported in fish [38e40], and the first fish CD8a gene was cloned in rainbow trout [41]. The CD8a genes have been cloned in ginbuna crucian carp [42,43], salmonids [43], sea bass [44], halibut [45], Japanese pufferfish [46]. Such evidence suggests that fish may have CD8-positive T cells with functions similar to those in mammals. In carp, the gene expression of CD8a was mostly concentrated in gills, head kidney, spleen, intestine and PBL, and barely detectable in liver and muscle [42]. Interestingly, this paper showed also that CD8a gene expression in kidney cells increased significantly following grafting with allogeneic but not isogeneic scales, and that `regulation of expression correlated with that of TRb. Another work on carp evidenced slight differences on CD8a basal gene expression [43], but confirming the high expression in gills and intestine. Expression of CD8 in trout showed that highest expression was in spleen, intestine, and PBL, head kidney had a much

lower expression that was almost undetectable in liver and muscle [41]. The sea bass CD8a cDNA is comprised of 1490 bp and is translated in one reading frame to give a protein of 217 amino acids, with a predicted 26 amino acids signal peptide, a 88 bp 50 -UTR and a 748 bp 30 -UTR [47]. Basal gene expression of CD8 in the sea bass is shown in Fig. 2b, the highest expression was found in the intestine and gills followed by spleen and liver, the lowest expression was detected in PBL, brain, and head kidney. In Atlantic halibut, the basal gene expression of both CD8a and CD8b was similar, highest in gills and spleen, followed by kidney, and lower in the intestine [44]. Also in Japanese pufferfish the basal gene expression of both CD8a and CD8b was similar, and higher in gills and kidney, followed by spleen, and much lower in PBL, intestine, and muscle. Taken together, available data showed that the anatomical location for the highest gene expression of CD8a and CD8b genes in fish were the gills. Recent data have shown that immunostimulation and vaccination may modulate transcriptional levels of CD8a and/or CD4 in some fish species [48e50], and together with data showing the antigen uptake occuring in gills [51] and in the intestine [52], it appears evident that studies on T cells subtypes, their distribution and modulation is important to develop strategies for oral and immersion vaccination. 1.3. T cell cytokines Interleukin-2 is among the oldest cytokine discovered in Vertebrates and identified at the beginning as a T cell growth factor. Attempts to find IL-2 in fish by homology cloning have failed, until the discovery of IL-2 in fish that was performed by gene synteny conservation between the human and Japanese pufferfish genomes [53]. As in mammals, no constitutive gene expression of IL-2 was observed in Japanese pufferfish, whereas the IL-2 gene expression was upregulated in vitro in head-kidney leucocytes by PHA or LPS. Recently, IL-2 has been also cloned in trout [54], and its expression

Fig. 5. Principal steps of T cells maturation in fish. The figure summarises double negative T cells precursors (DN) in thymus and double positive precursors (DP). Positive selection produces only cells expressing a functional TR that can bind self-MHC. After selective expression of CD8 or CD4 co-receptors, T cells leave thymus to periphery. In the periphery, T cells become specialized as cytotoxic (Tc), helper (Th), and regulatory (Treg).

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662 Table 1 Summary of expression levels for selected T cell-related genes in tissues of teleost fishes. Gene TCRab

TCRg

TCRd CD3 CD4

CD8

IL-4 IL-10 IL-17

Dila Spau Cham Cyca Sasa Dila Sasa Sasa Dila Dila Taru Onmy Sasa Onmy Cyca Dila Hyhy Taru Taru Cyca Dila Dare Sasa Taru Onmy

Gills

HK

Liver

Gut

SPL

PBL

MUS

Brain

Skin

þ/ þþ þþ þþþ þþ þþ þþ nd þþ þþ þþ nd þ nd þþ þþ þþ þþ þþþ nd þ þþ þþ þþ þþ

þ/ þ þ þ/ þþ þ þ þ þ þ þ þ þ þ þþ þ/ þ þþ þ nd þ/ þ/ þ þ þ

þ/ þ þ/ e þþ þ þ þ/ þ þ nd þ/ nd e þ/ þ nd nd þ nd þ nd þ nd þ/

þþ þþ þ/ e þþ þþþ þ nd þþ þþ þ/ nd þ þþ þþ þþ þ/ þ/ þ þþ þþ þþ þþ nd þþ

þ þ þ þ/ þþ þþ þ þþ þþ þ þþ þþ þþ þþ þþ þ þþ þ þ nd þ þ/ þ þ þ

þ/ nd þ/ nd nd þþ nd nd þþ þ þ/ þ/ nd þþ þ þ/ nd þ/ þ nd þ nd nd nd nd

nd nd nd nd e e nd þ/ e e þ/ nd nd e þ/ e nd þ/ þ nd e nd nd nd nd

nd nd nd nd e þ nd þ/ þ e nd nd nd nd nd þ/ nd nd þ nd þ nd þ nd þþ

nd nd nd nd nd nd nd nd nd nd þþ nd nd nd nd nd nd nd nd nd nd nd þ nd þ

Reported species: Cyprinus carpio (Cyca), Chionodraco hamatus (Cham), Danio rerio (Dare), Dicentrarchus labrax (Dila), Oncorhynchus mykiss (Onmy), Sparus aurata (Spau), Takifugu rubripes (Taru). Nd ¼ not done. Tissues: head kidney (HK), spleen (SPL), peripheral blood leucocytes (PBL), muscle (MUS).

