Transcriptional profiles of regulatory and virulence factors of Staphylococcus aureus of bovine origin: oxygen impact and strain-to-strain variations

Molecular and Cellular Probes 19 (2005) 227–235 www.elsevier.com/locate/ymcpr

Transcriptional profiles of regulatory and virulence factors of Staphylococcus aureus of bovine origin: oxygen impact and strain-to-strain variations Ce´line Ster, Florence B Gilbert*, Thierry Cochard, Bernard Poutrel Laboratoire de Pathologie Infectieuse et Immunologie, Institut National de la Recherche Agronomique, 37380 Nouzilly, France Received 16 June 2004; accepted for publication 7 January 2005 Available online 17 March 2005

Abstract Staphylococcus aureus is responsible for a large panel of infections in humans and animals. In cows, S. aureus provokes chronic intramammary infections. Little information is available about the regulation of virulence factors in bovine isolates. Moreover, oxygenation, which is low in an inflamed mammary gland, could play an important role during the infectious process. We investigated the impact of oxygen on regulatory and virulence factors transcription for three S. aureus bovine isolates cultivated in CYPG medium into a fermentor under moderate oxygenation or low oxygenation. A selective panel of regulatory factors and virulence factors was studied through their mRNA profiles by real-time PCR according to growth phases and oxygenation. RNAIII, rot and sarR genes, for the regulatory factors, and asp23 and cflA genes, for the virulence factors, were strongly expressed, whatever the oxygenation and the strains. Under low oxygenation, whatever the strain, an enhanced expression of srr, clfA and spa genes was detected. Some regulators such as sae, sarA and sigB were differentially transcribed according to the strain and the oxygenation condition. This study sustains the complexity of S. aureus genes global regulation and suggests the coexistence of different pathways that can be activated depending on the strain and the oxygen availability. q 2005 Elsevier Ltd. All rights reserved. Keywords: Bovine S. aureus; Oxygen impact; Gene expression; Regulatory factors; Virulence genes; Real-time PCR

1. Introduction Staphylococcus aureus is an important pathogen for humans and animals. In humans, it is responsible for disease states ranging from minor skin infections (impetigo, wound infections) to systemic diseases (endocarditis, osteomyelitis). S. aureus is also one of the major causes of bovine mastitis and provokes chronic subclinical infections that are not easily cured by antibiotics treatment [1]. A better understanding of the infectious process requires a better knowledge of how the environmental conditions that S. aureus encounters inside the mammary gland affect its colonizing and persistence capacities. Mayer et al. showed that oxygen level is about 23 mm Hg in uninflamed

* Corresponding author. Tel.: C33 2 47 42 78 78; fax: C33 2 47 42 77 79. E-mail address: [email protected] (F.B. Gilbert).

0890-8508/$ - see front matter q 2005 Elsevier Ltd. All rights reserved. doi:10.1016/j.mcp.2005.01.002

mammary glands and about 1.3 mm Hg in S. aureus infected mammary glands [2], relative to 150 mm Hg in the atmosphere at the sea level. Such oxygenation conditions, which are different from those usually used for in vitro cultures, may have an impact on regulatory factors and virulence factors expressions and thus have an impact on pathogenesis. S. aureus pathogenicity is controlled by a regulatory network that leads to an integrated expression of many putative virulence factors [3–5]. Most of the reported studies have involved a single human strain, NTC8325 and its derivatives, nevertheless strain differences in the regulatory roles of the sarA and agr loci have been recently reported [3,6]. Moreover, Sabersheikh and Saunders also showed differences in transcripts profiles for RNAIII, spa and hla genes among epidemic methicillin resistant S. aureus (EMRSA) [7]. The major and more characterized regulatory loci are agr and sar. The agr locus (accessory gene regulator) contains two divergent promoters P2 and P3. The P2 promoter, via its RNAII transcript, is involved in the transcription of

