Transcriptional regulation and promoter sequence of the spvR gene of virulence plasmid pKDSC50 in Salmonella choleraesuis serovar Choleraesuis

ELSEVIER

FEMS

Microbiology

Letters

129 (1995)

225-230

Transcriptional regulation and promoter sequence of the spvR gene of virulence plasmid pKDSC50 in Salmonella choleraesuis serovar Choleraesuis Akio Abe, Kazuyoshi Kawahara Department of Bacteriology, Received

*

The Kitasato Institute, 5-9-l Shirokane, Minato-ku, Tokyo 108, Japan

23 February

1995;

revised

18 April

1995;

accepted

18 April

1995

Abstract The transcript of the SPUR gene on the virulence plasmid, pKDSC.50, of Salmonellu choleraesuis serovar Choleraesuis detected for the first time by Northern blot analysis, and the transcriptional regulation of the spur gene was investigated. The transcription of the spvR was negatively regulated by sprlA and sp&, and enhanced at stationary phase under control of a sigma factor RpoS (0”). The spvR transcript was 2.4 kilonucleotides in Salmonella cells. and deduced to encode SpvR and SpvA. suggesting that SpvA but not SpvB is the functioning repressor in SPL’ operon. The promoter sequence analysis revealed that SPUR was transcribed from a single promoter and the 5’ end of the transcript was located at 18 bp upstream from the start codon of SPUR.Sequential similarity between the promoter of spvR and other (T“-controlled genes was not found, but the consensus sequence was found in - 10 to - 35 region of spcR and spcA, which may correlate to our previous data indicating that both genes were positively regulated by the SpvR protein. was

Keywords..

SPL’; rpoS;

Stationary phase;

Salmonella

choleraesuis

1. Introduction The non-typhoid Salmonella serovars contain large virulence plasmids that are required for systemic infection in humans and animals. These plasmids have a highly conserved 8-kb region containing the spvRABCD operon [ll. We have demonstrated that a 6.4-kb region containing the spvRABC genes on the virulence plasmid, pKDSC50 of Salmonella choleraesuis serovar Choleraesuis (S. Choleraesuis),

* Corresponding

author.

Tel.:

+81

(3) 3444 6161; Fax: +81

(03) 3444 6637 037%1097/9_5/$09.50 0 1995 Federation .SSDl 0378-1097(95)00162-X

of European

Microbiological

is essential for virulence in mice [2]. Furthermore, we have shown that the sp~!R gene product acts as the positive regulator for the downstream spt,ABC genes and for itself, and this unusual positive autoregulation is controlled by the negative feedback of the SpvA or SpvB gene proteins [3]. The SpvR protein belongs to the MetR/LysR family [4] and the amino-terminal region of SpvB shows homology with the CatM repressor of Acinetobacter calcoaceticus [3], which also belongs to the MetR/LysR family. The stationary phase sigma factor RpoS (axX) regulates a large number of genes in the stationary phase of bacterial growth and in stress conditions in Societies.

All rights reserved

Eschcrichiu co/i [~.6]. The rpoS gene was first identified as katF, a regulatory gene for HP11 catalase gene [7]. Sequence analysis showed that the rpoS product is a member of the (T”’ family, and sigma activity was detected in purified (r” in vitro [x]. (~ ix was also identified in Sulmonellu and was shown to contribute to Sulrnotzellu virulence [Y.IO]. We have previously reported, by using .sp~~K-lucZ fusion gene in E. coli, that the expression of .sprsR was dependent on (r-” [3]. However, to our knowledge, the spr%R transcript has never been detected in studies on Sulmonellu virulence plasmid, probably because of the low level of transcription. In the present study, we show the regulation of the .syr’K transcription, and promoter sequence of .spr,R, determined by the primer extension analysis.

g NaCI, I g NH,CI, 5 g Casamino acids (Difco Lab., Detroit, MI), 5 mg thiamine, 0.25 g MgSO, . 7H,O in I I) at 37” C with agitation. Ampicillin was added to the M9 medium at a final concentration of 60 pg ml ‘.

