Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways

ARTICLE IN PRESS

Metabolic Engineering 5 (2003) 133–149

Transcriptional profiling of gene expression in response to glucose in Bacillus subtilis: regulation of the central metabolic pathways Hans-Matti Blencke,a Georg Homuth,b Holger Ludwig,a Ulrike Ma¨der,b Michael Hecker,b and Jo¨rg Stu¨lkea,
a

Lehrstuhl fu¨r Mikrobiologie, Institut fu¨r Mikrobiologie, Biochemie und Genetik der Friedrich-Alexander-Universita¨t Erlangen-Nu¨rnberg, Staudtstr. 5, D-91058 Erlangen, Germany b Institut fu¨r Mikrobiologie und Molekularbiologie, Ernst-Moritz-Arndt-Universita¨t Greifswald, Jahn-Str. 15, D-17487 Greifswald, Germany Received 11 December 2002; received in revised form 10 February 2003; accepted 24 February 2003

Abstract Chemoheterotrophic bacteria use a few central metabolic pathways for carbon catabolism and energy production as well as for the generation of the main precursors for anabolic reactions. All sources of carbon and energy are converted to intermediates of these central pathways and then further metabolized. While the regulation of genes encoding enzymes used to introduce specific substrates into the central metabolism has already been studied to some detail, much less is known about the regulation of the central metabolic pathways. In this study, we investigated the responses of the Bacillus subtilis transcriptome to the presence of glucose and analyzed the role of the pleiotropic transcriptional regulator CcpA in these responses. We found that CcpA directly represses genes involved in the utilization of secondary carbon sources. In contrast, induction by glucose seems to be mediated by a variety of different mechanisms. In the presence of glucose, the genes encoding glycolytic enzymes are induced. Moreover, the genes responsible for the production of acetate from pyruvate with a concomitant substrate-level phosphorylation are induced by glucose. In contrast, the genes required for the complete oxidation of the sugar (Krebs cycle, respiration) are repressed if excess glucose is available for the bacteria. In the absence of glucose, the genes of the Krebs cycle as well as gluconeogenic genes are derepressed. The genes encoding enzymes of the pentose phosphate pathway are expressed both in the presence and the absence of glucose, as suggested by the central role of this pathway in generating anabolic precursors. r 2003 Elsevier Science (USA). All rights reserved. Keywords: Transcriptome analysis; Glycolysis; Krebs cycle; Pentose phosphate pathway; Acetate metabolism

1. Introduction Bacillus subtilis is widely used for the production of vitamins and other products including industrial enzymes such as amylases, proteases and lipases. Syntheses of these enzymes are repressed by the presence of glucose and other readily metabolizable carbon sources in the growth medium. It is therefore of crucial importance to understand the regulation of the central catabolic pathways and the mechanisms that govern carbon catabolite repression. B. subtilis uses glucose as the preferred source of carbon and energy (Stu¨lke and Hillen, 2000). This sugar is taken up and concomitantly phosphorylated by the


Corresponding author. E-mail address: [email protected] (J. Stulke). .

glucose permease of the phosphoenolpyruvate:sugar phosphotransferase system (PTS) and further catabolized by glycolysis and the pentose phosphate pathway (Gonzy-Tre´boul et al., 1991; Dauner et al., 2001). Similarly, other sugars and polyols are phosphorylated and converted to intermediates of either catabolic pathway (Stu¨lke and Hillen, 2000). The pyruvate generated by the oxidation of triose phosphates is finally oxidized in the tricarboxylic acid (TCA) cycle (Sonenshein, 2002). While the activity of the enzymes of the central metabolic pathways has been a subject of intensive analysis, regulation of the corresponding genes has only recently begun to attract attention. The ptsGHI operon encoding the PTS is induced in the presence of glucose by a termination/antitermination mechanism (Stu¨lke et al., 1997; Langbein et al., 1999). Glycolytic genes are

1096-7176/03/$ - see front matter r 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S1096-7176(03)00009-0

ARTICLE IN PRESS 134

H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

differently expressed: genes encoding enzymes that catalyze reversible reactions involved in both glycolysis and gluconeogenesis are constitutively expressed, whereas expression of genes encoding glycolytic enzymes that catalyze irreversible reactions is induced by glucose and other sugars. Regulation of the gapA gene encoding the key glycolytic enzyme glyceraldehyde-3phosphate dehydrogenase is mediated by the transcriptional repressor CggR (Tobisch et al., 1999; Fillinger et al., 2000; Ludwig et al., 2001). Similarly, the specific gluconeogenic gene gapB is only expressed in the absence of glucose in B. subtilis (Fillinger et al., 2000). The regulation of genes encoding enzymes of the pentose phosphate pathway has not yet been studied in B. subtilis. In contrast to glycolysis, the TCA cycle is repressed in the presence of glucose by binding of the CcpC repressor to the promoter regions of the citZ and citB genes encoding the major citrate synthase and aconitase, respectively (Tobisch et al., 1999; Jourlin-Castelli et al., 2000; Sonenshein, 2002). Interestingly, both glycolysis and the TCA cycle are synergistically regulated by sugars and amino acids (Rosenkrantz et al., 1985; Ludwig et al., 2001) suggesting a link of expression and activity of the central metabolic pathways to the overall physiological situation of the cell. Whereas the regulatory proteins, CggR and CcpC, control the expression of specific genes and operons, the pleiotropic regulatory protein CcpA is a major player in regulating gene expression in B. subtilis and other Gram-positive bacteria in response to the availability of readily utilizable carbon sources (Henkin et al., 1991; Henkin, 1996; Tobisch et al., 1999; Stu¨lke and Hillen, 1999; Yoshida et al., 2001; Moreno et al., 2001). In the presence of glucose, the HPr kinase/phosphatase (HPrKP) phosphorylates its target proteins, the HPr protein of the PTS and its regulatory homolog, Crh, at a conserved seryl residue, Ser-46. HPr-Ser-P and Crh-SerP are cofactors of CcpA, which trigger binding of the socalled catabolite-responsive elements (cre sites) by CcpA (Galinier et al., 1997, 1999). cre binding by CcpA results in repression or activation of transcription (Stu¨lke and Hillen, 2000). Mutations in ccpA result in a pleiotropic loss of carbon catabolite repression. Moreover, ccpA mutants exhibit a severe growth defect on minimal media suggesting that CcpA has important cellular functions in addition to exerting carbon catabolite repression. A detailed analysis of the growth defect of B. subtilis ccpA mutants revealed that CcpA is indispensable for the assimilation of ammonium. This was proposed to result from a lack of expression of the gltAB operon encoding glutamate synthase in ccpA mutants (Faires et al., 1999). Moreover, ccpA mutants require the presence of branched-chain amino acids and methionine for rapid growth (Ludwig et al., 2002a).

While many CcpA-regulated genes and operons have cre sites in their control regions, there are also several cases of CcpA-dependent genes which do not possess any obvious target site for CcpA binding and the existence of multiple mechanisms of CcpA action was proposed (Moreno et al., 2001). The detailed analysis of the role of CcpA in the expression of the glycolytic gapA operon revealed that CcpA is involved in controlling PTS sugar transport. In ccpA mutants, the HPrKP is highly active as a kinase and all HPr is phosphorylated at Ser-46 in this mutant. In this form, HPr cannot participate in sugar transport, and PTS sugar uptake is therefore defective in ccpA mutants. A substitution of Ser-46 of HPr by a non-phosphorylatable amino acid (ptsH1 mutation) simultaneously restores glucose uptake and induction of the gapA operon, even in a ccpA mutant background. Taken together, the ccpA mutation may interfere with the formation of the intracellular inducer of the gapA operon (Ludwig et al., 2002b). Thus, the regulation of gapA operon expression by CcpA is the paradigm of a novel second class of CcpAdependent regulatory mechanisms in addition to direct regulation by cre binding (class I). Given the importance of CcpA as a pleiotropic regulator controlling many central and specific catabolic pathways, it is not surprising that ccpA mutants have been studied both at the level of the proteome and the transcriptome (Tobisch et al., 1999; Yoshida et al., 2001; Moreno et al., 2001). The proteome analysis gave the first indication for the relevance of CcpA in the regulation of central metabolic pathways such as glycolysis and the TCA cycle. However, these studies were hampered by several problems. First, as with all studies at the genome level, the large amount of data generated makes it difficult to identify the most relevant and important findings. Second, the growth defect of ccpA mutants in minimal media results in bacterial strains that are not only genetically distinct but which also grow with different rates. Since growth rate is very important in adjusting the expression level of many genes, one can expect to find many responses to the change of the growth rate. This problem could be overcome by using complex media; however, it is often desirable to use defined conditions. Finally, the results obtained by proteome or transcriptome analysis do not easily allow to identify the mechanism by which CcpA controls the expression of a specific gene. In this study, we analyzed the response of B. subtilis cultures to the availability of glucose, and the role played by CcpA in this response. The prior identification of the nutrient requirements of the ccpA mutants allowed us to develop a minimal medium in which the ccpA mutant grows as fast as the wild-type strain. Moreover, the use of a ccpA ptsH1 double mutant enabled us to identify genes that belong to the new class II of CcpA-dependent genes. Our transcriptome data

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

indicate that in the presence of glucose, expression of enzymes for the catabolism of glucose to pyruvate and further to acetate are induced. Acetate formation with the concomitant formation of two molecules of ATP per molecule of glucose may thus be considered the final step of glucose utilization under these conditions.