228

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

the elements of the quorum sensing system of S. aureus: Agr A, C, B and D proteins [8]. The P3 promoter leads to the transcription of RNAIII, the effector molecule of this regulatory locus [9]. Its transcription occurs at the transition between the exponential growth phase and the stationary growth phase and leads to the repression of surface proteins expression such as adhesins or protein A (SpA) and to the activation of exoproteins expression such as hemolysins [3–5]. The sar locus (staphylococcal accessory regulator) is also involved in the pleiotropic expression of both extracellular proteins and cell wall proteins. It is composed of three distinct promoters leading to three overlapping transcripts SarA, SarC and SarB with a common 3 0 end. SarA seems to play a predominant role by down-regulating several proteases and activating a- hemolysin (hla), toxic shock syndrome toxin (TSST-1) and enterotoxin B expression [10]. SarA can also activate agr [11]. SarA homologs have been described. SarS (also called SarH1: SarA Homolog 1) was described concomitantly by Tegmark et al. [12] and Cheung et al. [13]. SarS can bind in vitro the promoter regions of RNAIII, hla, sspA (V8 serine protease gene) and spa. SarS is a repressor of hla transcription and an activator of spa. SarS own transcription is negatively controlled by SarA and agr [12,13]. SarR was described to modulate sar expression. It binds to sar promoter and downregulates sar P1 transcription and consequently SarA protein expression [14]. Rot is a Sar family member that was first identified as a transcription repressor of toxins genes [15]. Recently, Saı¨d-Salim et al. showed that rot acts as a global regulator with opposite effects on gene expression to agr. It activates SpA and SarS expression and represses lipase, hemolysins and proteases [16]. The sae locus was first described as a two-component regulatory system constituted by two co-transcribed genes, saeR and SaeS [17] affecting S. aureus exoprotein expression [18]. This locus enhances hla, hlb (b- hemolysin gene), coa (coagulase gene) and DNase transcription. It seems to act independently of sar or agr [19]. Recently, it was demonstrated that the sae locus contained two additional ORFs, leading to four or five overlapping transcripts [20,21]. Furthermore, a sae mutant showed a significantly reduced rate of invasion of human endothelial cells and increased expression of type 5 capsular polysaccharide [21]. The sae locus could be downstream of agr in the exoprotein activation pathway and could coordinate the effects of environmental signals with the agr quorumsensing system [20]. In 2001, Yarwood et al. identified another two-component regulatory system named srrAB locus (staphylococcal respiratory response). The srr locus is upregulated under microaerobic condition and could lead to the repression of staphylococcal virulence factors such as TSST-1 and protein A [22]. Gel shift analysis demonstrated that SrrA binds to agr P2, agr P3, spa, tst, and srr promoters. Moreover, strains overexpressing SrrAB were less virulent

compared to the isogenic strains in a rabbit model of endocarditis [23]. sB (encoded by sigB gene) is an alternative sigma factor activated in response to environmental stress. It is mainly expressed during the stationary phase of growth [24]. sB acts mostly through other regulatory genes but also directly on promoter of virulence genes [3]. Recently, a microarraybased analysis indicated that 251 ORFs were influenced by sB activity, suggesting that sB controls a large virulon and is an important modulator of virulence gene expression that is likely to act conversely to RNAIII as most of the exoenzymes and toxins were negatively influenced by sB while the expression of several adhesins was found to be clearly increased [25]. In addition to the agr locus, another quorum-sensing system was described. This system consists of the autoinducer RNAIII-activating protein (RAP) and its target molecule TRAP. The components of both quorum-sensing systems interact with one another as TRAP, activated by RAP, leads to the activation of agr [26]. RAP is orthologous to the ribosomal protein L2 and TRAP is a 167-amino acid protein that is constituvely expressed. TRAP is highly conserved in staphylococci and contains three completely conserved histidine residues that are phosphorylated and essential for its activity. Strains harbouring mutated TRAP (each of the conserved histidine residues was changed to alanine) did not express RNAIII, were non-hemolytic and did not cause disease in a murine cellulitis model, confirming the importance of TRAP in S. aureus pathogenesis [27]. An RNAIII-inhibiting peptide (RIP), which inhibits TRAP phosphorylation, has been shown to prevent numerous types of S. aureus infections in vivo [28]. All these regulatory factors have many targets among them virulence factors genes. Globally, surface proteins (FnBPs (fibronectin binding proteins), Spa, ClfA, ClfB) are expressed early during growth and are repressed when bacteria enter the stationary growth phase. On the contrary, exoproteins (SspA, Hla, Hlb) expression is enhanced at the stationary growth phase. Moreover, virulence factors expression can be modulated by environmental stimuli such as oxygen tension, pH, osmolarity, nutriment availability [3]. To our knowledge, transcripts profiles of regulatory loci and virulence factors genes had never been investigated for S. aureus of bovine origin. Moreover, little is known about the oxygen impact on the regulatory and virulence factors expression by S. aureus strains. Low oxygenation is probably an important environmental parameter S. aureus has to cope with during the infectious process. We intended to study the transcription profiles of major regulatory loci and virulence factor genes of bovine mastitis isolates grown under moderate oxygenation (23 mm Hg oxygen, uninflamed mammary gland) and low oxygenation (13 mm Hg oxygen).

