Trichuris suis: A Secretory Serine Protease Inhibitor

Experimental Parasitology 94, 1–7 (2000) doi:10.1006/expr.1999.4466, available online at http://www.idealibrary.com on

Trichuris suis: A Secretory Serine Protease Inhibitor

Marcia L. Rhoads, Raymond H. Fetterer, and Dolores E. Hill Parasite Biology and Epidemiology Laboratory, Livestock and Poultry Sciences Institute, USDA, ARS, BARC, Beltsville, Maryland 20705, U.S.A.

Rhoads, M. L., Fetterer, R. H., and Hill, D. E. 2000. Trichuris suis: A secretory serine protease inhibitor. Experimental Parasitology 94, 1–7. A trypsin inhibitor was identified in extracts of adult Trichuris suis and culture fluids from 24-h in vitro cultivation of adult parasites. The inhibitor was isolated by acid precipitation, affinity chromatography (trypsin–agarose), and reverse phase HPLC as a single polypeptide with a molecular weight estimated at 6.6 kDa by laser desorption mass spectrometry. The purified inhibitor associated strongly with trypsin (equilibrium dissociation inhibitory constant (Ki) of 3.07 nM) and chymotrypsin (Ki 5 24.5 nM) and was termed TsTCI. Elastase, thrombin, and factor Xa were not inhibited. The cDNA-derived amino acid sequence of the mature TsTCI consisted of 61 residues including 8 cysteine residues with a molecular mass of 6.687 kDa. The N-terminal region of TsTCI (46 residues) showed limited homology (36%) to a protease inhibitor from the hemolymph of the honeybee Apis mellifera, which is considered to be a member of the Ascaris inhibitor family. However, TsTCI did not display sequence homology with other members of this family or the distinctive cysteine residue pattern which distinguishes this family. However, similarity of a region of TsTCI (11 residues) with the reactive site regions of inhibitors from the nematodes Ascaris suum, Anisakis simplex, and Ancylostoma caninum was apparent. Index Descriptors and Abbreviations: trypsin (EC3.4.21.4) inhibitor; chymotrypsin (3.4.21.1) inhibitor; nematode; in vitro cultivation; excretory/secretory products; Apis mellifera; honeybee; TsTCI, Trichuris suis trypsin/chymotrypsin inhibitor; AmCI, Apis mellifera cathepsinG/ chymotrypsin inhibitor; ATI, Ascaris suum trypsin inhibitor; C/E-1, A. suum chymotrypsin/elastase inhibitor; AX-SPI-1,2,3, Anisakis simplex elastase isoinhibitors; AcAP, Ancylostoma caninum anticoagulant protein; pNA, paranitroanilide; TCA, trichloroacetic acid; HBSS, Hank’s balanced salt solution; PBS, phosphate-buffered saline; BSA, bovine serum albumin; TFA, trifluoroacetic acid; DTT, dithiothreitol.

the mucosal lining of the large intestines by burrowing through the epithelium; as adults, the posterior portion is extended into the intestinal lumen. Clinical trichuriasis is characterized by dehydration, anorexia, diarrhea, and anemia (Batte et al. 1977). It appears that intestinal microbial flora act synergistically with T. suis to produce severe mucohemorrhagic enteritis (Rutter and Beer 1975), and this may be linked to worm-induced suppression of mucosal immunity (Mansfield and Urban 1996). There is currently extensive interest in parasite proteases involved in reactions critical for parasite survival such as host tissue penetration and migration, feeding, molting and ecdysis, and defense mechanisms. A metalloprotease and a cysteine protease have been identified in T. suis adult parasites (Hill et al. 1993; Hill and Sakanari 1997). The 45-kDa metalloprotease was localized to the stichosome, a secretory organ, and was implicated in the breakdown of host tissue during the burrowing activity of adult worms (Hill et al. 1993). The cathepsin B-like cysteine protease was localized to the intestines and may function as a digestive enzyme (Hill and Sakanari 1997). In contrast to proteases, there is comparatively little current research into parasite inhibitors of proteases. Yet, inhibitors may be critical regulators of endogenous proteases or of host physiological and immunological effector mechanisms. Proteases play important roles in various host plasma protein cascades (i.e., coagulation, complement) and in the activation–secretion processes of host immune cells. In particular, mast cells, a major component in the host response to gastrointestinal parasites (Urban et al. 1998), release tryptases (trypsin-like serine proteases) and chymases (chymotrypsinlike serine proteases). In addition, neutrophils and macrophages release cathepsin G (Carney et al. 1998), a protease with both trypsin- and chymotrypsin-like specificities (Polanowska et al. 1998). These proteases mediate a variety of