135

2. Materials and methods

signal detection were carried out according to the instructions of the manufacturer (DIG RNA labelling kit and detection chemicals; Roche Diagnostics). Digoxigenin RNA probes specific for cggR and gapA (Tobisch et al., 1999; Ludwig et al., 2001) were used to detect the corresponding transcripts for quality assessment of the RNA preparations. The sizes of the RNA molecular weight markers (Gibco BRL) were as follows: 9.49, 7.46, 4.40, 2.37, 1.35, and 0.24 kb.

2.1. Bacterial strains and growth conditions

2.3. Transcriptome analysis

In this study, the B. subtilis strains GP303 (wild type; trpC2 amyE::(cggR-0 lacZ aphA3); Ludwig et al., 2001), GP337 (trpC2 ccpA::Tn917 ermC amyE::(cggR-0 lacZ aphA3); Ludwig et al., 2002a) and GP336 (trpC2 ccpA::Tn917 ermC ptsH1 amyE::(cggR-0 aphA3); Ludwig et al., 2002a) were used. These strains are isogenic derivatives of the wild-type strain 168. They are all resistant to kanamycin due to the presence of an aminoglycoside, phosphoryltransferase, encoded by the aphA3 gene. Bacteria were grown in CSE minimal medium containing succinate and glutamate as basic sources of carbon and nitrogen, respectively (Faires et al., 1999) supplemented with auxotrophic requirement (tryptophan, at 50 mg L1) and with the amino acids, leucine (50 mg L1), isoleucine (25 mg L1), valine (40 mg L1) and methionine (20 mg L1), to prevent growth defects of the ccpA mutant strains (Ludwig et al., 2002a). Glucose was added as indicated. SP plates were prepared by the addition of 17 g L1 Bacto agar (Difco) to the medium.

Synthesis of radioactively labelled cDNA and hybridization of B. subtilis macroarrays were performed as described by Eymann et al. (2002). The PanoramaTM macroarrays (Sigma-Genosys, Woodland, TX, USA) contained full-length PCR products of all 4107 B. subtilis protein-coding genes in duplicate. The macroarrays were used as recommended by the manufacturer. Each analysis was carried out two times using independently isolated RNA preparations and two different array batches of macroarrays. Exposed PhosphoImager screens were scanned with a Storm 860 PhosphoImager (Molecular Dynamics, Sunnyvale, CA, USA) at a resolution of 50 mm and a color depth of 16 bit. For quantification of the hybridization and background signals, we used the Array Vision software (Version 5.1., Imaging Research, St. Catherines, ON, Canada). Further analysis was carried out with the GeneSpringTM 3.2.12. software (Silicon Genetics, Redwood City, CA, USA). For normalization, the background-corrected values of the individual spots were divided by the median of all values of the particular array. Subsequently, the average of the normalized intensity values of the duplicate spots of each gene was used to calculate expression level ratios. Induction or repression ratios X3 in both experiments were considered to be significant. The significance of each signal on the macroarrays was estimated by calculating a quality factor (signal intensity valuestandard deviation of the signal intensity value/background value). Induction or repression levels given in Tables 1 and 2 were calculated only for those genes showing hybridization signals above a significance threshold (i.e., quality factor41.2) under at least one experimental condition. The regulation factors for all genes and operons under consideration in this study are summarized in Appendix A. Expression data for any gene are available from the authors upon request.

2.2. RNA isolation and Northern Blot analysis To isolate high-quality RNA suited for the detection of long transcripts and their precursors, RNA was prepared as described by Eymann et al. (2002). The cells were harvested at the exponential phase at an OD600 of 0.5. For RNA preparation, 25 ml cells were used. After mechanical cell disruption, the frozen powder was instantly resuspended in 3 ml lysis buffer (4 M guanidine isothiocyanate; 0.025 M sodium acetate, pH 5.3; 0.5% N-laurylsarcosine (w v1)). Subsequently, total RNA extraction with acid phenol solution and Northern Blot analysis were performed as described by Homuth et al. (1997). Digoxigenin (DIG) RNA probes were obtained by in vitro transcription with T7 RNA polymerase (Roche Diagnostics) using PCR-generated DNA fragments as template. The primers HMB43 (50 TGT CATATTCGGTGCAACTG)/HMB44 ð50 CTAATAC GACTCACTATAGGGAGAATTGCCAATTGCCAA GTAGAACATTCTGÞ were used to amplify a fragment specific for zwf. The reverse primer contained a T7 RNA polymerase recognition sequence (underlined in HMB44). In vitro RNA labelling, hybridization and

2.4. Evaluation of operon structures and regulatory sequences Final evaluation of the macroarray data included the consideration of putative operon structures derived from the genome sequence (Kunst et al., 1997) as well as previously characterized operons. Genes showing

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

136

Table 1 Summary of genes that are subject to induction by glucose Genea

Operon

Description

Glucose inductionb

Carbon metabolism: general functions cggR cggR gapA pgk tpiA pgm Glycolytic gapA operon eno ptsG ptsGHI Glucose-specific enzyme II pdhA

pdhABCD

Amino acid synthesis and transport gltA gltAB lysC ybxG ykbA

Nucleotide biosynthesis and transport purA purQ guaC yxjA

Other functions dltD

mdr ywoA

Unknown genes xkdQ yslB yueE yonV

Pyruvate dehydrogenase

Glutamate synthase Aspartokinase II Similar to amino-acid permease Similar to amino-acid permease

Adenylosuccinate synthetase

purEKBCSQLFMNHD Purine biosynthetic operon GMP reductase Similar to pyrimidine nucleoside transport

Position

atgaaaacgctttaa 301 (1) atgtaaacggttaaa 96 (1) ttggtatcggacgca 186 upstream of pdhD (1)

76.76

2

31.83

0

3.43

2

11.21 5.40 3.68

2 1 1

4.23

1

ttgtcatcggaacca +58 (1)

4.86

1

atggaagcgaacgaa 130 (1)

4.40 (2.60) 2 3.32 0 4.29 1

d-alanine transfer from 4.01 undecaprenol-phosphate to the poly(glycerophosphate) chain Multidrug-efflux transporter 3.61 Similar to bacteriocin 3.34 permease

PBSX prophage Similar to unknown proteins Similar to unknown proteins Unknown

ccpA cred classc Sequence

4.25 5.35 4.30 3.27

0

0 1

0 1 0 0

a If genes are part of an operon, the first gene of the operon is indicated. If a gene further downstream in the operon is the first one to be induced more than threefold, this gene is indicated. For these operons, the factor of induction of the promoter-proximal gene is shown in parentheses. b The factor of induction by glucose is given. Details of regulation by glucose in the three studied strains are listed in Appendix A. c The CcpA classes are: 0, CcpA does not play any role in regulation; I, CcpA directly mediates induction; II, CcpA controls glucose induction indirectly via regulation of glucose transport (see Ludwig et al., 2002b). d For cre sites deviating from the search consensus, the number of deviations is indicated. Positions of the cre sites are given relative to the start codon of the first gene of an operon. Exceptions are indicated.

significant expression were analyzed for their transcriptional organization using the SubtiList database (http:// genolist.pasteur.fr/SubtiList; Moszer et al., 1995). If genes were supposed to be members of polycistronic transcription units, all genes of the presumed operons were included in the analysis, even if not all genes met the significance criteria. To identify putative cre sites that may serve as targets for glucose-dependent regulation by the pleiotropic regulator protein CcpA, the SubtiList database was searched using the following consensus sequence: WTGNAANCGNWNNCW (Miwa et al., 2000). The search algorithm allowed one

deviation from the consensus and was performed in regions from 200 bp upstream to 200 bp downstream from gene starts.