was similarly observed to be upregulated by PHA, by the mixed leucocyte reaction, and by bacterial (Yersinia ruckeri) infection. Regulatory T cells T(reg) have been supposed to exist in fish on the base of the panel of cytokines identified and homologous to mammalian counterparts regulating the activities of CD4-positive T cell subpopulations. To reinforce this hypothesis, a paper recently described the identification in zebrafish by gene synteny approach of the genes coding for Th1-associated T(reg) molecules t-bet, and foxp3 [55]. The anti-inflammatory and Treg-associated cytokine IL-10 has been characterised in some fish species like Japanese pufferfish [56], Green spotted pufferfish [57], carp [58], and sea bass [59]. The basal gene expression pattern of IL-10 in sea bass is shown in Fig. 3, with the intestine accounting for the highest gene expression, followed by brain, gills, liver, spleen PBL, thymus, and head kidney. Similarly, the IL-10 gene expression was observed to be high in the intestine of carp [58]. Interleukin-10 (IL-10) is a regulatory cytokine, extensively studied in mammals, mainly involved in the suppression or deactivation of activated immune responses [60e62]. IL-10 is produced by macrophages [63] and by the T-helper 2 (Th2) and T-regulatory (TR) cell subsets [64e66]. It plays an important role in inflammation [67] by inhibiting some activities of macrophages [68,69], and certain cytokine production [70e72]. In teleosts, the functional immunology of

659

this cytokine remains unclear and need to be investigated more in detail. The cytokine IL-17, involved in Th17 response, has been identified in zebrafish [73], salmon [74], trout [75], and Japanese pufferfish [76]. In zebrafish, the gene expression of IL-17 genes is mostly present in intestine and gills, and after LPS stimulation also in spleen and kidney [73]. Atlantic salmon displayed a very high gene expression of IL-17 in gonads and skin, followed by intestine and gills, and lower gene expression in spleen, liver, brain, and kidney. In Japanese pufferfish, seven gene families coding for IL-17 have been identified, and the transcript level of corresponding cDNAs showed for the isoforms the gills as a major site of expression, followed by spleen and kidney. In rainbow trout, the expression of genes coding for the two IL-17 peptides IL-17C1 and IL-17C2 showed the highest expression in gills, intestine and brain, followed by spleen, kidney and skin, and lowest in liver. Th1 cells produce interferon-g (IFN-g) and lymphotoxin (LT), activating cell-mediated immunity and providing protection against intracellular pathogens and viruses. Th2 cells are marked by Stat6 [55] and secrete interleukin-4 (IL-4), that has been recently discovered in fish [77,78]. Basal gene expression of IL-4 in Japanese pufferfish evidenced the gills as the preferential site of expression of the cytokine, although all measured tissues were positive at various extent [77], and after in vivo lectin stimulation an increase in expression was measured in all tissues. GATA-3, a T cell-specific transcription factor that is essential for the development and differentiation of Th2 cells, has been cloned in zebrafish [79], crucian carp [80] and atlantic salmon [81] and rainbow trout [82]. In atlantic salmon GATA-3 is strongly expressed in gills, thymus, and brain which is in agreement with the reports on zebrafish [79], and in crucian carp [80]. GATA “in vivo” modulation against LPS [81] (Kumari et al., 2009), bacterial and parasitic [82] infection was detected showing an upregulation of this gene. With respect to IFN-g, the gene has been cloned in Japanese pufferfish [83], trout [84], catfish [85], zebrafish [86], carp [87], cod [88], and the IFN-g receptors in goldfish [89]. In trout, where most of the work has been done, the gene expression of the cytokine was investigated in head-kidney cells, and resulted to be stimulated by PHA and poly I:C [84] (Zou et al., 2005). Basal gene expression of IFN-g in fish tissues has been reported in catfish, where the tissues preferentially expressing the cytokine were thymus, intestine and muscle for the IFN-g1 isoform, and kidney and spleen for IFN-g2 isoform. In zebrafish the IFN-g1 isoform was expressed in gills, whereas the IFN-g2 isoform was not detectable. Upon stimulation, IFN-g1 increased consistently in the intestine, and IFNg2 in intestine and gills (Igawa et al., 2006). In cod, the highest IFN-g gene expression was measured in spleen and gills, followed by heart and liver, and the lowest in kidney [88] (Furnes et al., 2009). Upon injection of cod with poly I:C the gene expression of IFN-g raised consistently in all tissues, and particularly in the kidney. It is interesting to note that, as in mammals, the IFN-g expression-inducer IL-15 molecule has been identified and characterised in trout [90].