2. Materials and methods

_7..?.RNA munipulutions

2.1. Buctrriul strains und culture conditions

Preparation of total RNA, Northern blot and primer extension analysis were carried out as described previously [4]. Briefly, total RNA of Sulmonellu and E. coli was isolated by treatment with Proteinase K and DNase I. RNA samples (2.5 pug) were electrophoresed with denaturing formaldehyde gels and transferred to Nylon membranes (Duralon UV, Stratagene, La Jolla, CA). The spr$R anti-sense RNA probe was synthesized in vitro in the presence of [ w3’ P]UTP (Amersham, Buckinghamshire, UK) with SP6 RNA polymerase (Takara

7 7 P1u.smid.s ._...,. Genetic and physical maps of the recombinant plasmids used in this study are shown in Fig. I. Constructions of plasmid pMKD301 and pMKD.501 were described previously [ 121. Plasmid pMKD50 I 3 was derived from pMKD.501 by the elimination of a I .S-kb Sucl fragment and self-ligation. Plasmid pMBAI, containing 367 bp of the spl,R open reading frame (ORF), was used for preparation of an anti-sense RNA probe as described previously [4].

E. co/i DHlOB (BRL Co., Gaitherburg, MD), MC4100 [II], and MC8301 (rpoS::TnlOl, constructed by Pl transduction from UM122 to MC4100 [3], were used as host strains for plasmids. S. Choleraesuis RF- I, harboring virulence plasmid, pKDSC50, and the isogenic plasmid-cured strain, S. Choleraesuis 31N-1 [2] were used in this study. Bacteria were grown in complete MY medium without glucose supplementation (6.8 g Na,HPO,. 3 g KH, PO,. 0.5

I E

spvR

pMKD301

Sa

SPVA

1 kb

Sa

spvB

I E

spvc

.--

pMKD501 D .--Fig. 1. Genetic and physical maps of the .s,x region and the recombinant plasmids. The 6.4kb

Sull-ElcoRI

fragment of pKDSC50,

Sulmonelia Cholcraesuis virulence plasmid, is shown in the top line. The stippled boxes represent the .s,w ORF. The thin and broken lines represent the flanking region of the F~I‘ ORF and the vector plasmid pUCl 18, respectively. The thin and thick arrows indicate the direction of the transcription of each .s/w gene and the direction of /UC promoter, respectively. Restriction sites are E, EcoRI;

S. Ml;

Sa. &cl.

A. Abe, K. Kawahara / FEMS Microbiology Letters 129 (1995) 225-230

shuzo co., Kyoto, Japan) using plasmid pMBA1 as template and the incomplete short product was removed by spurn column (Nu-Clean DSO, Eastman Kodak Company, New Haven, CT). For determination of the 5’ end of the spvR transcript by primer extension analysis, degraded DNA in the total RNA fraction was removed by spurn column. An oligonucleotide complementary to the flanking region of the SPUR start codon (5’GATACTGAAGGAACCTGTITCCATCAGTGT-3’ ) was labelled at the 5’ end with [ y- 32P]ATP (Amershaml using T4 polynucleotide kinase. The 32P-labelled primer (1.7 pmol, 3 X 10” cpm) was hybridized with 50 pg of total RNA and cDNA was synthesized with AMV reverse transcriptase XL (Life Sciences Inc., St. Petersburg, FL). The length of extended cDNA was measured with a 6% sequencing gel.

3. Results

3.1. Transcriptional

regulation

of the SPUR gene

In our previous studies and those of another research group, four transcripts with different lengths encoding spuA, spvAB, spuABC and spvABCD were reported for the spv operon of Salmonella [4,13], whereas transcriptional unit of the spvR gene was not detected. In order to detect an spvR transcript, and to investigate the transcriptional regulation of the spvR gene, plasmid pMKD501 and pMKD5OlA were introduced into E. coli DHlOB and into a virulence plasmid-cured strain, S. Choleraesuis 3 lN1, and the resulting transformants were cultivated to stationary phase and subjected to Northern blot analysis. The 2.4-kilonucleotide (knt) transcript was detected in Salmonella, but not in the E. coli strain harboring pMKD501 (Fig. 2A, lanes 2, 5). In contrast, 1.3 knt and 2.8 knt transcripts were detected in E. coli and in Salmonella strains harboring pMKD501 A, respectively (Fig. 2A, lanes 3, 6). No specific signal was detected in the strains harboring only the vector plasmid, pUC118 (Fig. 2A, lanes 1, 4). The transcription of spvR was enhanced in both bacteria harboring pMKD501 A, in which spvA and spvB were deleted, indicating that the repression of