INTRODUCTION The swine whipworm, Trichuris suis, inhabits the cecum and colon of infected pigs (Beer 1973). The parasites disrupt

0014-4894/00

1

2 immune effector mechanisms and are central modulators of inflammation (Travis 1988; Walls et al. 1993). Regulation of host immune cell processes by parasite protease inhibitors may represent critical mechanisms for parasite survival. In the present study, inhibitor activity against the serine protease trypsin was identified in extracts and in culture fluids following in vitro cultivation of adult T. suis. A lowmolecular-weight (6.6 kDa) trypsin/chymotrypsin inhibitor (TsTCI) was purified by acid precipitation, affinity chromatography, and reverse phase HPLC. The cDNA coding sequence of TsTCI showed limited homology to a protease inhibitor from the honeybee Apis mellifera (Bania et al. 1999). The secretory trypsin/chymotrypsin inhibitor might function by down-regulating immune cell effector mechanisms; this may be associated with T. suis-induced suppression of mucosal immunity to intestinal tract resident bacteria, apparently an important factor in the more severe clinical aspects of T. suis infections.

MATERIALS AND METHODS

Parasites. Adult male and female Trichuris suis were obtained from pigs either experimentally infected by oral inoculation with 10,000 embryonated eggs or naturally infected by grazing on egg-contaminated dirt lots. Parasites were recovered from the mucosal surface of the cecum and colon with forceps and rinsed consecutively with sterile 0.85% NaCl, Hank’s balanced salt solution (HBSS), and RPMI 1640 medium containing 500 units ml21 penicillin, 0.5 mg ml21 streptomycin, 1.25 mg ml21 fungizone, and 350 mg ml21 chloramphenicol. Worms were washed free of antibiotics with HBSS and either homogenized or cultured in vitro. For extraction, worms were placed in ice-cold phosphate-buffered saline (PBS) and homogenized on ice using a Polytron tissue homogenizer (Brinkman, Westbury, NY). The homogenate was centrifuged at 12,000 g for 15 min and the supernatant was collected and stored frozen. For in vitro cultivation, worms were placed in 85 3 25 mm Petri dishes with RPMI 1640 plus antibiotics and 1% glucose (4 worms/ml) and maintained at 378C in a humidified incubator under 5% CO2/95% air. Culture fluids were collected after 24-h incubation, centrifuged (500 g for 10 min), concentrated (10-kDa cutoff membrane, Amicon), sterile filtered (0.2 mm), and frozen. Protein concentrations of the homogenates and culture fluids were estimated by the spectrophotometric nucleic acid/protein analysis program (Warburg–Christian) provided with the Beckman 640 spectrophotometer. Inhibitor assays. Trypsin inhibitor activity was assayed in 96well plates by the inhibition of hydrolysis of the synthetic peptideparanitroanilide (pNA) substrate N-benzoyl-L-isoleucyl-L-glutamyglycyl-L-arginine-pNA (Chromogenix S-2222, Diapharma, West Chester, OH). The assay consisted of 2.0 nM trypsin (bovine pancreas, TPCKtreated, Sigma), 50 mM Tris/HCl buffer, pH 7.5, containing 0.15 M NaCl and 0.1% bovine serum albumin (BSA) and a 10-ml aliquot of T. suis samples (extract, culture fluids, column fractions, or purified peptide). Following a 30-min incubation, substrate (0.25 mM) was

RHOADS, FETTERER, AND HILL

added and the residual activity (mOD/min) was determined at 405 nm on a Vmax microplate kinetic reader (Molecular Devices). The total volume of the assay was 200 ml. Inhibitor activity was assayed similarly with chymotrypsin (TLCK-treated, Sigma) using 3-carbomethoxypropionyl-L-arginyl-L-prolyl-L-tyrosine-pNA (Chromogenix S-2586, Diapharma), elastase (bovine pancreas, Calbiochem, La Jolla, CA) using Boc-alanyl-alanyl-prolyl-alanine-pNA (Calbiochem), thrombin (bovine plasma, Sigma) using H-D-phenylalanyl-L-pipecolyl-L-argininepNA (Chromogenix S-2238, Diapharma), and factor Xa (bovine plasma, 0.5 nM, Diapharma) using N-a-benzyloxycarbonyl-D-arginylL-glycyl-L-arginine-pNA (Chromogenix S-2765, Diapharma). One inhibitor unit is defined as the quantity (mg) of protein in T. suis homogenates and culture fluids that reduces the rate of hydrolysis by 2.0 nM concentration of each protease of their respective substrates by 50%. Inhibitor units were determined by plotting the ratio of the inhibited velocity (Vi) to the uninhibited velocity (Vo) against the protein concentration of the T. suis homogenate or culture fluids; the data were then fitted to a third-order polynomial equation.