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

2. Materials and methods 2.1. Bacterial strains The three S. aureus strains used in this work, 169-32, 776-10 and 788-06, were isolated from bovine mastitic milks and collected into three different French herds at three distinct periods (1985, 1997, 2001, respectively). Presence of the studied genes was determined by PCR with the primers used in this work. Moreover, we determined, using the primers defined by Lina et al. [29], that two strains belong to the agr group 1 (776-10, 788-08) and one to the agr group 2 (169-32). 2.2. Growth conditions Bacteria were grown in CYPG medium (casamino acids 10 g/l, yeast extract 10 g/l, glucose 5 g/l, NaCl 5.9 g/l, phosphate 60 mM, pH 6.8) into a 2-l fermentor (Setric Ge´nie Industriel, Toulouse, France) allowing temperature, dissolved oxygen and pH control. During growth, the temperature was maintained at 37 8C and the pH at 6.8 by addition of 1N NaOH. The fermentor was inoculated with an overnight preculture in order to obtain an initial optical density at 600 nm of 0.03. Growth was carried out until the culture reached the stationary phase. Each strain was grown twice under two oxygenation conditions. First, dissolved oxygen was maintained at 23.3 mm Hg with air injection. Stirring was regulated according to oxygen level and anti-foam added when necessary. Secondly, for low oxygenation condition, no air was injected during growth and after a rapid decrease of oxygen, dissolved oxygen remained constant at 13 mm Hg. Stirring was arbitrary maintained at 60 rpm. During growth, serial time samplings were performed to determine absorbance at 600 nm, CFU/ml and m value, characteristic of growth rate. For mRNA analysis, bacteria were sedimented by centrifugation (3000 g, 4 8C, 15 min), flash frozen in liquid nitrogen and stored at K70 8C until use. 2.3. RNA preparation and reverse transcription (RT) Total RNA was prepared using the RNeasy mini kit according to the manufacturer’s recommendations (QIAGEN SA, France) applying for yeast after a mechanical disruption (20 s, 5 m/s, into the FastPrep FP120 instrument using tubes containing beads, Bio 101, Bio Vista, California). DNA was removed during RNA preparation with RQ1 RNase- free DNase (24 units, 30 min, 37 8C, Promega Co., Madison). Total RNA was quantified by A260nm and the quality of the preparation evaluated on BET stained agarose gel. Reverse transcription (RT) was performed for 1 h at 42 8C with a final denaturation step of 10 min at 95 8C in

229

a 20 ml reaction mixture containing 1 mg RNA, 1 mM dNTP, 5 mM MgCl2, 0.5 mg random hexamers, 40 units of recombinant RNasin and 5 units of AMV RTase (Promega Co., Madison). A negative control without RNA was performed. 2.4. Quantification of specific transcripts by real-time PCR Specific cDNA quantification was performed using a LightCycler instrument (Roche biochemicals) and SYBR GreenI detection of amplicon. The primers used are listed in Table 1. A 10 ml—PCR reaction mixture contained 2.5 mM MgCl2 (Promega Co., Madison), 0.25 mM dNTP (Promega Co., Madison), 0.25 mM of each primer (Thermo hybaid GmbH, Germany), 1/20,000 diluted SYBR GreenI (Roche diagnostics GmbH, Mannheim, Germany), 0.2 ml of Titanium Taq polymerase (according to the manufacturer’s recommendation, Clontech Laboratories, Palo Alto, USA) and 1/50 or 1/5,000 diluted cDNA. For RNAIII, sae and sspA transcripts quantification, 3.75 mM MgCl2 was required. The following temperature profile was utilized for amplification: denaturation at 95 8C for 1 min and 40 cycles at 95 8C for 10 s (temperature transition, 20 8C/s), then the hybridation step (temperature transition, 20 8C/s) and the elongation step at 72 8C (temperature transition, 20 8C/s) with final fluorescence acquisition in single mode. Specific hybridation and elongation parameters for each studied gene are presented in Table 2. Melting curve analysis was done from 60 to 95 8C (temperature transition, 0.2 8C/s) with stepwise fluorescence acquisition. Sequence specific standard curves were generated using ten fold serial dilution (5. 101 to 5. 106 copies/ml) of plasmid preparation containing each DNA target sequence. The number of transcripts in each sample was then determined with the LightCycler Software. Each copy number was confirmed at least three times (i.e. three independent PCR runs). Quantifications were performed according to standard curves with optimized characteristics (slope, error), allowing weak experience-toexperience data variations. The quantitative assays were sensitive and reproductible. Two independent cultures were performed for each strain and each oxygen condition. mRNA copy values differed slightly for a same growth phase between those two independent fermentor cultures but without modification of the expression hierarchy of the different factors. As two separated (i.e. fermentors) set of values are not enough to present data as means C/K SEM, data for one of the cultures are presented here. Data are presented as the ratio of the copy number of interest gene transcripts on 104 copies of 16S rRNA (external reference). Sabersheikh and Saunders used a similar procedure to quantify by real-time PCR RNAIII, spa and hla transcripts in epidemic methicillin resistant S. aureus (EMRSA) [7]. To exclude the possibility of DNA contamination, control samples were also subjected to real-time amplification without prior reverse transcription. Detected copy numbers

230

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

Table 1 Oligonucleotide primers used in this study Gene

Accession number

Primer name

Position

Sequence (5 0 –3 0 )

16SrRNA

X68417

asp23

AP003136

clfA

AP003131

clfB

AP003138

coa

AP003129

fnbA

AP003137

hla

X01645

hlb

X13404

RNAIII

AF288215

rot

AP003135

sae

AP003360

sarA

U46541

sarR

AP003136

sarS

AP003129

sbi

AP003137

sigB

AP003136

spa

AP003129

srr

AP003134

sspA

AP003132

trap

AP003135

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

715–738 807–830 19–43 145–168 315–336 394–418 174–198 344–367 142–165 217–241 371–395 479–503 284–308 454–478 161–184 337–360 67–89 235–258 312–335 409–432 22–45 232–256 26–50 120–144 39–61 159–183 72–96 292–316 275–298 393–417 231–255 380–404 6–30 191–215 261–284 368–392 53–76 226–250 352–374 441–465