3. Results 3.1. Quality of the transcriptome data and classification of glucose responses To identify the genes that respond to the presence of glucose in the growth medium, we cultivated the

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

137

Table 2 Summary of genes that are subject to repression by glucose Genea

Operon

Description

Glucose repressionb

CcpA classc

cred Sequence

Position

Carbon catabolism: specific functions dctP glpT

glpTQ

glpF

glpFK

rbsR nagA

rbsRKDACB ywsB nagAB

acuA acoR

acuABC acoR sspH

acsA yxiA

1

atgaaaacgctatca

64

0.16

1

aagaaagcgctatca (1)

159

0.12

1

0.10 0.35

1 1

ttgacaccgctttca (1) aagaaatcgctttca (1) atgtaaacggttaca

182 +81 34

0.28 0.27

1 1

ttgaaaacgctttat (1) ttgaaagcgctttat (1)

75 67

0.22 0.23

1 1

ttgaaagcgctttat (1) ttgaaagcgttacca atgtaagcgtttaaa (1)

+0 +6 46

0.32 0.26

1 1

tagaaaacgctttca (1)

34

Aconitase Citrate synthase (major) Glyceraldehyde-3-phosphate dehydrogenase Phosphoenolpyruvate carboxykinase

0.27 0.15 0.11

1 1 0

atgtaagcattttct (1)

114

0.14

2

atggaaatgcacaca (1)

108

Similar to enoyl CoA hydratase Similar to 3-hydroxybutyrylCoA dehydratase Similar to 3-hydroxyacylCoA DHG b-hydroxybutyrate dehydrogenase

0.06

1

Aagtaagcgcataca (1)

29

0.26 (0.43)

1

0.22

0

0.25

1

0.21 0.18

1 1

ttgtaagcgtataca ttgtaaccgttatcc (1)

188 +148 in qcrB

0.09 (0.60)

1

aaataaacgatgaca (2)e ttgaatgcgcttaca (1)

207e +3, in ctaD

0.10 (0.64)

1

0.24 0.22 (0.63) 0.20 0.21 (0.51) 0.19 0.18

1 1 1 1 0 0

0.23 0.13

1 1

atgaaagcgctatca

161

Ribose utilization operon N-acetylglucosamine utilization operon Acetoin dehydrogenase Activator of the acoABCL operon Acetyl-CoA synthetase Endo-1,5-alpha-larabinosidase Endo-beta-1,3-1,4 glucanase Pectate lyase

bglS pel Carbon metabolism: general functions citB citZ citZ icd mdh gapB pckA

Lipid metabolism yhaR ysiB

lcfA ysiAB etfB

yusL

yusLKJ

yxjF

Respiration cccA qcrA

qcrABC

ctaC

ctaBCDEFG

Sporulation phrE

rapE phrE

rapA phrC rapF phrG spoIIAA sspG

0.16

C4-dicarboxylate transport protein Glycerol-3-phosphate permease Glycerol uptake facilitator

rapA phrA rapC phrC rapF phrF ywhH rapG phrG spoIIA AB sigF

Two-component regulatory systems phoP phoPR yesM

Cytochrome c550 Menaquinol:cytochrome c oxidoreductase Cytochrome caa3 oxidase

Phosphatase (RapE) regulator RAP phosphatase RAP phosphatase RAP phosphatase RAP phosphatase sigF-operon SASP-G (minor)

Phosphate regulation Two-component sensor kinase

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

138 Table 2 (continued) Genea

Operon

Other functions cstA cstA ysfE pksE yxbB

pksABCDEFGHIJLSMNR yxbBA yxnB asnH yxaM

bpr dppA appA

dppABCDE appABC yjbA

Unknown genes yfkN

yvqI

yvqJIH

ybcO yfmG yitN

ybcO ybcP yfmGH yitNM

ykuD ykzF ylbO

ykzF ykuL

ylbP ymaH yojL yopL yozM ypiF yqxI yttP yvaW

ypiBF yqxIJ yvaWXY

yvcI yvmB yvnA ywjF yydG

yydGHIJ

Description

Carbon starvation-induced protein Polyketide synthesis Unknown; asnH: asparagine synthetase Bacillopeptidase F d-alanyl-aminopeptidase Oligopeptide ABC transporter

Similar to 20 ,30 -cyclicnucleotide 20 phosphodiesterase Similar to macrolide-efflux protein Unknown Unknown Similar to unknown proteins from B. subtilis Similar to unknown proteins Unknown Similar to unknown proteins from B. subtilis Similar to unknown proteins Similar to host factor-1 protein Similar to cell wall-binding protein Unknown Unknown Similar to unknown proteins Unknown Similar to unknown proteins Similar to unknown proteins from B. subtilis Similar to mutator MutT protein Similar to unknown proteins Similar to unknown proteins from B. subtilis Similar to iron–sulphurbinding reductase Unknown

Glucose repressionb

CcpA classc

cred Sequence

Position

0.29

1

atgaatgcggttaca (1)

+0

0.17 (0.66) 0.12

0 0

ttgaaatggatgcca (1)

+103 in pksD

0.13 0.35 0.20

0 0 1

ttgaaagaggattct (1)

124

0.19

1

0.23 (0.43)

0

ttgaaagtgatagca (1)

+13

0.025 0.25 0.32

0 0 0

0.30 0.23 0.31

1 1 0

0.13 0.13

1 0

atgaaaccgattaat (1)

+0

0.33

1

0.24 0.07 0.15 (0,57) 0.26 0.32 0.12

1 1 1 1 1 0

ttgataccgctgtca (1)

+52 in ypiF

0.18

1

0.26 0.15

1 1

ttgacaacgaaaaca (1)

103

0.23

0

ttgtaaccgcttacg (1)

+40

0.22

0

a

If genes are part of an operon, the first gene of the operon is indicated. If a gene further downstream in the operon is the first one to be repressed more than threefold, this gene is indicated. For these operons, the factor of repression of the promoter-proximal gene is shown in parentheses. b The relative expression of a gene in the presence of glucose is shown (in absence of glucose: 1.0). Details of regulation by glucose in the three studied strains are listed in Appendix A. c The CcpA classes are as explained in the legend to Table 1. d For cre sites deviating from the search consensus, the number of deviations is indicated. Positions of the cre sites are given relative to the start codon of the first gene of an operon. Exceptions are indicated. e This cre site was proposed by Liu and Taber (1998).

B. subtilis strains GP303 (wild type), GP337 (ccpA) and GP336 (ccpA ptsH1) in CSE minimal medium containing the amino acids required for growth of ccpA mutant strains. The basic medium contained succinate and

glutamate to which glucose was added as appropriate. In this medium, all the three strains grew with similar rates in the absence of glucose. In the presence of glucose, the wild-type strain GP303 grew somewhat

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149 + Glc

139

-Glc 10

1

1

OD

600

OD600

10

0.1

0.1

0.01

(A)

0.01 0

100

200 300 time (min)

400

500

0

(B)

100

200 300 time (min)

400

500

Fig. 1. Growth of B. subtilis wild-type and mutant strains in a defined medium. The growth of the wild-type strain GP303 (~), the ccpA mutant strain GP337 (’) and the ccpA ptsH1 double mutant strain GP336 (m) were monitored in the presence (A) and in the absence (B) of glucose by measuring the optical density at 600 nm (OD 600). Cultures were grown at 371C under vigorous agitation in CSE medium70.5% (w v1) glucose containing the amino-acid mixture consisting of leucine, isoleucine, valine and methionine.

faster due to the impaired glucose transport in ccpA mutants (Fig. 1). The quality of the RNA preparations was assessed by Northern Blot hybridization using riboprobes specific for gapA and cggR. These genes are part of a highly unstable 7 kb transcript. The detection of this transcript was an indication that the RNA preparations had the quality necessary to perform transcriptome analyses (data not shown). DNA macroarrays containing all known protein-encoding genes of B. subtilis were used to record the comparative transcriptional profiles of cells growing exponentially in CSE medium in the presence or absence of glucose. Prior to quantification of the array data, the quality and reproducibility of the array experiment was estimated by comparing the normalized spot intensities in scatter diagrams (Fig. 2). Array data from hybridizations of independent samples representing the same cultivation condition always yielded high Pearson correlation coefficients (see Fig. 2A for an example). As expected, Pearson correlation coefficients calculated for samples of cultures grown in the presence and absence of glucose or for wild-type and mutant strains were lower (see Fig. 2B). All genes subject to regulation by glucose were classified depending on the role of CcpA. Genes, which were subject to CcpA-independent glucose regulation, were grouped as class 0. CcpA-dependent genes which are likely to be controlled by direct CcpA binding to a cre site in front of the regulated gene were grouped in class I. Indirect effects of CcpA due to the sugar transport deficiency were restored by the ptsH1 suppressor mutant, and the respective genes are members of class II of CcpA-dependent genes (see Ludwig et al., 2002b).