Purification Protocol Trichloroacetic acid (TCA) precipitation. Fifty percent (w/v) TCA was added slowly to the T. suis soluble extract while stirring to a final concentration of 2.5%. This solution was left at room temperature for 30 min and then centrifuged at 17,300 g for 10 min. The supernatant was dialyzed extensively with multiple changes of 50 mM Tris buffer, pH 7.6. Trypsin–agarose affinity chromatography. Trypsin (bovine pancreas) attached to cross-linked beaded agarose (Sigma, 50–100 units/ ml packed gel) was equilibrated with 50 mM Tris buffer, pH 7.6, containing 0.3 M NaCl and 10 mM CaCl2 and poured into a column. The dialyzed TCA-soluble fraction (routinely 15–20 mg) was loaded onto the column. The flow was stopped and the sample allowed to incubate with the trypsin–agarose for approximately 10 min. The column was then eluted with equilibration buffer; fractions were monitored at 280 nm. When the absorbance returned to baseline bound proteins were eluted with 0.01 M HCl; 0.5 ml fractions were collected and assayed for trypsin inhibitor activity. Active fractions were combined and lyophilized. Reverse phase HPLC. The lyophilized sample from the affinity column was resuspended in 0.1% trifluoroacetic acid (TFA) and separated on a Jupiter C-18, 5 mm, 250 3 4.6 mm steel column. The mobile phases consisted of A (0.1% aqueous TFA) and B (0.13% TFA in 70% aqueous acetonitrile). The sample was applied and eluted at a flow rate of 1 ml/min with 85% A for 5 min, followed by a linear gradient from 85% A to 100% B in 30 min; eluent was monitored at 214 nm. Fractions were assayed for trypsin inhibitor activity, pooled, and rotary evaporated. The resulting sample was reconstituted in water, the peptide concentration estimated by absorbance at 205 nm (Stoschek, 1990), and the specificity of the inhibitor determined with chymotrypsin, elastase, thrombin, and factor Xa. The purified inhibitor was termed TsTCI. Apparent dissociation constants. The apparent equilibrium dissociation inhibitory constant (Ki) was determined for TsTCI against trypsin and chymotrypsin. Using the described assay, ratios of inhibited velocity (Vi) to the uninhibited velocity (Vo) were plotted against the concentration of TsTCI as determined by quantitative amino acid analysis. Data were fitted to an equation for tight-binding inhibitors (Bieth 1974) and the Ki’s were determined.

3

In Vitro RELEASED TRYPSIN AND CHYMOTRYPSIN INHIBITOR

Laser desorption mass spectrometry (LDMS). The molecular mass of TsTCI was determined by matrix-assisted laser desorption mass spectrometry. The peptide was mixed with saturated a-cyano-4-hydroxycinnamic acid matrix solution and pulsed with a nitrogen laser (337 nm) at 20,000 V. NH2-terminal and internal amino acid sequence analysis. Following Edman degradation, the N-terminal sequence of TsTCI was determined on an Applied Biosystems Procise liquid-pulse protein sequenator. Internal sequences were determined by subjecting TsTCI to Lys C endoproteinase digestion (2 to 4 pmol Lys C, 100 mM Tris, pH 8.8, 2 M urea, 2.2 mM DTT, and 5 mM iodoacetamide) at 378C for 24 h. Digested peptides were fractionated by HPLC and selected peaks subjected to amino acid sequencing as described above. Peaks chosen for sequencing were also analyzed by LDMS to confirm mass estimations. Isolation of mRNA and cDNA cloning. Total RNA was extracted from adult T. suis by the method of Zarlenga and Gamble (1987). Firststrand cDNA was generated by RT-PCR using 20 mg of total RNA and 50 mM oligo(dT)16 primer as previously described (Lu et al. 1998). The original primer sequences, designed from the amino acid sequence data obtained as described above, were degenerate with inosine used as the third base in each codon. Amplification of inhibitor-specific cDNA by PCR was accomplished using the first-strand cDNA as a template and the specific oligonucleotide primers based upon the exact sequence of the molecule. Each primer (Table I) contained a HindIII or EcoR1 restriction site at the 58 end to allow subcloning in a known orientation for double-stranded DNA sequencing. Three additional bases (ACA) or a GCCG clamp were added to insure polymerization through the restriction sites. The 58 end of the inhibitor cDNA was amplified using the modified conserved nematode 22-bp splice leader (SL-1) as the sense primer (Blaxter et al. 1994) and antisense primer based on the peptide sequence VCTRQC. The 38 end of the cDNA was confirmed using oligonucleotides based on the peptide sequence EFQRRG as the sense primer and oligo(dT)16 as the antisense primer. The PCR reaction mixture contained 200 pM of each primer, 5 units of AmpliTaq DNA polymerase, and 200 mM dNTP (Gene Amp Kit, Perkin–Elmer, Branchburg, NJ). The reaction mixture was heated to 948C for 5 min, followed by 40 cycles of 948C for 30 s, 638C for 1 min, and 728C for 45 s. The PCR products were separated on 1.5% agarose gels (FMC Bioproducts, Rockland, ME), isolated using glass milk (USBioclean MP Kit, USB, Cleveland, OH), cloned into the pBluescript plasmid vector (Stratagene), and sequenced by the dideoxy chain-terminator method (T7 Sequenase v.2.0 Kit, Cleveland, OH).