TATGGAGGAACACCAGTGGCGAAG TCATCGTTTACGGCGTGGACTACC AAAGCAAAACAAGCATACGACAATC AGCGATACCAGCAATTTTTTCAAC TGCAACTACGGAAGAAACGCCG CCTCCGCATTTGTATTGCTTGATTG TGCAAGTGCAGATTCCGAAAAAAAC CCGTCGGTTGAGGTGTTTCATTTG TCCGAGACCGCAATTTAACAAAAC CGCTTCATATCCAAATGTTCCATCG CGACACAACCTCAAGACAATAGCGG CGTGGCTTACTTTCTGATGCCGTTC GCGAAGAAGGTGCTAACAAAAGTGG CGCCAATTTTTCCTGTATCATCACC CGACCGTTTTGTATCCAAACTGGG TTTGTCCCACCCTGATTGAGAACG AAGGAAGGAGTGATTTCAATGGC ACATGGTTATTAAGTTGGGATGGC GCGTCCTGTTGACGATGAAAGAAC TTGCATTGCTGTTGCTCTACTTGC CAAATCATTATTGGCGTCGTTTCG CATTGCTTGCGTAATTTCCGTTAGC GCTTTGAGTTGTTATCAATGGTCAC CTCTTTGTTTTCGCTGATGTATGTC TCAACGCAACATTTCAAGTTAAG TCTGAGCACTTAGCAATCTCTTTAG AAAAGTCAAGCCTGAAGTCGATATG CTGCAATTTTCTCTCGTTGTTCTTC AAGACAGCAAGAACCCAGACCGAC CCAAACTTGTTGGCTTCTATCAGGG GTCCTTTGAACGGAAGTTTGAAGCC GAAGGTGAACGCTCTAATTCAGCGG ATATCTGGTGGCGTAACACCTGCTG CGCATCAGCTTTTGGAGCTTGAGAG CCGTGTTGAAGGTTTTGAATCTGG TGAGGTTCGCTTTGTTCTACAGTTG CAGCGACACTTGTGAGTTCTCCAG TCGTTGTATCTGTGATTTGGTGACG TTCGGATTTGCTGATCGACATGC TGAATGTTGTCCGCTTGAACCAAAG

were always insignificant (less than 10% data not shown). No amplification was observed with the RT negative control.

checked (Eurogentec, DNA sequencing department, IvozRamet, Belgium).

2.5. Elaboration of sequence specific DNA standards for quantitative PCR

3. Results

Sequence specific DNA standards were prepared by cloning each DNA sequence target (obtained after a PCR reaction using each primer set) into the p-Drive cloning vector (QIAGEN SA, France) according to the manufacturer’s recommendations. After overnight culture of transformed bacteria, plasmids were purified using the QIAgen Spin Miniprep kit (QIAGEN SA, France) according to the manufacturer’s recommendation, quantified using A260 nm and the cloned DNA sequences were

3.1. Growth of S. aureus strains Each culture condition was tested twice for each strain and growth rates (m values) were determined in each case. They were 0.76, 0.54, 0.74 hK1, respectively for S. aureus strains 776-10, 169-32 and 788-06 under low oxygenation and 1.16, 1.11 and 1.02 hK1, respectively under moderate oxygenation. All three strains grew similarly, whatever the oxygen condition tested (Fig. 1). The oxygenation

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235 Table 2 Hybridation and elongation parameters used for the LightCycler quantitative PCRs Target gene

Hybridation temperature (8C)

Hybridation hold time (s)

Elongation hold time (s)

16S rRNA asp23 clfA clfB coa fnbA hla hlb RNAIII rot sae sarA sarR sarS sbi sigB spa srr sspA trap

64 60 62 64 60 60 66 70 67 62 68 55 59 60 60 66 64 59 68 62

4 3 2 2 2 3 2 4 2 2 5 2 3 5 3 3 3 3 2 2

10 6 4 8 4 6 8 8 8 5 10 5 6 10 6 7 9 9 8 8

difference was sufficient to induce a statistically significant difference in growth rate (m value) and variations of studied genes expressions. 3.2. RT-PCR analysis of genes expression according to oxygenation As this study aims at determining importantly expressed regulatory and virulence factors for S. aureus of bovine origin and at analyzing the impact of oxygen on those factors, three different and representative strains were selected in order to point out common characteristics and to avoid the generalization of results obtained for only one strain. For each strain, expression of regulatory and virulence factors genes was analyzed at four growth-phase

Fig. 1. Growth curves for S. aureus 788.06 strain cultivated in CYPG medium under low oxygenation (B) or under moderate oxygenation (C). The arrow numbers refer to the acceleration (1), mid exponential (2), late exponential (3) and stationary (4) growth phase points at which samples were taken for RNA preparation.