3.2. Identification of the genes activated by glucose In this study, a gene was considered to be regulated by glucose if its expression was induced or repressed at least threefold in both experiments. Our transcriptome analysis revealed that the transcription of 18 genes and operons was activated by glucose (Table 1). Several of the induced genes encode enzymes of general carbon metabolism. The strongest induction was seen for the glycolytic gapA operon encoding enzymes of triose phosphate interconversion with an induction factor of 77 for cggR, the promoter-proximal gene of the operon. Induction of this operon depended on a functional CcpA; however, inducibility was restored in a ccpA ptsH1 double mutant suggesting an indirect effect of CcpA. This finding is in agreement with the idea that the gapA operon is the prototype of the novel class II of CcpA-dependent genes and operons (Ludwig et al., 2002b, see Section 4). Similarly, expression of the pdhABCD operon coding for the pyruvate dehydrogenase complex was activated by glucose. However, induction of this operon was only threefold and was also mediated by CcpA in an indirect manner. Glucose is transported in B. subtilis by the PTS. Both the glucose-specific and general components of this system are encoded by the ptsGHI operon. In agreement with previous studies, a strong induction of this operon by glucose was observed. This induction was completely independent of CcpA, but may rather be mediated by transcriptional antitermination (Stu¨lke et al., 1997). Several genes encoding enzymes of amino-acid biosynthesis or transport were induced by glucose. Very strong induction was detected for the gltAB operon encoding the two subunits of glutamate synthase, the

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

140 10,000,000

r = 0.933

wt-glc I

1,000,000

100,000

10,000

1,000 1,000

10,000

100,000

1,000,000

10,000,000

wt-glc II

(A) 10,000,000

r = 0.879

wt-glc I

1,000,000

100,000

10,000

1,000 1,000

10,000

(B)

100,000

1,000,000

10,000,000

wt + glc

Fig. 2. Scatter diagrams of normalized spot intensities. (A) Spot intensities of two array hybridizations with two independent samples from the wildtype strain GP303 grown in the absence of glucose (wt glc I versus wt glc II). (B) Spot intensities of array hybridizations from a probe of the wildtype strain GP303 grown in the absence of glucose (wt glc) and a sample of the same strain grown in the presence of glucose (wt +glc). The significance threshold of threefold induction or repression is symbolized by the two solid lines. r; Pearson correlation coefficient.

only enzyme catalyzing glutamate biosynthesis in B. subtilis (Belitsky, 2002). Induction of gltAB required a functional CcpA. This is in agreement with the observation that ccpA mutants are phenotypically similar to gltAB mutants (Faires et al., 1999). However, the role of CcpA in gltAB induction seems to be indirect, as demonstrated by the restoration of gltAB induction in a ccpA ptsH1 double mutant. The lysC gene encoding aspartokinase II was induced by glucose in a

CcpA-dependent manner. In ccpA mutants, this enzyme may be functionally replaced by the two other aspartokinases. This would explain that ccpA mutants do not require amino acids of the aspartate family for growth (Ludwig et al., 2002a). In addition, two genes encoding putative amino-acid permeases (ybxG, ykbA) were induced by glucose. Several genes encoding enzymes of nucleotide biosynthesis were induced by glucose, among them the

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

purEKBCSQLFMNHD operon and the purA gene. All of the genes of the pur operon were induced by glucose; however, purQ was the first gene of the operon showing consistently more than threefold induction. Glucose induction of purA involved CcpA, and a putative cre target site is present upstream of the gene. In contrast, CcpA seemed to play an indirect role for the induction of the pur operon. Moreover, the guaC gene encoding GMP reductase and yxjA coding for a putative nucleoside transporter were induced by the presence of glucose. 3.3. Identification of the genes subject to repression by glucose Table 2 shows the genes whose expression is repressed by glucose. 59 genes and operons were significantly repressed by glucose under the conditions employed in this study. The largest group of these genes encodes enzymes involved in the utilization of specific carbon sources such as glycerol, ribose, N-acetylglucosamine, acetoin, and acetate. In addition to catabolic enzymes, there were also genes encoding transporters of alternative carbon sources repressed by glucose, among them dctP, glpF and glpT encoding transporters for C4dicarboxylic acids, glycerol and glycerol-3-phosphate, respectively. Moreover, a few genes encoding extracellular carbohydrate degradative enzymes such as bglS, pel and yxiA encoding b-1,3-1,4-glucanase (lichenase), pectate lyase and a putative a-arabinosidase, respectively, were repressed by glucose. Glucose repression of most of these genes has been demonstrated in previous studies, and this repression depended on CcpA in all cases. cre sites are present in the control regions of all genes and operons with the exception of the nagAB operon and the pel gene. This is reinforced by the finding that all of these genes are members of class I of CcpAdependent genes, i.e., their repression is mediated by direct interaction between CcpA and a cre site. Moreover, it is in good agreement with the published evidence (Asai et al., 2000; Darbon et al., 2002; Strauch, 1995; Ali et al., 2001; Grundy et al., 1994; Kru¨ger et al., 1993). Only a small fraction of genes related to general carbon metabolism was repressed by glucose: the repression of citZ and citB encoding the major citrate synthase and aconitase, respectively, was exerted by CcpA. In contrast, repression of gapB was also detectable in a ccpA mutant strain, which is in agreement with previously published data (Moreno et al., 2001). The repression of gapB encoding an NADP-dependent glyceraldehyde-3-phosphate dehydrogenase by glucose is related to its function in gluconeogenesis (Fillinger et al., 2000). Another gene needed for growth on succinate as a carbon source is pckA encoding PEP carboxykinase. Glucose repression of pckA depended on a functional ccpA, but could be

141

restored in a ccpA ptsH1 double mutant and was thus only indirectly regulated by CcpA. This pattern of regulation defines pckA as the first example of a glucoserepressed gene that is a member of class II of CcpAdependent genes (see Ludwig et al., 2002b). Several genes involved in b-oxidation of fatty acids were repressed by glucose, among them the putative yusLKJ operon encoding 3-hydroxyacyl-CoA dehydrogenase, b-ketoacyl thiolase, and fatty acid-CoA dehydrogenase. Moreover, two genes encoding enoyl CoA hydratases (yhaR and ysiB) were repressed by glucose. Repression of the latter two genes required the ccpA gene, whereas glucose repression of the yusLKJ operon was independent of CcpA. B. subtilis has two electron transfer pathways from menaquinol to oxygen: first, menaquinol can be directly oxidized by one of the three menaquinol oxidases, and second, it can become reoxidized via an electron transfer chain consisting of menaquinol:cytochrome c oxidoreductase (bc complex), cytochrome c-550 and cytochrome c terminal oxidase caa3 encoded by qcrABC, cccA and ctaCDEF, respectively (von Wachenfeldt and Hederstedt, 2002). The genes encoding the components of the latter pathway were concertedly repressed by glucose. This observation is in agreement with previous reports (Yu et al., 1995; Monedero et al., 2001, Liu and Taber, 1998). Repression of the three operons by glucose was mediated by CcpA. cre sites are present in the control regions of all the three operons; however, the activity has so far been demonstrated only for the cre site of cccA (Monedero et al., 2001). Carbon catabolite repression of sporulation has long been recognized (Sonenshein, 1989). Our analysis indicates that expression of several of the response regulator phosphatases and their respective regulators are subject to repression by glucose. Repression of all these genes involved CcpA; however, no cre sites are present in the control regions. Previous work suggested that CcpA provides a regulatory link between carbon and nitrogen metabolism (Faires et al., 1999; Ludwig et al., 2002a). Our results show that there seems also to be a link between carbon and phosphate regulation, as the phoPR twocomponent regulatory system controlling expression of the phosphate starvation regulon (Hulett, 2002) was repressed by glucose in a CcpA-dependent manner. In Escherichia coli, expression of several proteins is induced by carbon starvation. One of these proteins, CstA, is highly conserved in bacteria. Its induction in E. coli is mediated by the cAMP/Crp complex (Schultz and Matin, 1991). In B. subtilis, this gene was also repressed by glucose. It belongs to class I of the CcpA-dependent genes. In accordance with this finding, a potential cre site was detected overlapping the translational start site of cstA. Unfortunately, the function of CstA is unknown.

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

142

3.4. Regulation of the central metabolic pathways B. subtilis catabolizes glucose via glycolysis and the pentose phosphate pathway. The pyruvate formed can be further oxidized to acetyl-CoA or can be used to regenerate NAD+ in fermentation. Similarly, the acetylCoA can be completely oxidized in the Krebs cycle or the energy of the thioester can be directly used in substrate-level phosphorylation to form acetate (see Fig. 3). To understand the regulatory interrelationships between the different steps in metabolism, the transcriptome data were analyzed for the regulation of the genes encoding enzymes of the central metabolic pathways. The results are summarized in Table 3. Glycolysis (from external glucose to pyruvate) involves 10 enzymes encoded in five genetic loci. In good agreement with previous work (Ludwig et al., 2001), most glycolytic genes were induced by glucose. The mechanisms of regulation of glycolytic genes and operons have been studied to some detail. They include transcriptional antitermination, repression of transcrip-

glucose ptsGHI zwf 6-P-gluconolactone pgi

6-P-gluconate rpe

glucose-6-P

xylulose-5-P

fructose-6-P fbp pfk

sedoheptulose-7-P

fructose-1,6-bis-P fbaA tpi glyceraldehyde-3-P DHAP gapA

gntZ

ribulose-5-P ywlF?