A

227

B 123456

1

&if f2.4

-16s 4-1.3

2

_i .. -235 f2.4

-16s

44.0

Fig. 2. Detection of spcR transcript by using multicopy plasmid (A) and natural virulence plasmid (B). (A) Total RNAs were isolated from E. coli DHlOB harboring pUC118 (lane l), pMKD501 (lane 2) and pMKD5OlA (lane 3), and Salmonella Choleraesuis 31N-1 harboring pUC118 (lane 41, pMKD501 (lane 5) and pMKD501 A (lane 6) at the stationary phase COD,,, = 1.5). (B) Total RNA s were isolated from Salmonella Choleraesuis RF-l grown to exponential (OD,,, value of 0.5; lane 1) and stationary COD,, value of 1.5; lane 2) phases. Northern blot analysis was carried out as described in Materials and methods. Arrows indicate the spy transcripts, the lengths of which were deduced from 16s (1541 nucleotides) and 23s (2904 nucleotides) rRNAs, appeared by overexposure.

spvR by the SpvA and SpvB proteins was exerted at the transcription level both in E. coli and Salmonella. In the next experiment, we tried to detect the spvR transcript in S. Choleraesuis RF-l, harboring a natural virulence plasmid. Total RNA was prepared from an exponential or stationary phase culture of Salmonella Choleraesuis RF-l, and Northern blot analysis was carried out. The 2.4-knt transcript was detected specifically in the stationary phase, while the same band in the exponential phase was undetectable (Fig. 2B1, suggesting that expression of SPUR was controlled by u3*. From the length of each transcript and from the results of the following primer extension analysis (Fig. 31, the 2.4-knt transcript was deduced to encode SpvR and SpvA, whereas the 1.3-knt transcript SpvR only. Since a loop and stem structure was found between the spvR and spvA ORFs (data not shown), the putative transcription termination site

228

downstream from the start codon of spr,R. The extended signal was observed in MC4100, having the wild-type allele of rpoS, but the signal was not detected in the rpoS mutant strain, MC8301 (Fig. 3, lanes 1, 2), indicating that the .~pllR expression depends on 03’ at the transcriptional level. From the length of the extended signal, the transcription of the .spl,R gene was proved to initiate from 18 bp upstream from the start codon of .yx>R, and used a single promoter. Furthermore, when plasmid pMKD501, containing the sp~&4BC genes, was introduced into MC4100, the signal was much weaker than that of MC4100 carrying pMKD301 (Fig. 3, lane 3), suggesting that the negative regulation by SpvA and SpvB was exerted at the transcriptional level in the sprs operon.

3’ 5’ AT AT / AT GC TA CG CG TA AT AT TA AT AT GC AT CG T Ad= T A$ TA TA TA \ TA 5’ 3’

CTAG123

/

\

Fig. 3. Detection trf 5’ end of the .q K transcript. Total

4. Discussion

KNAs

were isolated from E. cob at stationary phase COD,>,,,,= 1.5) and primer extension analysis ws als and methods. Lanes: pMKD301;

I.

carried out as described in Materi-

t:. coti

2. E. coli MCH301 (I~xS

E. co/~ MC4100

(rpo.S’

MC4100

(r[wS

) harboring

) harboring pMKDSUl.

’)

harboring

pMKD.IOI:

3,

The extension

products were run in parallel with sequence ladders (loaded in the order

CTAG)

pMKD301

that

wcrc

generated using

as a template. The

asterisks

same primer

and

indicate transcription

initiation site of the .sp~,R gene.

was suggested to function Salmonella cells. 3.2. Determination transcription

in E. coli,

In this study, the transcript of the .spl,R gene was for the first time. The length of the transcript was 1.3 knt in E. coli and 2.4 knt in S. Choleraesuis, but some other bands were also detected by Northern blot analysis. The 2.8-knt band was detected in the Salmonella strain harboring pMKD5OlA. This transcript was thought to be a read-through product of the .spcR transcript, because the putative transcription terminator located between .spr,A and sp~,B ORF was eliminated by the deletion of a Sac1 fragment, and we found another stem and loop structure in 45 bp downstream from the termination codon of .spllB ORF (unpublished data). This result and that of a control experiment using a strain harboring only a vector plasmid pUCll8 (Fig. 2A, lane 4) strongly suggest that the 2.4-knt bands detected in Fig. 2A, lane 5 and Fig. 2B, lane 2 were originated from natural spl)R transcript. In Fig. 2A, lanes 3 and 6, 0.8 knt bands were detected both in Sdmonella and E. co/i strain harboring pMKD50 1d. As the transcripts produced from pMKD501 A do not have a normal transcription terminator, these bands might be degradation products of unstable readthrough transcripts. Since SpvR and SpvA were deduced to be encoded together in the 2.4-knt transcript, expression of spc,R could usually be repressed by the SpvA protein. Therefore, SpvA was assumed to be emdetected