Table 2 Primers and PCR conditions used for real-time and RT-PCR experiments. Transcript

Primer forward (50 / 30 )

Primer reverse (50 / 30 )

PCR cycles

T of annealing

rRNA 18S (housekeeping gene for real-time) TcRbeta (RT-PCR) TcRbeta (real-time) TcRgamma (RT-PCR) TcRgamma (real-time) CD4 RAG-1 CD8alpha

CCAACGAGCTGCTGACC AGATTACCGGACCATCAGTGAAG GACGGACGAAGCTGCCCA CTGCTGTGTGTGGCCTCAGAC CTGCTGTGTGTGGCCTCAGAC GTGATAACGCTGAAGATCGAGCC GGTGAAGTCCATGGAGAACC CCACTGCATGCGCCGGTGAGG

CCGTTACCCGTGGTCC TCAGTAGTTCTGCTTTCCCTTT TGGCAGCCTGTGTGATCTTCA GTGCTGGACGGAGCAGTGGTA GTGCTGGACGGAGCAGTGGTA GAGGTGTGTCATCTTCCGTTG TTAGGATGACCTCTGCCCAG GTGGACGTCGACTTAAACGTG

35 23 35 23 35 23 23 23

52 55 52 52 52 52 55 55



C C  C  C  C  C  C  C 

660

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662

The presence of a number of regulatory cytokines in teleost suggests the existence of T cells subset corresponding to Th1/Th2 cells, although at present is not possible a direct identification with specific antibody markers. 1.4. Purification of T cells from sea bass intestine As already shown, the intestine of fish contains a high number of T cells, and the involvement of T cells in functional activities of fish intestine is getting increasing attention. Results of some recent investigations demonstrated the dramatic changes in the number of T cells when changing the feeding habit in Atlantic salmon [91], or when manipulating the intestinal microbiome of sea bass [92], thus indicating the importance of T cells in intestinal immunobiology of fish. To achieve preliminary informations on the genes expressed by intestinal T cells of sea bass, and taking advantage from the availability of the anti-T cell mAb DTL15 (see Introduction), we immunopurified T cells from the intestinal mucosa, and analysed the gene expression of some T cell-related genes. The immunopurification was performed by magnetic sorting of Percoll-enriched leucocytes, as already described [13], the expression analysis was performed by RT-PCR in cDNAs prepared from leucocyte fractions, considered genes were TRb, TRg, CD4, CD8a, and RAG-1, and obtained results are shown in Fig. 4. From this experiment it is evident that in immunopurified T cells there is an increase in the gene expression of TRb, CD8a, and RAG-1, whereas CD4 showed a weak expression in immunopurified cells, and TRg showed a very high expression in both purified and non-purified DLT15-positive cells. The sequences of oligonucleotide primers employed for RT-PCR and real-time PCR of sea bass cDNAs are shown in Table 2. 2. Conclusions Acquired immunity is restricted to jawed Vertebrates, and lymphocytes are the cells mainly responsible for acquired immune reactions. During their early developmental stages, T and B lymphocyte progenitors rearrange different sets of prototypic immunoglobulin (Ig) variable (V), diversity (D), and joining (J) gene segments to generate the antigen binding regions through a RAGdriven recombination assembly. Functionally, B cells secrete Ig molecules whereas T cells retain Ig-like molecules on their surface. For a fine tuning of self/non-self recognition mechanisms, T cells produce specific surface-bound or soluble molecules, whose genes have been identified and cloned in teleost species (see Introduction for references). From the cloning of these T cell-associated genes it emerged that the almost entire set of T cell-related molecules discovered in mammals are evolutionary related to their orthologs in teleost fish, as reassumed in Fig. 5. However, different to mammals, there is only a limited knowledge in fish of the regional distribution of T cell subsets, as well as the levels of transcription of T cell-related genes. In this view, and for a possible importance in functional immunology studies in fish, the aim of this review has been to collect available knowledge regarding the transcritpion levels of T cell-related genes in lymphoid and non-lymphoid tissues of some teleost fish species. Data have been summarised in Table 1, and from this table it is evident that highest gene expression of T cell-related genes takes place in mucosal tissues. From this finding it is conceivable to speculate that in investigated species the T cellmediated recognition mechanisms play major roles in tissues at direct contact with external environment. In addition, and particularly interesting for applicative purposes, a knowlegde on the antigen uptake through mucosal surfaces may be of importance for oral or bath immunisation of fish.