231

points: acceleration, mid exponential, late exponential and stationary growth phases under moderate and low oxygenation (Tables 3 and 4). 3.2.1. Profiles of regulatory factors transcripts Whatever the oxygenation and the strains, high level of RNAIII, rot and sarR copies were detected (Table 3). Variations according to oxygenation were detected too as more srr transcripts were obtained under low than under moderate oxygenation. Whatever the oxygenation and the strains, the numbers of trap copies were low and relatively constant throughout the growth. Among strain-to-strains variations, the level of sigB mRNA was more important for the strain 169.32 and more transcripts were detected under low than under moderate oxygenation. In the same way, more sae transcripts were obtained for the strain 169.32 in comparison to the two others. Nevertheless, contrary to sigB gene, more copies of the sae mRNA were detected under moderate oxygenation than under low oxygenation. 3.2.2. Profiles of virulence factor transcripts Whatever the oxygenation and the strains, high level of asp23 and clfA transcripts were detected and the number of fnbA and coa mRNA copies were very low (Table 4). More mRNA copies for the genes encoding alpha and beta hemolysins and SspA were observed under moderate oxygenation than under low oxygenation whereas the numbers of clfB, sbi and spa mRNA copies were more important under low oxygenation than under moderate oxygenation. Among the strain-to-strain variations, level of asp23 and clfA transcripts were weaker for the strain 776.10 than for the two other strains.

4. Discussion and conclusions In this work, we intended to analyze oxygen impact on the expression of regulatory and virulence factors by bovine S. aureus strains. The moderate oxygenation (23 mm Hg) corresponded to the oxygen tension of a non-inflamed mammary gland. For low oxygenation condition, no oxygen was added during the culture and after a rapid oxygen decrease, oxygen tension remained constant at approximately 13 mm Hg. Such oxygenation difference was sufficient to induce a statistically significant difference in growth rate (m value) and variations of studied genes expressions. Three different bovine mastitic isolates were selected in order to point out common characteristics and to avoid the generalization of results obtained for only one strain. If much is known about the virulence associated genes of S. aureus and their temporal regulation in laboratory strains, little is known about the expression of these genes in the epidemic strains (EMRSA) [7]. It is also the case for the mastitis causing S. aureus.

232

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

Table 3 Regulatory factors expressions according to the strains, the oxygenation and the growth phases

RNAIII Acceleration Mid exponential Late exponential Stationary SarR Acceleration Mid exponential Late exponential Stationary Rot Acceleration Mid exponential Late exponential Stationary Srr Acceleration Mid exponential Late exponential Stationary SigB Acceleration Mid exponential Late exponential Stationary Sae Acceleration Mid exponential Late exponential Stationary SarA Acceleration Mid exponential Late exponential Stationary SarS Acceleration Mid exponential Late exponential Stationary Trap Acceleration Mid exponential Late exponential Stationary

776-10

169-32

788-06

Oxygenation

Oxygenation

Oxygenation

Moderate

Low

Moderate

Low

Moderate

Low

164 718 394 580

18 153 21 42

109 327 1238 913

481 2002 4671 568

21 264 79 24

8 1709 83 4

27 82 15 61

45 79 52 35

77 122 44 15

137 211 98 68

160 663 684 614

27 634 74 1

14 25 28 18

40 45 3 14

5 58 176 2

37 123 211 68

28 83 162 107

73 210 90 19

21 27 14 18

46 32 28 34

42 24 67 2

307 222 455 203

2 4 3 1

334 724 358 130

21 37 4 13

17 13 30 6

7 144 66 48

83 167 364 218

22 28 31 39

25 10 75 3

14 31 4 5

8 12 14 4

18 15 210 51

9 15 28 3

1 6 2 2

5 4 30 !1

5 13 4 22

22 26 20 23

14 41 243 746

13 17 87 85

26 30 25 86

14 38 97 4

48 7 !1 !1

22 27 32 15

2 2 9 16

19 12 30 14

16 26 14 13

5 45 2 !1

7 6 1 6

5 5 15 4

!1 !1 !1 !1

!1 !1 !1 !1

9 8 7 11

4 8 43 1

Data are the ratio of the copies number for the studied gene to 104 copies of the external standard (16S rRNA) for the three S. aureus strains 776-10, 169-32 and 788-06, under moderate (23 mm Hg) or low (13 mm Hg) oxygenation and at four growth phase points (acceleration, mid exponential, late exponential and stationary growth phases).

Our results suggest that RNAIII, sarR and rot could be major regulators for S. aureus of bovine origin. RNAIII is recognized as the strategic link between the quorum sensing system and the expression of S. aureus virulon (cell- wall associated proteins and exoproteins). For the strains 776-10 and 169-32, among the different regulators tested, RNAIII copies were the most detected

whatever the oxygenation condition. For the strain 78806, RNAIII copies were also among the most observed but more sarR transcripts were detected. SarR was described as a modulator of sarA transcription [15]. No correlation could be made between sarR and sarA transcriptions in our study. It should be of interest to determine if this protein SarR can regulate the expression

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

233

Table 4 Virulence factors expressions according to the strains, the oxygenation and the growth phases 776-10

169-32

788-06

Oxygenation

Oxygenation

Oxygenation

Moderate asp23 gene Acceleration Mid exponential Late exponential Stationary clfA gene Acceleration Mid exponential Late exponential Stationary hla gene Acceleration Mid exponential Late exponential Stationary hlb gene Acceleration Mid exponential Late exponential Stationary sspA gene Acceleration Mid exponential Late exponential Stationary clfB gene Acceleration Mid exponential Late exponential Stationary sbi gene Acceleration Mid exponential Late exponential Stationary spa gene Acceleration Mid exponential Late exponential Stationary coa gene Acceleration Mid exponential Late exponential Stationary fnbA gene Acceleration Mid exponential Late exponential Stationary