ribose-5-P tkt glyceraldehyde-3-P ywjH

fructose-6-P

erythrose-4-P tkt

gapB glyceraldehyde-3-P

1,3-bis-P-glycerate

xylulose-5-P

pgk 3-P-glycerate pgm 2-P-glycerate eno PEP pykA pyruvate pckA

alsS

α-acetolactate

ldh

alsD

acetoin

lactate

pdhABCD pycA pta acetyl-CoA

acetyl-P

ackA

acetate

citZ, citA oxaloacetate

citrate citB

mdh

isocitrate

L-malate

icd

citG

2-oxoglutarate

fumarate

odhAB pdhD

sdhCAB

succinyl-CoA

succinate sucCD

Fig. 3. Overview on glycolysis, pentose phosphate shunt, Krebs cycle and their interconnections in B. subtilis. The regulation of the relevant genes and the enzymes for which they are coding are presented in Table 3. Abbreviations used: PEP, phosphoenolpyruvate; DHAP, dihydroxyacetone phosphate.

tion, and differential segmental mRNA stability (Stu¨lke et al., 1997; Ludwig et al., 2001; Meinken et al., 2003). The genes of the pentose phosphate pathway were all expressed constitutively. Since regulation of this metabolic pathway has not been studied before, we wished to obtain an independent confirmation. For this purpose, the transcription of the zwf gene encoding the first enzyme of the pathway, glucose-6-phosphate dehydrogenase, was studied by Northern Blot analysis. The zwf gene was strongly transcribed as a monocistronic transcription unit with a transcript size of 1.5 kb (see Fig. 4). This correlates well with the size of the zwf ORF of 1.47 kb and the presence of a putative transcriptional terminator downstream of zwf. The zwf transcript was present in similar amounts in cultures grown with or without glucose in the wild-type as well as in the ccpA and ccpA ptsH1 mutant strains. The pyruvate dehydrogenase encoded by the pdhABCD operon links glycolysis to the Krebs cycle and overflow metabolism. The presence of glucose resulted in a threefold induction of the operon. This induction may be necessary to avoid pyruvate accumulation. Under our experimental conditions, the alsSD operon encoding a-acetolactate synthase and decarboxylase as well as the lctEP operon coding for lactate dehydrogenase and permease were not induced, suggesting that pyruvate is specifically catabolized to acetylCoA. The fate of acetyl-CoA is determined by the competitive action of two enzymes: the citrate synthase (citZ) may use acetyl-CoA to initiate the Krebs cycle with the concomitant final oxidation of the carbon, whereas phosphotransacetylase (pta) converts acetylCoA to acetyl-phosphate. Under the conditions of this study, pta gene expression was induced in the presence of glucose, whereas citZ expression was strongly reduced. In agreement with this observation, the complete metabolic pathways, i.e., acetate formation and the Krebs cycle were regulated to the same direction as pta and citZ, respectively. Acetyl-phosphate is finally converted to acetate by acetate kinase (ackA). This reaction allows the formation of ATP, and is thus an additional step of substrate-level phosphorylation for glucose-grown cells of B. subtilis. Induction of pta and ackA expression was significant but below the threshold used for the previous analysis. Transcription of both genes is induced by direct binding of CcpA to cre sites upstream of the promoters (Turinsky et al., 1998; Presecan-Siedel et al., 1999). B. subtilis encodes two citrate synthases: expression of the major citrate synthase (citZ) was severely repressed by glucose, while the citA gene encoding the minor citrate synthase was constitutively expressed. The genes encoding the enzymes for the conversion of citrate to succinate were all repressed by glucose. It is interesting to note that the 2-oxoglutarate dehydrogenase is composed of the proteins encoded in differentially

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

143

Table 3 Regulation of genes encoding enzymes of the central metabolic pathways Gene Glycolysis ptsG ptsH ptsI pgi pfk fbaA tpi gapA pgk pgm eno pykA

Operon

Description

Glucose regulationa

ptsGHI ptsGHI ptsGHI

Glucose-specific enzyme II HPr PTS enzyme I Phosphoglucoisomerase Phosphofructokinase Fructose-1,6-bisphosphate aldolase Triose phosphate isomerase Glyceraldehyde-3-phosphate dehydrogenase Phosphoglycerate kinase Phosphoglycerate mutase Enolase Pyruvate kinase

31.83 1.98 4.28 1.42 1.46 1.42 2.77 10.68 2.81 7.33 3.28 1.38

pfk pykA cggR gapA cggR gapA cggR gapA cggR gapA cggR gapA pfk pykA

pgk pgk pgk pgk pgk

tpiA tpiA tpiA tpiA tpiA

pgm pgm pgm pgm pgm

eno eno eno eno eno

Pyruvate dehydrogenase pdhA pdhABCD pdhB pdhABCD pdhC pdhABCD pdhD pdhABCD

Pyruvate Pyruvate Pyruvate Pyruvate

Fermentative and overflow metabolism alsS alsSD alsD alsSD ldh ldh lctP lctP ldh lctP pta ackA

a-Acetolactate synthase a-Acetolactate decarboxylase Lactate dehydrogenase Lactate permease Phosphotransacetylase Acetate kinase

1.35 0.81 1.56 1.46 2.56 2.46

Krebs acid cycle citA citZ citZ icd mdh icd citZ icd mdh mdh citZ icd mdh citB odhA odhAB odhB odhAB sucC sucCD sucD sucCD sdhC sdhCAB sdhA sdhCAB sdhB sdhCAB citG

Citrate synthase (minor) Citrate synthase (major) Isocitrate dehydrogenase Malate dehydrogenase Aconitase 2-Oxoglutarate dehydrogenase (E1 subunit) 2-Oxoglutarate dehydrogenase (E2 subunit) Succinyl-CoA synthetase (beta subunit) Succinyl-CoA synthetase (alpha subunit) Succinate dehydrogenase (cytochrome b-558 subunit) Succinate dehydrogenase (flavoprotein subunit) Succinate dehydrogenase (iron–sulfur protein) Fumarate hydratase

1.49 0.15 0.45 0.82 0.27 0.42 0.33 0.37 0.42 0.98 0.59 0.62 0.56

Pentose phosphate pathway zwf gntZ rpe ywlF tkt ywjH

Glucose-6-phosphate 1-dehydrogenase 6-Phosphogluconate dehydrogenase Ribulose-5-phosphate epimerase Ribose-5-phosphate isomerase (putative, based on homology) Transketolase Transaldolase (putative, based on homology)

0.74 2.75 1.37 1.18 1.66 1.16

Gluconeogenesis fbp gapB pckA

Fructose-1,6-bisphosphatase Glyceraldehyde-3-phosphate dehydrogenase Phosphoenolpyruvate carboxykinase

0.92 0.11 0.14

Anaplerotic reaction pycA

Pyruvate carboxylase

1.52

a

dehydrogenase dehydrogenase dehydrogenase dehydrogenase

(pyruvate decarboxylase, subunit a) (pyruvate decarboxylase, subunit b) (dihydrolipoamide acetyltransferase) (lipoamide dehydrogenase)

3.43 2.78 1.94 2.03

The relative gene expression in the presence of glucose is shown (without glucose: 1.0). Details of regulation by glucose in the three studied strains are listed in Appendix A.

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

144

ccpA

ccpA ptsHI

+ - +

- +

WT

9.49 7.46 4.4

23S rRNA 2.37 1.5 kb 1.35

Fig. 4. Regulation of the zwf gene. For Northern Blot analysis, total RNA was isolated from B. subtilis GP303 (wild type), GP337 (ccpA) and GP336 (ccpA ptsH1) grown in CSE minimal medium containing the amino-acid mixture in the absence () or presence (+) of 0.5% (w v1) glucose as indicated. Total RNA was prepared and separated by electrophoresis in a 0.8% formaldehyde agarose gel and, after blotting, the nylon membrane was hybridized to a zwf-specific DIGlabelled riboprobe. Samples of 5 mg of RNA were applied per lane. The main signal corresponds to the 1.5 kb zwf monocistronic mRNA. Note that the probe cross-hybridized with the 23S rRNA.

regulated operons: the odhAB operon encoding the E1 and E2 components was repressed by glucose, whereas the E3 (PdhD, lipoamide dehydrogenase) is encoded in the glucose-inducible pdhABCD operon. The enzymes necessary for the reactions from succinate to oxaloacetate (and vice versa) were expressed in a constitutive manner (less than twofold repression by glucose). For growth on organic acids, B. subtilis needs to perform gluconeogenesis. The pckA and gapB genes encoding phosphoenolpyruvate carboxykinase and the anabolic glyceraldehyde-3-phosphate dehydrogenase were subject to a strong glucose repression (for details of regulation, see above, Table 2). In contrast, the fbp gene encoding fructose-1,6-bisphosphatase was expressed constitutively. To utilize glucose as a single carbon source, B. subtilis needs the pyruvate carboxylase (pycA) to replenish the Krebs cycle intermediate pool. Expression of this gene was constitutive under our experimental conditions.