Among mucosal surfaces of reported species, the gills are the anatomical district displaying the highest transcription levels of T cell genes, particularly regarding TRg, CD4, CD8, IL-4, IL-17. This observation is particularly interesting, since most of in vitro functional immunology studies in fish have been conducted so far by using kidney or spleen leucocytes as effector cells, whereas the gillassociated lymphoid tissue was neglected. Despite the difficulties in obtaining leucocytes from the gills, future investigations should pay more attention to this tissue to study in vivo and in vitro activities of T cells. The other tissue displaying high levels of expression of T cellrelated genes is the intestine (Table 1), and among marine fish species most of the knowledge on intestinal T cells has been achieved in the sea bass (see above for references). It should be remembered that studies conducted by in situ hybridisation showed in sea bass a differential distribution of T cells in the intestine towards the anus, with the TRb-expressing cells decreasing, and CD8a-expressing cells increasing. This peculiar regional distribution may reflect specialisation of T cell activities in the intestine related to possible oral antigen uptake, or an asset important for relationships with intestinal microbiome [92]. In the intestine, the intra-epithelia leucocyte (IEL) population is about 30e50% in mammals [93], 35e55% in birds [94], and 45e55% in fish [16,95]. Notably, most of intestinal IEL express the TRgd receptor, display a CD8aa phenotype, and are spontaneously cytotoxic [93]. IEL are remarkably different from T cells residing in other sites of the body, not well described and endowed with unusual but distinctive characteristics that place them as performers of both innate and acquired responses [96]. These cells are located at the front line of defense, at the point which the interior of the body comes in contact with the greatest numbers of antigens from the exterior world. To investigate in sea bass which T cell-associated genes are expressed in T cells purified from IELs, we immunopurified DLT15positive cells from the intestine of sea bass by using established protocols [13], analysed the gene expression of TRb, TRg, CD8a, CD4, and RAG-1 genes, and the RT-PCR results are shown in Fig. 4. From this experiment it is evident that DLT15-purified cells express higher levels of all the genes investigated, suggesting for the first time that fish may have an intestinal T cell population having a phenotype that include TRg/CD8a molecules, and in which a RAG-1-driven somatic recombination may occur. These observations suggest that some of the features of vertebrate IELs arose early in evolution and well before mammals. The expression of some T cell-related genes has been recently investigated in the kidney of sea bass after experimental infection with betanodavirus, and results have shown that, among investigated genes associated to T cells, only IL-10 was significantly modulated by the infection and subsequent boosting, thus suggesting the importance of regulatory cytokines during an in vivo antiviral responses [97]. Reassuming, from the available data the spleen appears to be the non-mucosal tissue in which the highest expression of T cellrelated genes occur, thus indicating the importance of this organ in T cell activities where the encounter with the antigen is mediated by other components of the immune system. Also, from the available data some differences are evident in the basal expression of the same gene in different species, and this could be either attributable to interspecific differences, or to the low number of individual fish analysed. In this respect, a part of future research will extend transcriptomic data with a higher number of sampled fish. In conclusion, the distribution of transcripts coding for molecules involved in regulating T cell activities in fish appears to have a non-homogeneous mapping, being more concentrated in mucosal tissues, and inside the intestine T cell subpopulations are