Low

Moderate

Low

Moderate

Low

6 60 21 62

3 4 59 59

18 15 210 51

15 40 265 525

16 15 35 102

7 143 761 14

21 27 14 18

46 31 38 34

26 73 877 27

138 221 1453 4082

131 87 211 303

18 79 474 62

5 66 14 19

13 39 15 13

6 108 641 2739

9 75 189 44

16 156 152 130

4 39 14 2

45 390 51 54

6 16 7 9

22 130 9 11

4 13 19 4

36 279 151 57

25 38 60 2

4 39 3 15

2 3 15 9

24 156 79 9

7 11 18 19

9 28 64 118

2 7 11 1

5 !1 !1 1

256 190 54 9

18 21 9 !1

125 201 71 1

204 124 21 11

427 1842 9 2

19 3 !1 1

77 127 17 14

117 87 18 34

33 49 134 57

102 294 154 78

42 4 393 !1

11 1 !1 2

37 87 11 2

19 29 67 206

123 81 280 123

16 156 152 130

62 3666 10 4

!1 !1 !1 !1

!1 !1 !1 !1

!1 5 10 1

3 5 27 20

10 3 2 2

6 3 5 !1

!1 !1 !1 2

!1 !1 3 1

!1 !1 !1 !1

!1 !1 !1 !1

10 14 4 11

7 3 54 !1

Data are the ratio of the copies number for the studied gene to 104 copies of the external reference (16S rRNA) for the three S. aureus strains 776-10, 169-32 and 788-06, under moderate (23 mm Hg) or low (13 mm Hg) oxygenation and at four growth phase points (acceleration, mid exponential, late exponential and stationary growth phases).

of other genes and if it plays a role in bovine S. aureus pathogenesis. Rot is also well known as an important regulatory factor for laboratory strains. Firstly described as a regulator of toxins expression, Saı¨d-Salim et al.

showed that it acts like a global regulator [17]. Moreover, a predominant role for Rot among the other transcriptional factors was suggested as it may interact directly with RNAIII [3].

234

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

For the virulence factors, the asp23 gene was transcribed whatever the oxygenation and the strain. This alkaline shock protein is highly expressed during early exponential growth with or without stress treatment [30]. Our results showed rather an end growth expression for the asp23 gene (late exponential or stationary phases). Proteomic analysis by 2D-electrophoresis and mass spectrometry confirmed that Asp23 is mostly expressed during the stationary phase (unpublished results). As expression analysis was not carried out until the stationary growth phase in Gertz et al. report, data cannot be compared. Nevertheless, Gertz et al. underline that quantitative expression differences exist between their clinical isolate S. aureus MA13 (wound infection) and the reference strain S. aureus NCTC 8325-4. Investigations on its expression by more S. aureus isolates of human and animal origins and its function(s) are warranted. This factor might play an important biological role especially under low oxygenation as it was equally or more expressed under low oxygenation compared to moderate oxygenation. The expression of srr was described to be the greatest under microaerobic condition [22]. We also observed that srr was more actively transcribed under low oxygenation for the three strains. Yarwood et al. reported that srr downregulates RNAIII [22,23]. In our report such effect was not observed. This difference may be explained by the use of different strains. Although this locus may play a major role under low oxygenation, investigations about its regulatory functions should be pursued. It is recognized that low oxygen leads to decreased expression of agr, hla, hlb and spa genes [3]. In our study, we confirmed only partially these observations as RNAIII and spa were more expressed under low oxygenation compared to moderate oxygenation for the strains 169-32 and the three strains respectively. For the strain 169-32, none of the observed differences in transcription profile of the studied regulatory factors could explain the higher RNAIII expression under low oxygenation. This might be the consequence of another regulatory locus (or loci) that was not included in our study. For the three strains, less mRNA copies of sspA were detected under low oxygenation than under moderate oxygenation, whereas more copies of clfA, clfB and spa mRNA were detected under low oxygenation. Those factors could play a determinant role in pathogenesis. Recently, Brouillette et al. showed that ClfA was an important virulence factor during mastitis in a mice model [31]. Many strain-to-strain variations in transcription profiles were observed in this study. Low and relatively constant numbers of trap transcripts were detected during the growth of the strains 776-10 and 788-06. These results could be in agreement with the constitutive expression of TRAP but no transcripts were detected with the strain 169-32 whatever the oxygenation level. This may be attributed to an nonoptimal sequence of primers for the quantification of relatively low cDNA copies even if a PCR product was