4. Discussion Efficient utilization of carbon and energy sources is important for any organism to be successful in competition in natural environments. On the other hand, efficient carbon source utilization is also desirable for any practical application of bacteria in production

processes. In agreement with previous studies (Dauner et al., 2001), the data presented in this work clearly demonstrate that the carbon metabolism of B. subtilis is optimized to use glucose incompletely, but quickly, as a source of carbon and energy. In contrast, the gain of energy is of higher priority for cells growing in the absence of the sugar. In the presence of glucose, glycolysis and acetate production are induced resulting in two extra substrate-level phosphorylations per molecule of glucose. On the other hand, the Krebs cycle and genes encoding enzymes of the respiration chain are repressed under these conditions. Our medium contained glutamate and succinate as intermediates of the Krebs cycle and precursors for the biosynthesis of amino acids and nucleotides. Therefore, energy production by glycolysis and acetate formation can be uncoupled from anabolism under these conditions, even if the energy yield is not maximal. The validity of this idea is supported by flux analyses of B. subtilis metabolism in carbon-limited and excess-carbon cultures (Dauner et al., 2001). It had been proposed that heterotrophic organisms have a selective advantage if they are optimized towards a high rate of ATP synthesis, rather than towards a high yield of ATP, as this allows them to successfully outcompete other cells with a slower metabolism (Unden, 1998; Pfeiffer et al., 2001). Similar patterns of the regulation of the central metabolic pathways were observed when comparing the global expression pattern of glucose- and acetate-grown cells of E. coli (Oh et al., 2002). One interesting outcome of this study concerns the fate of pyruvate. In the presence of glucose, the oxidative decarboxylation of pyruvate to acetyl-CoA is induced. Acetyl-CoA is then the starting point of two alternative pathways (see Fig. 3): it may be used as a substrate of citrate synthase to initiate the Krebs cycle, or it can be converted to acetate. Acetate formation is one of the pathways that are collectively termed overflow metabolism (Russell and Cook, 1995) and that serve to excrete excess carbon from the cell. In addition to acetate, B. subtilis is able to secrete lactate, acetoin, and butanediol. While acetate synthesis allows an additional substrate-level phosphorylation without regenerating NADH, the pathways leading to butanediol and lactate cannot be used for energy conservation; they do, however, recycle NADH. This makes these latter reactions very important for growth under anaerobic conditions. Indeed, the ldh lctP and alsSD operons encoding enzymes of these pathways are induced under anaerobic conditions, and more specifically, in the absence of terminal electron acceptors (Cruz Ramos et al., 2000; Ye et al., 2000). In addition, expression of both operons requires the transcriptional activator AlsR, which is thought to respond to a low intracellular pH and/or the acetate concentration (Cruz Ramos et al., 2000; Renna et al., 1993). The preferential production of

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

acetate followed by a switch to neutral products resembles the hierarchy of fermentation pathways in Clostridium acetobutylicum. This organism produces butyric acid with a concomitant substrate-level phosphorylation. Once the pH of the medium falls below a certain threshold, the bacteria switch to solvent formation which allows the regeneration of NADH but not the production of an extra ATP (Du¨rre et al., 2002). While the regulation of glycolysis and the Krebs cycle has already been studied at the level of gene expression (Ludwig et al., 2001; Sonenshein, 2002), this is the first report addressing regulation of the pentose phosphate pathway. This pathway serves two major functions: it provides the NADPH needed for anabolic reactions and it generates precursors for tryptophan and nucleotide biosyntheses. This general importance may explain why the genes of the pentose phosphate pathway are not regulated by the presence or absence of glucose. A notable exception is the gntZ gene encoding 6-phosphogluconate dehydrogenase, the last enzyme of the oxidative part of the pathway. Expression of this gene is weakly induced in the presence of glucose. This may reflect the irreversibility of the reaction catalyzed by 6phosphogluconate dehydrogenase. Moreover, there is no need to close the gap between ribulose-5-phosphate and glucose-6-phosphate since gluconeogenesis is operative in the absence of glucose (see Table 3). Weak glucose induction of the genes encoding enzymes of the oxidative part and constitutive expression of the sugar phosphate interconversion enzymes was also observed in E. coli (Oh et al., 2002). The key regulator of carbon metabolism in B. subtilis and other Gram-positive bacteria is the transcriptional regulator, CcpA (Stu¨lke and Hillen, 2000). This is supported by the observation that glucose regulation of both activated and repressed genes is in most cases mediated by CcpA (see Tables 1 and 2). CcpA can affect gene expression by direct binding to a cre target site in the control region of the regulated genes (class I) or by its role in controlling glucose transport with the resulting effects on the accumulation of intracellular inducers (class II). In addition, other, so far unknown modi of CcpA action may exist (Ludwig et al., 2002b). In this study, we used B. subtilis strains that allowed us to classify the glucose-regulated genes. Effects of a ccpA mutation that results from reduced sugar transport can be reverted by the restoration of sugar transport in the ccpA ptsH1 double mutant. This study revealed that activation of gene expression by glucose occurs by

145

CcpA-independent mechanisms (class 0), by direct CcpA regulation (class I) or by specific mechanisms that require glucose transport (class II). These mechanisms are equally represented among the activated genes and operons. It is, however, interesting to note that the most strongly induced operons are CcpA-independent (ptsGHI) or belong to class II (gapA, gltAB). A completely different picture emerges with the genes that are repressed by glucose. Only one of these genes, pckA, is a member of class II of CcpA-regulated genes, i.e., repression depends on an intracellular metabolite that cannot accumulate in the ccpA mutant due to insufficient glucose uptake. In contrast, 38 genes and operons are members of class I of CcpA-regulated genes, i.e., their repression is caused by CcpA–cre interaction. All glucose-repressed genes that encode enzymes involved in the utilization of secondary carbon sources and respiration belong to this class. These two sets of genes do possess cre sequences that are probably involved in regulation by CcpA. As observed in previous studies (Moreno et al., 2001), there are many CcpA-regulated genes that do not possess cre target sites. The mechanism(s) by which CcpA regulates the expression of these genes remains(s) to be elucidated. In contrast, there are potential cre sites in the promoter regions of glucoseresponsive genes, which are clearly not involved in regulation. This was demonstrated for the ptsGHI operon (class 0) and the gapA operon (class II) (Stu¨lke et al., 1997; Ludwig et al., 2001). In future studies, it will be interesting to uncover the regulatory interplay between CcpA, pathway-specific regulators, and the metabolites that serve as effectors in the control of central metabolism in B. subtilis. This knowledge will undoubtedly be helpful in the improvement of strains for production purposes.

Acknowledgments We are grateful to Florian Ernst for his help with the array experiments. This work was supported by grants from the Deutsche Forschungsgemeinschaft (Stu 214/21; Stu 214/2-2) and the Fonds der Chemischen Industrie.

Appendix A Regulation factors for all genes and operons in this study are given in Table 4.

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

146

Table 4 Regulation of genes mentioned in this work in the three strainsa Geneb

ackA acoR acsA acuA alsD alsS bglS bpr cccA cggR citA citB citG citZ cstA ctaC dctP dltD dppA eno fbaA fbp gapA gapB glpF glpT gltA gntZ guaC icd lctP ldh lysC mdh mdr nagA odhB pckA pdhA pdhB pdhC pdhD pel pfk pgi pgk pgm phoP phrC phrE phrG pksE pta ptsG ptsH ptsI purA purQ pycA pykA

See table

3 2 2 2 3 3 2 2 2 1 3 2, 3 2, 2, 2 2 1 2 1, 3 3 1, 2, 2 2 1 3 1 3 3 3 1 3 1 2 3 2, 1, 3 3 3 2 3 3 3 1, 2 2 2 2 2 3 1, 1, 1, 1 1 3 3

3 3 3

3

3 3

3 3

3

3 3 3

GP303 Wild type

GP337 ccpA

GP336 ccpA ptsH1

+Glc

Glc

+Glc

Glc

+Glc

2.46 0.27 0.22 0.29 0.81 1.35 0.32 0.13 0.21 76.76 1.49 0.27 0.57 0.15 0.29 0.09 0.16 4.01 0.35 3.28 1.42 0.92 10.69 0.11 0.12 0.16 11.21 2.57 3.32 0.45 1.46 1.56 5.39 0.82 3.61 0.35 0.42 0.14 3.43 2.78 1.94 2.03 0.26 1.46 1.42 2.81 7.33 0.23 0.22 0.10 0.21 0.17 2.56 31.83 1.98 4.28 4.86 4.40 1.52 1.38

0.82 1.43 1.30 1.21 0.83 0.99 0.95 0.96 1.07 3.14 0.95 1.07 0.97 0.89 1.09 0.97 0.96 1.04 1.23 0.83 0.95 1.29 1.10 1.00 1.19 0.70 1.03 1.09 1.01 0.88 1.05 1.14 0.98 1.13 0.90 1.13 1.02 1.09 1.09 0.85 0.73 1.14 0.84 0.86 0.68 0.89 0.98 1.43 1.30 1.02 1.24 0.93 1.08 1.26 1.10 1.23 1.17 0.97 1.24 0.85

1.27 1.33 0.67 0.78 1.17 1.03 0.50 0.14 0.46 18.69 1.34 0.79 0.86 0.99 0.96 0.54 0.98 2.55 0.33 2.26 1.24 1.06 4.45 0.18 0.56 0.80 2.42 2.13 1.77 0.73 1.07 0.74 2.50 1.12 2.04 1.51 1.06 0.40 2.04 2.14 1.81 1.52 0.70 0.93 1.24 1.54 3.35 1.42 0.58 0.43 0.39 0.26 1.53 18.98 1.73 3.28 3.43 2.66 1.52 0.84