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662

asimmetrically distributed, thus revealing interesting features that necessitate of functional immunology studies to be understood. References [1] Duff DCB. The oral immunisation of trout against Bacterium salmonicida. J Immunol 1942;44:87e94. [2] Siu Stolen J, Makela O. Carrier preimmunisation in the anti hapten response of a marine fish. Nature 1975;254:718e29. [3] Etlinger HM, Hodgins HO, Chiller JM. Rainbow trout leukocyte culture: a simplified method. In Vitro 1976;12:599e601. [4] Sizemore RC, Miller NW, Cuchens MA. Phylogeny of lymphocyte heterogeneity: the cellular requirements for in vitro mitogenic responses of channel catfish leukocytes. J Immunol 1984;133:2920e34. [5] Marsden MJ, Vaughan LM, Foster TJ, Secombes CJ. A live (delta aroA) Aeromonas Salmonicida vaccine for furunculosis preferentially stimulates T-cell responses relative to B-cell responses in rainbow trout (Oncorhynchus Mykiss). Infect Immunol 1996;64(9):3863e9. [6] Miller NW, Sizemore RC, Clem LW. Phylogeny of lymphocyte heterogeneity: the cellular requirements for in vitro antibody respones of channel catfish leukocytes. J Immunol 1985;134:2884e98. [7] Miller NW, Bly JE, Van Ginkel Ellsaesser FCF, Clem LW. Phylogeny of lymphocyte heterogeneity: identification and separation of functionally distinct subpopulations of channel catfish lymphocytes with monoclonal antibodies. Dev Comp Immunol 1987;11:739e47. [8] Scapigliati G, Mazzini M, Mastrolia L, Romano N, Abelli L. Production and characterisation of a monoclonal antibody against the thymocytes of the sea bass Dicentrarchus labrax (L.) (teleostea, percicthydae). Fish Shellfish Immunol 1995;5:393e405. [9] Romano N, Abelli L, Mastrolia L, Scapigliati G. Immunocytochemical detection and cytomorphology of lymphocyte subpopulations in a teleost fish Dicentrarchus labrax (L). Cell Tissue Res 1997;289:163e71. [10] Abelli L, Picchietti S, Romano N, Mastrolia L, Scapigliati G. Immunohistochemistry of gut-associated lymphoid tissue of the sea bass Dicentrarchus labrax (L.). Fish Shellfish Immunol 1997;7:235e45. [11] Picchietti S, Terribili FR, Mastrolia L, Scapigliati G, Abelli L. Expression of lymphocyte antigenic determinants in developing gut-associated lymphoid tissue of the sea bass Dicentrarchus Labrax (L.). Anat Embryol 1997;196: 457e63. [12] Abelli L, Baldassini MR, Mastrolia L, Scapigliati G. Immunodetection of lymphocyte subpopulations involved in allograft rejection in a teleost, Dicentrarchus Labtax (L. Cell Immunol 1999;191:152e60. [13] Scapigliati G, Romano N, Abelli L, Meloni S, Ficca AG, Buonocore F, et al. Immunopurification of T-cells from sea bass Dicentrarchus labrax (L.). Fish Shellfish Immunol 2000;10:329e41. [14] Meloni S, Zarletti G, Benedetti S, Randelli E, Buonocore F, Scapigliati G. Cellular activities during a mixed leucocyte reaction in the teleost sea bass Dicentrarchus Labrax. Fish Shellfish Immunol 2006;20:739e49. [15] Kronke M, Leonard WJ, Depper JM. Cyclosporin A inhibits T-cell growth factor gene expression at the level of mRNA transcription. Proc Natl Acad Sci USA 1984;81:5214e26. [16] Randelli E, Buonocore F, Scapigliati G. Cell markers and determinants in fish immunology. Fish Shellfish Immunol 2008;25:326e40. [17] Paul WE. Fundamental immunology. 5th ed. Philadelphia, PA: Lippincott Williams & Wilkins; 2003. [18] Wermenstam NE, Pilström L. T-cell antigen receptors in Atlantic cod (Gadus morhua L.): structure, organisation and expression of TCR a and b genes. Dev Comp Immunol 2000;25:117e35. [19] Zhou H, Bengtén E, Miller NW, Clem LW, Wilson M. The T cell receptor locus of the channel catfish, Ictalurus punctatus, reveals unique features. J Immunol 2003;170:2573e81. [20] Romano N, Rossi F, Abelli L, Caccia E, Piergentili R, Mastrolia L, et al. Majority of TcRbeta T-lymphocytes located in thymus and midgut of the bony fish, Dicentrarchus labrax L. Cell Tissue Res 2007;329:479e89. [21] Buonocore F, Randelli E, Scala V, Belardinelli M, Casani D, Facchiano A, et al. Evolution of cell-mediated immune defences: cloning and structural characterisation of the T cell receptor beta chain from the icefish Chionodraco hamatus (Perciformes: Channichthyidae). Ital J Zool 2009;76:258e68. [22] Shang N, Sun XF, Hu W, Wang YP, Guo QL. Molecular cloning and characterization of common carp (Cyprinus Carpio L.) TCRg and CD3g/d chains. Fish Shellfish Immunol 2007;24:412e25. [23] Yazawa R, Cooper GA, Beetz-Sargent M, Robb A, McKinnel L, Davidson WS, et al. Functional adaptive diversity of the Atlantic salmon T-cell receptor gamma locus. Mol Immunol 2007;45:2150e7. [24] Park CI, Hirono I, Enomoto J, Nam BH, Aoki T. Cloning of Japanese flounder Paralichthys Olivaceus CD3 cDNA and gene, and analysis of its expression. Immunogenetics 2001;53:130e5. [25] Guselnikov SV, Najakshin AM, Taranin AV. Fugu rubripes possesses genes for the entire set of the ITAM-bearing transmembrane signal subunits. Immunogenetics 2003;55:472e9. [26] Araki K, Suetake H, Kikuchi K, Suzuki Y. Characterization and expression analysis of CD3epsilon and CD3gamma/delta in Fugu, Takifugu rubripes. Immunogenetics 2005;57:158e63.