amplified for each strain when genomic DNA was used as a positive control. Indeed, it was shown that traP nucleotidic sequence displays some variability and can be divided into subgroups [27]. As TRAP is a non-classical signal transducer and may be bound to the membrane through other proteins, studies on the variability in its sequence should be pursued and the eventual biological impacts for S. aureus investigated. Strain differences were observed in the hierarchy of the different regulatory and virulence factors but also in their temporal expressions. The strain 169-32 maintained the highest level of RNAIII with the a maximum occuring at the late exponential phase. For the strains 788-06 and 776-10, the level of RNAIII peaked during the exponential phase. The pattern of RNAIII induction in the latter strain was quite atypical as after the decrease observed in the late exponential phase, an increase was detected at the beginning of the stationary phase. This atypical RNAIII pattern was confirmed by Nothern blot hybridization analysis (results not shown). Recently, a similar kinetic of RNAIII production was reported for the strain Sau383, a clinical strain isolated from infected femoral pin [32]. Strain variations in RNAIII production level and kinetic has been previously described for human isolates [7]. Nevertheless, for the regulatory factors, RNAIII and rot (and possibly sarR) seemed to occupy a central position for bovine mastitis isolates. Those two factors are yet described as important regulatory factors in laboratory S. aureus. Then, according to the strain but also to the oxygen condition, a panel of regulatory factors was differentially expressed. These results sustain the complexity of S. aureus accessory regulatory network and suggest that, depending on the strains and the environmental stimuli, different pathways susceptible to function synergistically or not with the central regulators can be activated. Numerous studies concerning the analysis of S. aureus regulation have involved a single strain, NCTC8325 and its derivatives. In this study, differences in mRNA pattern were detected even for S. aureus strains causing the same pathology. This underlined the variability among S. aureus strains and consequently the difficulty to generalize data obtains for one strain. Recently, Blevins et al. have reported strain differences in the regulatory roles of the sarA and agr loci [6]. In the same way, Sabersheikh and Saunders showed that the number of copies of RNAIII, hla, spa transcripts differed greatly between EMRSA strains [7]. Although strains within an EMRSA clone or type gave similar result, high levels of RNAIII transcripts were not consistently linked to elevated levels of hla transcripts or to low levels of spa transcripts. To take into account the variability of S. aureus, reports should involve various strains. Oxygen level leads to noteworthy modifications in expression of regulatory and virulence factors. This may partly explain the discrepancies observed between in vitro and in vivo data. It is important for further studies to pay attention on oxygenation conditions used as they can

C. Ster et al. / Molecular and Cellular Probes 19 (2005) 227–235

interfere. Moreover, such work points out factors that can be of interest for the knowledge of S. aureus infections as they implicate low oxygen level. It would be interesting to analyze oxygen impact on the relationship existing between the different regulatory factors by using strains mutated for one or several of the regulatory factors. Moreover, impact of the regulatory factors on the metabolic and energetic pathways has to be further investigated, as they are involved in growth and thus in bacterial pathogenesis.

Acknowledgements This work was supported by the Re´gion Centre (France) and Schering Plough Company. We thank Pascal Rainard for critical reading of the manuscript. Maı¨wenn Olier is gratefully acknowledged for her help in Northern blot hybridization analysis.

References [1] Sol J, Sampimon OC, Snoep JJ, Schukken YH. Factors associated with bacteriological cure during lactation after therapy for subclinical mastitis caused by Staphylococcus aureus. J Dairy Sci 1997;80:2803–8. [2] Mayer SJ, Waterman AE, Keen PM, Craven N, Bourne FJ. Oxygen concentration in milk of healthy and mastitic cows and implications of low oxygen tension for the killing of Staphylococcus aureus by bovine neutrophils. J Dairy Res 1988;55:513–9. [3] Novick RP. Autoinduction and signal transduction in the regulation of staphylococcal virulence. Mol Microbiol 2003;48:1429–49. [4] Bronner S, Montiel H, Pre´vost G. Regulation of virulence determinants in Staphylococcus aureus: complexity and applications. FEMS Microbiol Rev 2004;28:183–200. [5] Pragman AA, Schlievert PM. Virulence regulation in Staphylococcus aureus: the need for in vivo analysis of virulence factor regulation. FEMS Immunol Med Microbiol 2004;42:147–54. [6] Blevins JS, Beenken KE, Elasri MO, Hurlburt BK, Smeltzer MS. Strain-dependent differences in the regulatory roles of sarA and agr in Staphylococcus aureus. Infect Immun 2002;70:470–80. [7] Sabersheikh S, Saunders NA. Quantification of virulence-associated gene transcripts in epidemic methicillin resistant Staphylococcus aureus by real-time PCR. Mol Cell Probes 2004;18:23–31. [8] Novick RP, Projan SJ, Kornblum J, Ross HF, Ji G, Kreiswirth B, Vandenesch F, Moghazeh S. The agr P2 operon: an autocatalytic sensory transduction system in Staphylococcus aureus. Mol Gen Genet 1995;248:446–58. [9] Novick RP, Ross HF, Projan SJ, Kornblum J, Kreiswirth B, Moghazeh S. Synthesis of staphylococcal virulence factors is controlled by a regulatory RNA molecule. EMBO J 1993;12:3967–75. [10] Chan PF, Foster SJ. Role of SarA in virulence determinant production and environmental signal transduction in Staphylococcus aureus. J Bacteriol 1998;180:6232–41. [11] Chien Y, Manna AC, Cheung AL. SarA level is a determinant of agr activation in Staphylococcus aureus. Mol Microbiol 1998;30: 991–1001. [12] Tegmark K, Karlsson A, Arvidson S. Identification and characterization of SarH1, a new global regulator of virulence gene expression in Staphylococcus aureus. Mol Microbiol 2000;37:398–409. [13] Cheung AL, Schmidt K, Bateman B, Manna AC. SarS, a SarA homolog repressible by agr, is an activator of protein A synthesis in Staphylococcus aureus. Infect Immun 2001;69:2448–55.