0.94 1.65 0.79 0.82 0.71 1.10 0.87 1.03 1.13 1.49 1.16 0.86 1.01 0.79 1.11 0.77 1.19 1.62 1.16 0.93 0.89 1.14 0.75 0.77 0.68 0.67 0.72 0.86 0.97 0.85 1.41 1.60 0.97 1.19 0.84 1.00 0.69 1.16 0.94 0.86 0.94 1.10 0.75 0.60 0.84 0.77 0.91 1.47 1.58 1.33 1.05 0.69 1.01 0.55 0.61 1.19 1.10 0.86 1.69 0.69

0.94 1.50 0.56 0.74 0.99 1.14 0.66 0.15 0.63 34.54 1.14 1.24 0.90 0.94 1.07 0.48 1.44 2.39 0.43 2.71 1.21 0.84 7.55 0.08 0.27 0.29 9.07 2.21 1.93 0.97 1.25 1.16 2.49 1.02 2.13 1.26 0.85 0.18 3.46 3.92 2.59 2.10 0.55 0.98 0.89 1.92 3.70 1.27 0.48 0.43 0.37 0.25 1.48 24.35 1.63 3.14 3.66 3.38 1.92 0.90

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

147

Table 4 (continued) Geneb

qcrA rapA rapF rbsR rpe sdhA sdhB sdhC spoIIAA sspG sucC sucD tkt tpi xkdQ ybcO ybxG yesM yfkN yfmG yhaR yitN ykbA ykuD ykzF ylbO ylbP ymaH yojL yonV yopL yozM ypiF yqxI ysiB yslB yttP yueE yusL yvaW yvcI yvmB yvnA yvqI ywjF ywjH ywlF ywoA yxbB yxiA yxjA yxjF yydG zwf

See table

2 2 2 2 3 3 3 3 2 2 3 3 3 3 1 2 1 2 2 2 2 2 1 2 2 2 2 2 2 1 2 2 2 2 2 1 2 1 2 2 2 2 2 2 2 2 3 1 2 2 1 2 2 3

GP303 Wild type

GP337 ccpA

GP336 ccpA ptsH1

+Glc

Glc

+Glc

Glc

+Glc

0.18 0.24 0.20 0.10 1.37 0.59 0.98 0.62 0.19 0.18 0.37 0.42 1.66 2.77 4.25 0.03 3.68 0.13 0.19 0.25 0.06 0.32 4.23 0.30 0.23 0.31 0.10 0.13 0.33 3.27 0.24 0.07 0.15 0.26 0.26 5.35 0.32 4.30 0.22 0.12 0.22 0.29 0.14 0.23 0.20 1.16 1.18 3.34 0.12 0.23 4.29 0.25 0.20 0.74

1.26 0.84 0.74 1.46 0.93 1.01 1.14 0.95 1.64 1.11 0.67 0.88 1.05 0.76 1.05 0.85 1.20 1.55 0.82 0.83 0.82 1.04 0.97 0.78 1.07 1.22 1.12 1.15 1.11 0.91 1.27 1.30 0.95 0.79 1.11 2.13 1.21 1.80 1.07 1.22 0.61 1.30 1.39 1.15 0.95 1.03 0.93 1.16 1.41 1.01 0.50 0.88 1.22 1.24

0.85 0.37 0.55 2.13 1.09 1.38 1.15 1.49 0.38 0.13 0.91 1.16 1.55 1.66 3.16 0.08 1.74 0.88 0.38 0.29 0.46 0.25 1.86 0.38 0.58 0.37 0.49 0.28 0.47 2.20 0.43 0.37 0.42 0.32 0.53 2.82 0.51 1.64 0.28 0.22 0.65 1.48 1.39 0.42 0.17 1.36 0.96 1.55 0.19 0.38 1.85 0.41 0.37 0.69

1.24 0.83 0.68 1.19 1.05 0.90 1.14 0.91 0.92 0.48 0.59 0.78 1.24 0.50 1.45 1.22 1.39 1.71 0.81 0.84 0.99 1.66 1.11 1.71 0.85 0.72 0.83 1.24 0.82 0.92 1.61 0.89 0.74 1.07 0.83 2.07 1.14 1.62 1.01 0.72 1.28 1.13 1.05 1.35 0.88 1.05 0.93 1.48 1.52 0.93 1.21 0.70 0.86 0.54

1.00 0.35 0.43 2.05 1.13 1.29 1.13 1.34 0.33 0.13 1.06 1.31 1.36 2.01 6.53 0.08 1.71 1.07 0.24 0.35 0.44 0.29 2.69 0.87 0.45 0.34 0.43 0.33 0.70 2.23 0.59 0.28 0.38 0.42 0.53 3.08 0.52 3.17 0.30 0.35 0.48 1.20 1.21 0.49 0.37 1.10 1.00 1.96 0.18 0.45 2.51 0.56 0.47 0.48

a To compare the relative regulation of the relevant genes, expression of each gene listed in this table in wild-type strain GP303 in CSE medium in the absence of glucose was set to 1. b The genes are listed in alphabetical order. Details on operon structures, functions, and cre sites can be found in the tables as indicated.

ARTICLE IN PRESS 148

H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149

References Ali, N.O., Bignon, J., Rapoport, G., De´barbouille´, M., 2001. Regulation of the acetoin catabolic pathway is controlled by sigma L in Bacillus subtilis. J. Bacteriol. 183, 2497–2504. Asai, K., Baik, S.H., Kasahara, Y., Moriya, S., Ogasawara, N., 2000. Regulation of the transport system for C4-dicarboxylic acids in Bacillus subtilis. Microbiology 146, 263–271. Belitsky, B.R., 2002. Biosynthesis of amino acids of the glutamate and aspartate families, alanine and polyamines. In: Sonenshein, A.L., Hoch, J.A., Losick, R. (Eds.), Bacillus subtilis and Its Closest Relatives: From Genes to Cells. American Society for Microbiology Press, Washington, DC, pp. 203–231. Cruz Ramos, H., Hoffmann, T., Marino, M., Nedjari, H., PresecanSiedel, E., Dreesen, O., Glaser, P., Jahn, D., 2000. Fermentative metabolism of Bacillus subtilis: physiology and regulation of gene expression. J. Bacteriol. 182, 3072–3080. Darbon, E., Servant, P., Poncet, S., Deutscher, J., 2002. Antitermination by GlpP, catabolite repression via CcpA and inducer exclusion triggered by PBGlpK dephosphorylation control Bacillus subtilis glpFK expression. Mol. Microbiol. 43, 1039–1052. Dauner, M., Storni, T., Sauer, U., 2001. Bacillus subtilis metabolism and energetics in carbon-limited and excess-carbon chemostat culture. J. Bacteriol. 183, 7308–7317. Du¨rre, P., Bo¨hringer, M., Nakotte, S., Schaffer, S., Thormann, K., Zickner, B., 2002. Transcriptional regulation of solventogenesis in Clostridium acetobutylicum. J. Mol. Microbiol. Biotechnol. 4, 295–300. Eymann, C., Homuth, G., Scharf, C., Hecker, M., 2002. Bacillus subtilis functional genomics: characterization of the stringent response by proteome and transcriptome analysis. J. Bacteriol. 184, 2500–2520. Faires, N., Tobisch, S., Bachem, S., Martin-Verstraete, I., Hecker, M., Stu¨lke, J., 1999. The catabolite control protein CcpA controls ammonium assimilation in Bacillus subtilis. J. Mol. Microbiol. Biotechnol. 1, 141–148. Fillinger, S., Boschi-Muller, S., Azza, S., Dervyn, E., Branlant, G., Aymerich, S., 2000. Two glyceraldehyde-3-phosphate dehydrogenases with opposite physiological roles in a nonphotosynthetic bacterium. J. Biol. Chem. 275, 14031–14037. Galinier, A., Haiech, J., Kilhoffer, M.-C., Jaquinod, M., Stu¨lke, J., Deutscher, J., Martin-Verstraete, I., 1997. The Bacillus subtilis crh gene encodes a HPr-like protein involved in catabolite repression. Proc. Natl. Acad. Sci. USA 94, 8439–8444. Galinier, A., Deutscher, J., Martin-Verstraete, I., 1999. Phosphorylation of either Crh or HPr mediates binding of CcpA to the Bacillus subtilis xyn cre and catabolite repression of the xyn operon. J. Mol. Biol. 286, 307–314. Gonzy-Tre´boul, G., de Waard, J.H., Zagorec, M., Postma, P.W., 1991. The glucose permease of the phosphotransferase system of Bacillus subtilis: evidence for IIGlc and IIIGlc domains. Mol. Microbiol. 5, 1241–1249. Grundy, F.J., Turinski, A.J., Henkin, T.M., 1994. Catabolite regulation of Bacillus subtilis acetate and acetoin utilization genes by CcpA. J. Bacteriol. 176, 4527–4533. Henkin, T.M., 1996. The role of the CcpA transcriptional regulator in carbon metabolism in Bacillus subtilis. FEMS Microbiol. Lett. 135, 9–15. Henkin, T.M., Grundy, F.J., Nicholson, W.L., Chambliss, G.H., 1991. Catabolite repression of a-amylase gene expression in Bacillus subtilis involves a trans-acting gene product homologous to the E coli lacI and galR repressors. Mol. Microbiol. 5, 575–584. Homuth, G., Masuda, S., Mogk, A., Kobayashi, Y., Schumann, W., 1997. The dnaK operon of Bacillus subtilis is heptacistronic. J. Bacteriol. 179, 1153–1164. Hulett, F.M., 2002. The Pho regulon. In: Sonenshein, A.L., Hoch, J.A., Losick, R. (Eds.), Bacillus subtilis and Its Closest Relatives:

From Genes to Cells. American Society for Microbiology Press, Washington, DC, pp. 193–201. Jourlin-Castelli, C., Mani, N., Nakano, M.M., Sonenshein, A.L., 2000. CcpC, a novel regulator of the LysR family required for glucose repression of the citB gene in Bacillus subtilis. J. Mol. Biol. 295, 865–878. Kru¨ger, S., Stu¨lke, J., Hecker, M., 1993. Carbon catabolite repression of b-glucanase synthesis in Bacillus subtilis. J. Gen. Microbiol. 139, 2047–2054. Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V., et al., 1997. The complete genome sequence of the Gram-positive bacterium Bacillus subtilis. Nature 390, 249–256. Langbein, I., Bachem, S., Stu¨lke, J., 1999. Specific interaction of the RNA-binding domain of the Bacillus subtilis transcriptional antiterminator GlcT with its RNA target, RAT. J. Mol. Biol. 293, 795–805. Liu, X., Taber, H.W., 1998. Catabolite regulation of the Bacillus subtilis ctaBCDEF gene cluster. J. Bacteriol. 180, 6154–6163. Ludwig, H., Homuth, G., Schmalisch, M., Dyka, F.M., Hecker, M., Stu¨lke, J., 2001. Transcription of glycolytic genes and operons in Bacillus subtilis: evidence for the presence of multiple levels of control of the gapA operon. Mol. Microbiol. 41, 409–422. Ludwig, H., Meinken, C., Matin, A., Stu¨lke, J., 2002a. Insufficient expression of the ilv-leu operon encoding enzymes of branched chain amino acid biosynthesis limits growth of a Bacillus subtilis ccpA mutant. J. Bacteriol. 184, 5174–5178. Ludwig, H., Rebhan, N., Blencke, H.-M., Merzbacher, M., Stu¨lke, J., 2002b. Control of the glycolytic gapA operon by the catabolite control protein A in Bacillus subtilis: a novel mechanism of CcpAmediated regulation. Mol. Microbiol. 45, 543–553. Meinken, C., Blencke, H.-M., Ludwig, H., Stu¨lke, J. (2003). Expression of the glycolytic gapA operon in Bacillus subtilis: differential syntheses of proteins encoded by the operon. Microbiology 149, 751–761. Miwa, Y., Nakata, A., Ogiwara, A., Yamamoto, M., Fujita, Y., 2000. Evaluation and characterization of catabolite-responsive elements (cre) of Bacillus subtilis. Nucl. Acids Res. 28, 1206–1210. Monedero, V., Boe¨l, G., Deutscher, J., 2001. Catabolite regulation of the cytochrome c550-encoding Bacillus subtilis cccA gene. J. Mol. Microbiol. Biotechnol. 3, 433–438. Moreno, M.S., Schneider, B.L., Maile, R.R., Weyler, W., Saier Jr., M.H., 2001. Catabolite repression mediated by CcpA protein in Bacillus subtilis: novel modes of regulation revealed by wholegenome analyses. Mol. Microbiol. 39, 1366–1381. Moszer, I., Glaser, P., Danchin, A., 1995. SubtiList: a relational database for the Bacillus subtilis genome. Microbiology 141, 261–268. Oh, M.-K., Rohlin, L., Kao, K.C., Liao, J.C., 2002. Global expression profiling of acetate-grown E. coli. J. Biol. Chem. 277, 13175–13183. Pfeiffer, T., Schuster, S., Bonhoeffer, S., 2001. Cooperation and competition in the evolution of ATP-producing pathways. Science 292, 504–507. Presecan-Siedel, E., Galinier, A., Longin, R., Deutscher, J., Danchin, A., Glaser, P., Martin-Verstraete, I., 1999. The catabolite regulation of the pta gene as part of carbon flow pathways in Bacillus subtilis. J. Bacteriol. 181, 6889–6897. Renna, M.C., Najimudin, N., Winik, L.R., Zahler, S.A., 1993. Regulation of the Bacillus subtilis alsS, alsD, and alsR genes involved in post-exponential-phase production of acetoin. J. Bacteriol. 175, 3863–3875. Rosenkrantz, M.S., Dingman, D.W., Sonenshein, A.L., 1985. Bacillus subtilis citB gene is regulated synergistically by glucose and glutamine. J. Bacteriol. 164, 155–164. Russell, J.B., Cook, G.M., 1995. Energetics of bacterial growth: balance of anabolic and catabolic reactions. Microbiol. Rev. 59, 48–62.

ARTICLE IN PRESS H.-M. Blencke et al. / Metabolic Engineering 5 (2003) 133–149 Schultz, J.E., Matin, A., 1991. Molecular and functional characterization of a carbon starvation gene of E. coli. J. Mol. Biol. 218, 129–140. Sonenshein, A.L., 1989. Metabolic regulation of sporulation and other stationary-phase phenomena. In: Smith, I., Slepecky, R.A., Setlow, P. (Eds.), Regulation of Prokaryotic Development. American Society for Microbiology, Washington, DC, pp. 109–130. Sonenshein, A.L., 2002. The Krebs citric acid cycle. In: Sonenshein, A.L., Hoch, J.A., Losick, R. (Eds.), Bacillus subtilis and Its Closest Relatives: From Genes to Cells. American Society for Microbiology Press, Washington, DC, pp. 151–162. Strauch, M.A., 1995. AbrB modulates expression and catabolite repression of a Bacillus subtilis ribose transport operon. J. Bacteriol. 177, 6727–6731. Stu¨lke, J., Hillen, W., 1999. Carbon catabolite repression in bacteria. Curr. Opin. Microbiol. 2, 195–201. Stu¨lke, J., Hillen, W., 2000. Regulation of carbon catabolism in Bacillus species. Annu. Rev. Microbiol. 54, 849–880. Stu¨lke, J., Martin-Verstraete, I., Zagorec, M., Rose, M., Klier, A., Rapoport, G., 1997. Induction of the Bacillus subtilis ptsGHI operon by glucose is controlled by a novel antiterminator, GlcT. Mol. Microbiol. 25, 65–78. Tobisch, S., Zu¨hlke, D., Bernhardt, J., Stu¨lke, J., Hecker, M., 1999. Role of CcpA in regulation of the central pathways of carbon catabolism in Bacillus subtilis. J. Bacteriol. 181, 6996–7004.

149

Turinsky, A.J., Grundy, F.J., Kim, J.H., Chambliss, G.H., Henkin, T.M., 1998. Transcriptional activation of the Bacillus subtilis ackA gene requires sequences upstream of the promoter. J. Bacteriol. 180, 5961–5967. Unden, G., 1998. Transcriptional regulation and energetics of alternative respiratory pathways in facultatively anaerobic bacteria. Biochim. Biophys. Acta 1365, 220–224. von Wachenfeldt, C., Hederstedt, L., 2002. Respiratory cytochromes, other heme proteins, and heme biosynthesis. In: Sonenshein A, .L., Hoch, J.A., Losick, R. (Eds.), Bacillus subtilis and Its Closest Relatives: From Genes to Cells. ASM Press, Washington, DC, pp. 163–179. Ye, R.W., Tao, W., Bedzyk, L., Young, T., Chen, M., Li, L., 2000. Global gene expression profiles of Bacillus subtilis grown under anaerobic conditions. J. Bacteriol. 182, 4458–4465. Yoshida, K.-I., Kobayashi, K., Miwa, Y., Kang, C.-M., Matsunaga, M., Yamaguchi, Y., Tojo, S., Yamamoto, M., Nishi, R., Ogasawara, N., Nakayama, T., Fujita, Y., 2001. Combined transcriptome and proteome analysis as a powerful approach to study genes under glucose repression in Bacillus subtilis. Nucl. Acids Res. 29, 6683–6692. Yu, J., Hederstedt, L., Piggot, P.J., 1995. The cytochrome bc complex (menaquinone: cytochrome c reductase) in Bacillus subtilis has a nontraditional subunit organization. J. Bacteriol. 177, 6751–6760.