661

[27] Park CI, Hirono I, Aoki T. Molecular characterization of the Japanese flounder, Paralichthys Olivaceus, CD3e and evolution of the CD3 cluster. Dev Comp Immunol 2005;29:123e33. [28] Liu Y, Moore L, Koppang EO, Hordvik I. Characterization of the CD3z, CD3gd and CD33 subunits of the T cell receptor complex in Atlantic salmon. Dev Comp Immunol 2008;32:26e35. [29] Shang N, Sun XF, Hu W, Wang YP, Guo QL. Molecular cloning and characterization of common carp (Cyprinus Carpio L.) TCRgamma and CD3gamma/ delta chains. Fish Shellfish Immunol 2008;24:412e25. [30] Overgård AC, Hordvik I, Nerland AH, Eikeland G, Patel S. Cloning and expression analysis of Atlantic halibut (Hippoglossus hippoglossus) CD3 genes. Fish Shellfish Immunol 2009;27:707e13. [31] Bernard D, Riteau B, Hansen JD, Phillips RB, Michel F, Boudinot P, et al. Costimulatory receptors in a teleost fish: typical CD28, elusive CTLA4. J Immunol 2006;176:4191e200. [32] Suetake H, Araki K, Suzuki Y. Cloning, expression and characterization of fugu CD4, the first ectothermic animal CD4. Immunogenetics 2004;56:368e74. [33] Dijkstra JM, Somamoto T, Moore L, Hordvik I, Ototake M, Fischer U. Identification and characterization of a second CD4-like gene in teleost fish. Mol Immunol 2006;43:410e4. [34] Laing KJ, Zou JJ, Purcell MK, Phillips R, Secombes CJ, Hansen JD. Evolution of the CD4 family: teleost fish possess two divergent forms of CD4 in addition to lymphocyte activation gene-3. J Immunol 2006;177:3939e51. [35] Edholm E, Stafford JL, Quiniou SM, Waldbieser G, Miller NW, Bengtén E, et al. Channel catfish, Ictalurus Punctatus, CD4-like molecules. Dev Comp Immunol 2007;31:172e87. [36] Moore LJ, Dijkstra JM, Koppang EO, Hordvik I. CD4 homologues in Atlantic salmon. Fish Shellfish Immunol 2009;26:10e8. [37] Buonocore F, Randelli E, Casani D, Guerra L, Picchietti S, Costantini S, et al. CD4 homologue in sea bass (Dicentrarchus labrax): molecular characterisation and structural analysis. Mol Immunol 2008;45:3168e77. [38] Fischer U, Utke K, Ototake M, Dijkstra JM, Kollner B. Adaptive cell-mediated cytotoxicity against allogeneic targets by CD8-positive lymphocytes of rainbow trout (Oncorhynchus mykiss). Dev Comp Immunol 2003;27:323e37. [39] Fischer U, Utke K, SomamotoT KollnerB, Ototake M, Nakanishi T. Cytotoxic activities of fish leucocytes. Fish Shellfish Immunol 2006;20:209e26. [40] Secombes CJ, Bird S, Zou J. Adaptive immunity in teleosts: cellular immunity. Dev Biol (Basel) 2005;121:25e32. [41] Hansen LD, Strassburger P. Description of an ectothermic TCR coreceptor, CD8 alpha, in rainbow trout. J Immunol 2000;164:3132e9. [42] Somamoto T, Yoshiura Y, Nakanishi T, Ototake M. Molecular cloning and characterization of two types of CD8a from ginbuna crucian carp, Carassius Auratus Langsdorfii. Dev Comp Immunol 2005;29:693e702. [43] Moore LJ, Somamoto T, Lie KK, Dijkstra JM, Hordvik I. Characterisation of salmon and trout CD8a and CD8b. Mol Immunol 2005;42:1225e34. [44] Buonocore F, Randelli E, Bird S, Secombes CJ, Costantini S, Facchiano A, et al. The CD8alpha from sea bass (Dicentrarchus labrax L.): cloning, expression and 3D modelling. Fish Shellfish Immunol 2006;20:637e46. [45] Patel S, Overgård AC, Nerland AH. CD8alpha and CD8beta in Atlantic halibut, Hippoglossus Hippoglossus: cloning, characterization and gene expression during viral and bacterial infection. Fish Shellfish Immunol 2008;25:570e80. [46] Araki K, Akatsu K, Suetake H, Kikuchi K, Suzuki Y. Characterization of CD8þ leukocytes in Fugu (Takifugu rubripes) with antiserum against fugu CD8alpha. Dev Comp Immunol 2008;32:850e8. [47] Randelli E, Foglietta A, Mazzini M, Scapigliati G, Buonocore F. Cloning and expression analysis of the co-receptor CD8a in sea bream (Sparus aurata L.). Aquaculture 2006;256:631e7. [48] Byon JY, Ohira T, Hirono I, Aoki T. Use of a cDNA microarray to study immunity against viral hemorrhagic septicaemia (VHS) in Japanese flounder (Paralichthys olivaceus) following DNA vaccination. Fish Shellfish Immunol 2005 Feb;18(2):135e47. [49] Raida MK, Buchmann K. Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: effects of temperature on protection and gene expression. Vaccine 2008;26:1050e62. [50] Utke K, Kock H, Schuetze H, Bergmanna SM, Lorenzen N, Einer-Jensen K, et al. Cell-mediated immune responses in rainbow trout after DNA immunization against the viral hemorrhagic septicemia virus. Devel Comp Immunol 2008;32:239e52. [51] Castillo A, Razquin B, Villena AJ, Zapata AG, López-Fierro P. Thymic barriers to antigen entry during the post-hatching development of the thymus of rainbow trout, Oncorhynchus mykiss. Fish Shellfish Immunol 1998;8:157e70. [52] Fuglem B, Jirillo E, Bjerkås I, Kiyono H, Nochi T, Yuki Y, et al. Antigen-sampling cells in the salmonid intestinal epithelium. Dev Comp Immunol 2010;34:768e74. [53] Bird S, Zou J, Savan R, Kono T, Sakai M, Dijkstra JM, et al. Characterisation and expression analysis of interleukin 2 (IL-2) and IL-21 homologues in the Japanese pufferfish Fugu rubripes, following their discovery by synteny. Immunogenetics 2005;56:909e23. [54] Díaz-Rosales P, Bird S, Wang TH, Fujiki K, Davidson WS, Zou J, et al. Rainbow trout interleukin-2: cloning, expression and bioactivity analysis. Fish Shellfish Immunol 2009;27:414e22. [55] Mitra S, Alnabulsi A, Secombes CJ, Bird S. Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio. FEBS J 2010;277:128e47.