235

[14] Manna A, Cheung AL. Characterization of sarR, a modulator of sar expression in Staphylococcus aureus. Infect Immun 2001;69:885–96. [15] McNamara PJ, Milligan-Monroe KC, Khalili S, Proctor RA. Identification, cloning, and initial characterization of rot, a locus encoding a regulator of virulence factor expression in Staphylococcus aureus. J Bacteriol 2000;182:3197–203. [16] Saı¨d-Salim B, Dunman PM, McAleese FM, Macapagal D, Murphy E, McNamara PJ, Arvidson S, Foster TJ, Projan SJ, Kreiswirth BN. Global regulation of Staphylococcus aureus genes by Rot. J Bacteriol 2003;185:610–9. [17] Giraudo AT, Calzolari A, Cataldi AA, Bogni C, Nagel R. The sae locus of Staphylococcus aureus encodes a two-component regulatory system. FEMS Microbiol Lett 1999;177:15–22. [18] Giraudo AT, Raspanti CG, Calzolari A, Nagel R. Characterization of a Tn551-mutant of Staphylococcus aureus defective in the production of several exoproteins. Can J Microbiol 1994;40:677–81. [19] Giraudo AT, Cheung AL, Nagel R. The sae locus of Staphylococcus aureus controls exoprotein synthesis at the transcriptional level. Arch Microbiol 1997;168:53–8. [20] Novick RP, Jiang D. The staphylococcal saeRS system coordinates environmental signals with agr quorum sensing. Microbiology 2003; 149:2709–17. [21] Steinhuber A, Goerke C, Bayer MG, Doring G, Wolz C. Molecular architecture of the regulatory Locus sae of Staphylococcus aureus and its impact on expression of virulence factors. J Bacteriol 2003;185: 6278–86. [22] Yarwood JM, McCormick JK, Schlievert PM. Identification of a novel two-component regulatory system that acts in global regulation of virulence factors of Staphylococcus aureus. J Bacteriol 2001;183: 1113–23. [23] Pragman AA, Yarwood JM, Tripp TJ, Schlievert PM. Characterization of virulence factor regulation by SrrAB, a two-component system in Staphylococcus aureus, J Bacteriol 2004;186:2430–8. [24] Gertz S, Engelmann S, Schmid R, Ziebandt AK, Tischer K, Scharf C, Hacker J, Hecker M. Characterization of the sigma(B) regulon in Staphylococcus aureus. J Bacteriol 2000;182:6983–91. [25] Bischoff M, Dunman P, Kormanec J, Macapagal D, Murphy E, Mounts W, Berger-Ba¨chi B, Projan S. Microarray-based analysis of the Staphylococcus aureus sB regulon. J Bacteriol 2004;186: 4085–99. [26] Balaban N, Goldkorn T, Gov Y, Hirshberg M, Koyfman N, Matthews HR, Nhan RT, Singh B, Uziel O. Regulation of Staphylococcus aureus pathogenesis via target of RNAIII- activating Protein (TRAP). J Biol Chem 2001;276:2658–67. [27] Gov Y, Borovok I, Korem M, Singh VK, Jayaswal RK, Wilkinson BJ, Rich SM, Balaban N. Quorum Sensing in Staphylococci is regulated via phosphorylation of three conserved histidine residues. J Biol Chem 2004;279:14665–72. [28] Dell’Acqua A, Giacometti A, Cirioni O, Ghiselli R, Saba V, Scalise G, Gov Y, Balaban N. Suppression of drug-resistant Staphylococcal infections by the quorum-sensing inhibitor RNAIIIinhibiting peptide. J Infect Dis 2004;190:318–20. [29] Lina G, Boutite F, Tristan A, Bes M, Etienne J, Vandenesch F. Bacterial competition for human nasal cavity colonization: role of Staphylococcal agr alleles. Appl Environ Microbiol 2003;69:18–23. [30] Gertz S, Engelmann S, Schmid R, Ohlsen K, Hacker J, Hecker M. Regulation of sigmaB-dependent transcription of sigB and asp23 in two different Staphylococcus aureus strains. Mol Gen Genet 1999; 261:558–66. [31] Brouillette E, Lacasse P, Shkreta L, Belanger J, Grondin G, Diarra MS, Fournier S, Talbot BG. DNA immunization against the clumping factor A (ClfA) of Staphylococcus aureus. Vaccine 2002; 20:2348–57. [32] Eleaume H, Jabbouri S. Comparison of two standardisation methods in real-time quantitative RT-PCR to follow Staphylococcus aureus genes expression during in vitro growth. J Microbiol Methods 2004; 59:363–70.