but not in

of the initiation site of the spl!R

Plasmid pMKD301, containing sp~,R, was introduced into an rpoS-defective strain, E. coli MC8301 (rpoS::TnlO), and an isogenic parent strain, E. coli MC4100 (rpoS+ 1. Total RNA was prepared from each strain in stationary phase and the 5’ end of the spz!R transcript was determined by primer extension using a primer corresponding from 40 to 69 nt

A. Abe, K. Kawahara / FEMS Microbiology

Letters 129 (1995) 225-230

-35

229

-10

spvR

CGCCATCCTGTTTTTGCACAT~CATTTTTT

apvA

-10 GCACAmAATAAACTCAATAT:a*(;CCACTCA

fit

-10 -35 CACTTCTGCTCTCCCGGCGTAACCCGGATTTGCCGCTTATACTTGTGGCAAAT

pox3

-10 TTCTCTCCCATCCCTTCCCCCTCCGTCAGATGAACTAAACTTGTTACCgTTAT

CAGGATTATTCTGnaAAAA

-10

TTlTCTGGCZbATACMaaTAAT

Fig. 4. Comparison of the promoter region of spur with that of other genes. The - 10 and the - 35 regions are given as underlined letters. The bold-lowercase and bold-uppercase letters indicate transcription initiation sites and the consensus sequence between the promoter regions of .xprR and sp[sA, respectively. The asterisks on bold-lowercase letters represent a minor transcription initiation site of the sp[,A promoter. The nucleotide sequence of the spvR gene and the .?puA promoter sequence were taken from previous paper [4]. The fit and pad promoter sequences were from [14] and [15], respectively.

ployed in the negative feedback mechanism of SPUR expression, while another repressor protein SpvB could function as a repressor for other genes encoded in chromosome. Recently, Tanaka et al. [8] showed that E. co/i promoters were classified into three types, type I (recognized by u70 and (Tag), type II (recognized mainly by a’(‘), and type III (recognized only by cr 3Rl. The promoters of fit gene, a regulatory gene for cell division, and of pod gene, the pyruvate oxidase gene, were recently reported as being type III promoters [14,15]. In this study, the sp~$R promoter was also identified as type III promoter. However, the promoter region of spcR had no striking similarity with those of fit and pod (Fig. 4). On the other hand, when we compared the promoter region of spuR and spvA, we could find the consensus sequence, CATTTT (C or Tl T, between the - 10 and the - 35 region (Fig. 4). Since both genes were positively regulated by the SpvR protein, this sequence might be a recognition site of SpvR protein. As far as we know, this is the first report describing the positive and negative regulators for the type III promoter, whose DNA sequence was different from other type III promoters. Although we had tried a primer extension analysis using Salmonella strains, we could not detect the extended signal, probably due to low amount of the SPUR transcript in Salmonella cells. Accordingly, the transcriptional initiation site was proved by using multi-copy plasmid pMKD301 in E. coli. However, we think that the extended signal obtained in E. coli

was not an artificial one, because the transcription initiation site of spuA determined by using multi-copy plasmid in E. coli in our previous study [4] completely agreed with that determined with the native virulence plasmid in Salmonella [10,13]. Recently, SpvB was reported to be a main virulence protein among proteins encoded in spy’ region [16], and Northern blot analysis in the present paper (Fig. 2) suggests that SpvB might not be involved in the regulation of SPUR expression. In our recent study, we could show that the SpvB protein regulates at least six chromosomal genes in the stationary phase (unpublished data). These data also suggest that SpvB protein might not be the repressor for spy’ operon, but be that for chromosomal genes, which should be regulated in stationary phase, or under stress conditions.

Acknowledgements Part of this work was supported by Grants-in-Aid for Encouragement of Young Scientists (to A.A., No. 06770214) by the Ministry of Education, Science, and Culture of Japan and Grant for All Kitasato Project Study by Kitasato University.