662

I. Boschi et al. / Fish & Shellfish Immunology 31 (2011) 655e662

[56] Zou J, Clark MS, Secombes CJ. Characterisation, expression, and promoter analysis of an interleukin-10 homologue in the pufferfish Fugu Rubripes. Immunogenetics 2003;55:325e35. [57] Lutfalla G, Crollius HR, Stange-thomann N, Jaillon O, Mogesen K, Monneron D. Comparative genomic analysis reveals independent expansion of a lineagespecific gene family in vertebrates: the class II cytokine receptors and their ligands in mammals and fish. BMC Genomics 2003;4:29e37. [58] Savan R, Igawa D, Sakai M. Cloning, characterisation and expression analysis of interleukin-10 from the common carp Cyprinus carpio L. Eur J Biochem 2003;270:4647e54. [59] Buonocore F, Randelli E, Bird S, Secombes CJ, Facchiano A, Costantini S, et al. Interleukin-10 expression by real-time PCR and homology modelling analysis in the european sea bass (Dicentrarchus labrax L.). Aquaculture 2007;270: 512e22. [60] Moore KW, O’Garra A, de Waal Malefyt R, Vieira P, Mosmann TR. Interleukin10. Annu Rev Immunol 1993;11:165e90. [61] Moore KW, de Waal Malefyt R, Coffman RL, O’Garra A. Interleukin-10 and the interleukin-10 receptor. Annu Re Immunol 2001;19:683e765. [62] Mosmann TR. Properties and functions of interleukin-10. Adv Immunol 1994;56:1e26. [63] Barnes PF, Chatterjee D, Abrams JS, Lu S, Wang E, Yamamura M, et al. Cytokine production induced by Mycobacterium tuberculosis lipoarabinomannan. Relationship to chemical structure. J Immunol 1992;149:541e7. [64] Mosmann TR, Moore KW. The role of IL-10 in crossregulation of TH1 and TH2 responses. Immunol Today 1991;12:49e53. [65] Street NE, Mosmann TR. Functional diversity of T lymphocytes due to secretion of different cytokine patterns. FASEB J 1991;5:171e7. [66] Ding YZ, Fu S, Zamarin D. Interleukin-10. In: Thomson AW, Lotze MT, editors. The cytokine Handbook. 4th ed. London: Academic Press; 2003. p. 603e25. [67] Bogdan C, Vodovotz Y, Nathan C. Macrophage deactivation by interleukin 10. J Exp Med 1991;174:1549e55. [68] Fiorentino DF, Zlotnik A, Mosmann TR, Howard M, O’Garra A. IL-10 inhibits cytokine production by activated macrophages. J Immunol 1991;147: 3815e22. [69] Cunha FQ, Moncada S, Liew FY. Interleukin-10 (IL-10) inhibits the induction of nitric oxide synthase by interferon-gamma in murine macrophages. Biochem Biophys Res Commun 1992;182:1155e9. [70] De Waal Malefyt R, Yssel H, deVries JE. Direct effects of IL-10 on subsets of human CD4þ T cell clones and resting T cells. Specific inhibition of IL-2 production and proliferation. J Immunol 1993;150:4754e65. [71] Fickenscher H, Hor S, Kupers H, Knappe A, Wittmann S, Sticht H. The interleukin-10 family of cytokines. Trends Immunol 2002;23:89e96. [72] Commins S, Steinke JW, Borish L. The extended IL-10 superfamily: IL-10, IL-19, IL-20, IL-22, IL-24, IL-26, IL-28, and IL-29. J Allergy Clin Immunol 2008;121:1108e11. [73] Gunimaladevi I, Savan R, Sakai M. Identification, cloning and characterization of interleukin-17 and its family from zebrafish. Fish Shellfish Immunol 2006;21:393e440. [74] Kumari J, Larsen AN, Bogwald J, Dalmo RA. Interleukin-17D in Atlantic salmon (Salmo salar): molecular characterization, 3D modelling and promoter analysis. Fish Shellfish Immunol 2009;27:647e59. [75] Wang T, Martin SA, Secombes CJ. Two interleukin-17C-like genes exist in rainbow trout Oncorhynchus Mykiss that are differentially expressed and modulated. Dev Comp Immunol 2010;34:491e500. [76] Korenaga H, Kono T, Sakai M. Isolation of seven IL-17 family genes from the Japanese pufferfish Takifugu rubripes. Fish Shellfish Immunol 2010;28:809e18. [77] Li JH, Shao JZ, Xiang LX, Wen Y. Cloning, characterization and expression analysis of pufferfish interleukin-4 cDNA: the first evidence of Th2-type cytokine in fish. Mol Immunol 2007;44:2078e86. [78] Ohtani M, Hayashi N, Hashimoto K, Nakanishi T, Dijkstra JM. Comprehensive clarification of two paralogous interleukin 4/13 loci in teleost fish. Immunogenetics 2008;60:383e97.

[79] Neave B, Rodaway A, Wilson SW, Patient R, Holder N. Expression of zebrafish GATA3 during gastrulation and neurulation suggests a role in the specification of cell fate. Mech Dev 1995;51:169e82. [80] Takizawa F, Mizunaga Y, Araki K, Moritomo T, Ototake M, Nakanishi T. GATA3 mRNA in ginbuna crucian carp (Carassius auratus langsdorfii): cDNA cloning, splice variants and expression analysis. Dev Comp Immunol 2008;32:898e907. [81] Kumari J, Bogwald J, Dalmo RA. Transcription factor GATA-3 in Atlantic salmon (Salmo salar): molecular characterization, promoter activity and expression analysis. Mol Immunol 2009;46:3099e107. [82] Wang T, Holland JW, Martin SA, Secombes CJ. Sequence and expression analysis of two T helper master transcription factors, T-bet and GATA3, in rainbow trout Oncorhynchus mykiss and analysis of their expression during bacterial and parasitic infection. Fish Shellfish Immunol; 2010. [83] Zou J, Yasutoshi YB, Dijkstra JM, Sakai M, Ototake M, Secombes C. Identification of an interferon gamma homologue in Fugu Takifugu Rubripes. Fish Shellfish Immunol 2004;17:403e9. [84] Zou J, Carrington A, Collet B, Dijkstra JM, Yoshiura Y, Bols N, et al. Identification and bioactivities of IFNg in rainbow trout Oncorhynchus mykiss: the first Th1-type cytokine characterized functionally in fish. J Immunol 2005;175:2484e94. [85] Milev-Milovanovic I, Long S, Wilson M, Bengten E, Miller NW, Chinchar VG. Identification and expression analysis of interferon gamma genes in channel catfish. Immunogenetics 2006;58:70e80. [86] Igawa D, Sakai M, Savan R. An unexpected discovery of two interferon gamma-like genes along with interleukin 22 (IL-22) and IL-26 from teleost: IL22 and -26 genes have been described for the first time outside mammals. Mol Immunol 2006;43:999e1009. [87] Stolte EH, Savelkoul HF, Wiegertjes G, Flik G, Lidy Verburg-van Kemenade BM. Differential expression of two interferon-gamma genes in common carp (Cyprinus carpio L.). Dev Comp Immunol 2008;32:1467e81. [88] Furnes C, Seppola M, Robertsen B. Molecular characterisation and expression analysis of interferon gamma in Atlantic cod (Gadus morhua). Fish Shellfish Immunol 2009;26:285e92. [89] Grayfer L, Belosevic M. Molecular characterization, expression and functional analysis of goldfish (Carassius aurutus L.) interferon gamma. Dev Comp Immunol 2009;33:235e46. [90] Wang T, Holland JW, Carrington A, Zou J, Secombes CJ. Molecular and functional characterization of IL-15 in rainbow trout Oncorhynchus mykiss: a potent inducer of IFN-gamma expression in spleen leukocytes. J Immunol 2007;179:1475e88. [91] Bakke-McKellep AM, Froystad M, Lilleeng E, Dapra F, Refstie S, Krogdahl A, et al. Response to soy: T-cell-like reactivity in the intestine of Atlantic salmon, Salmo salar. J Fish Dis 2007;30:13e25. [92] Picchietti S, Fausto AM, Randelli E, Carnevali O, Taddei AR, Buonocore F, et al. Early treatment with Lactobacillus Delbrueckii strain induces rise in intestinal T cells and granulocytes and modulates immune related genes of larval Dicentrarchus Labrax (L.). Fish Shellfish Immunol 2009;26:368e76. [93] Lefrancois L, Goodman T. In vivo modulation of cytolytic activity and thy-1 expression in TCR-gdþ intraepithelial lymphocytes. Science 1989;243: 1716e28. [94] Chai J, Lillehoj HS. Isolation and functional characterization of chicken intestinal intra-epithelial lymphocytes showing natural killer cell activity against tumour target cells. Immunol 1988;63:111e7. [95] Rombout JHWM, Joosten PHM, Engelsma MY, Vos AP, Taverne N, TaverneThiele JJ. Indications for a distinct putative T cell population in mucosal tissue of carp (cyprinus carpio L.). Dev Comp Immunol 1998;22:63e77. [96] Ishikawa H, Naito T, Iwanaga T, Takahashi-Iwanaga H, Suematsu M, Hibi T, et al. Curriculum vitae of intestinal intraepithelial T cells: their developmental and behavioral characteristics. Immunol Rev 2007;215:154e65. [97] Scapigliati G, Buonocore F, Randelli E, Casani D, Meloni S, Zarletti G, et al. Cellular and molecular immune responses of the sea bass (Dicentrarchus labrax) experimentally infected with betanodavirus. Fish Shellfish Immunol 2010;28:303e11.