References [l] Gulig, P.A., Danbara, H., Guiney, D.G., Lax, A.J., Norel, F. and Rhen, M. (1993) Molecular analysis of spt virulence

230

A. Abe, K. Kawuhuru / FEMS Microbiology Letters 129 (1995) 225-230

genes of the Sulmonellu virulence plasmids. Mol. Microbial. 7, 825-830. [2] KaWaham, K., Hardguchi, Y., Tsuchimoto, M., Tcrakado. N. and Danbara, H. (1988) Evidence of correlation between the SO-kilobase plasmid of Salmonella choleraesuis and its virulence. Microb. Pathog. 4. 155-163. [3] Abe, A., Matsui. H.. Danbara, H., Tanaka. K., ‘Takahashi, H. and Kawahara. K. (1994) Regulation of .spr’R gene cxpression of Sulmonellu virulence plasmid pKDSC50 in Salmonrllu choleraesui.\ SC~OVUCholeraesuis. Mol. Microbiol. 12, 7799787. [4] Matsui, H., Ahc. A.. Suzuki, S., Kijima, M.. Tamura. Y., Nakamura, M.. Kawahara, K. and Danbara, H. (1993) Molecular mechanism of the regulation of expression of plasmid-encoded mouse bacteremia (m/m) genes in Salmonella serovar Choteraesuis. Mol. Gen. &net. 236. 219-226. [Sl Siegclc, D.A. and Kolter. R. (IYY?) Lift after log. J. Bactcriol. 174, 345-348. [61 Hengge-Aronis, R. (1903) Survival of hunger and stress: the role of rpoS in early stationary phase gene regulation in E. coli. Cell 72, 165-168. 171 Loewen, P.C. and Briggs, B.L. (1984) Genetic mapping of kutF. a locus that with katE affects the synthesis of a second species in Escherichia coli. J. Bacterial. 160, 668-675. Y.. Fujita, N., Ishihama, A. and [81 Tanaka, K., Takayanagi, Takahashi, H. (1993) Heterogeneity of the principal sigma factor in Escherichia coli: the rpoS gene product, 03k, is a second principal sigma factor of RNA polymerase in stationary phase Escherichia coli. Proc. Natl. Acad. Sci. USA 90. 351 l-3515. [91 Fang. F.C., Libby, S.J., Buchmeier, N.A.. Loewen. P.C..

Switala, J., Harwood, J. and Guiney, D.G. (lY92) The altcrnative sigma factor k&F (rpoS) regulates Salmonellu virulencc. Proc. Nat]. Acad. Sci. USA 89, 1197X-I 1982. [IO] Kowarz, L., Coynault, C., Robbe-Saule, V. and Norcl. F. (1994) The Salmonella typhimurium k&F (rpoS) gene: cloning, nucleotide sequence. and regulation of .spr,R and .\pr,ABCD virulence plasmid genes. J. Bacterial. 176, 68.526X60. [I II Silhavy, T.J., Berman, M.L. and Enquist. L.W. (1984) Expcrimental With Gent Fusion. Cold Spring Harbor Laboratory. Cold Spring Harbor, NY. [I21 Matsui, H., Abe, A.. Kdwahara, K., Terakado, N. and Danhara, H. (199 1) Positive regulator for the expression of Mha protein of the virulence plasmid, pKDSC50, of Salmonella choleraesuis. Microb. Pathog. 10. 459-464. [131 Krause, M., Fang, F.C. and Guiney, D.G. (1992) Regulation of plasmid virulence gene expression in Salmonella dublin involves an unusual operon structure. J. Bactcriol. 174, 4482-448’). S.. Nakayama, T., Tanaka, K., [I41 Utsumi, R., Kusafuka, Takayanagi, Y., Takahashi, H., Noda, M. and Kawamukai, M. (1993) Stationary phase-specific expression of the fit gene in Escherichia coli K- I2 is controlled by the rpoS gene product ( rr” J. FEMS Microbial. Lett. 113, 273-278. [I51 Chang, Y.Y.. Wang, A.Y. and Cronan, J. Jr. (1994) Exprcssion of Escherichia coli pyruvate oxidase (PoxB) depends on the sigma factor encoded by the rpoS(katF) gene. Mol. Microbial. I I. 1019-1028. [I61 Roudier, C., Fierer, J. and Guiney, D.G. (1992) Characterizdtion of translation termination mutations in the spv operon of the Salmonella virulence plasmid pSDL2. J. Bacterial. 174, 6418-6423.