The full-length cDNA sequence was obtained by PCR using the modified SL-1 sequence as the sense primer and antisense primer derived from sequence information determined above from the region near the poly-A tail; PCR reaction conditions, cloning, and sequencing were as described.

RESULTS

The amidolytic activity of trypsin was inhibited by both T. suis soluble extract and culture fluids in a concentrationdependent manner (Fig. 1). The extract contained 0.73 units and the culture fluids 0.17 units of trypsin inhibitor activity (a unit is defined as micrograms of T. suis protein required to inhibit trypsin activity by 50%), indicating an enrichment of the inhibitor in culture fluids. A preincubation (approximately 10 min) of the inhibitor with trypsin was required for maximal inhibition. Following TCA precipitation of the T. suis soluble extract, trypsin inhibitor activity remained in solution. Trypsin inhibitor activity in the TCA-soluble fraction bound to the trypsin–agarose column (little or no activity was present in the flow thru fraction) and was eluted with 0.01 M HCl. Reverse

TABLE I Oligonucleotide Primers used in RT-PCR for Amplification of cDNA Containing Trichuris suis Serine Protease Inhibitor TsTCI 58 Sense primers Modified 58 SL-1: GCCGGAATTCGGTTTAATTACCCAAGTTGGAG EFQRRG: ACAGAATTCGAGTTCCAGCGTCGT 38 Antisense primers Oligo (dT): GCCGAAGCTT-Oligo (dT)16 VCTRQC: ACAAAGCTTTTGGCGCGTACAA Note. EcoR1 and HindIII restriction sites are underlined.

FIG. 1. Concentration-dependent inhibition of trypsin by Trichuris suis soluble extract and culture fluids. The relationship of the ratio of inhibited enzyme velocity (Vi) to uninhibited velocity (Vo) and micrograms of protein of T. suis extract (solid squares) and culture fluids (solid circles) is shown. The data were fitted to a polynomial equation and the mg of T. suis extract and culture fluids at 50% enzyme inhibition were determined; inhibitor units are shown in the inset.

4 phase HPLC of the trypsin agarose-bound fraction indicated one major protein component (elution time approximately 20 min) (Fig. 2); this protein peak coincided with the peak of trypsin inhibitor activity. Analysis of this fraction by LDMS indicated one protein component with a molecular mass estimated at 6.59 kDa. The T. suis purified peptide inhibited trypsin with a Ki estimated at 3.07 nM as well as chymotrypsin with an estimated Ki of 24.5 nM. The peptide (TsTCI) did not inhibit elastase, thrombin, or factor Xa. A 19-residue amino-terminal sequence (NH2-EQQCGPDEEFQRRGSAYPL) and a 13-residue internal sequence (VCTRQCVPGCVCK) of TsTCI were obtained by automated Edman degradation analysis. Oligonucleotide probes designed from these sequences were used for PCR cloning of TsTCI cDNA (Table I). The complete cDNA coding sequence of TsTCI (GenBank Accession No. AF176643) is shown in Fig. 3. The TsTCI sequence consisted of 360 bp and contained a single translational open-reading frame extending from the initiator methionine (positions 70–72) to a stop codon, TGA, at positions 298–300. The openreading frame encoded 76 amino acids and a 58 untranslated region of 69 nucleotides which included the modified SL1 sequence at the 58 terminal end. The initiator codon was flanked by sequences conforming to the Kozak translation initiation prediction (Kozak 1986). The 58 end contained a putative signal sequence of 15 amino acid residues which was adjacent to a potential signal sequence cleavage site (denoted by the forward slash) (Von Heijne 1986) between

RHOADS, FETTERER, AND HILL

amino acid residues 21 and 11, which gave an aminoterminal glutamic acid (consistent with the N-terminal amino acid obtained by Edman degradation) and a mature polypeptide containing 61 amino acids. The calculated molecular weight of the mature polypeptide was 6.7 kDa. The cDNAderived amino acid sequence was screened against all nonredundant protein sequence databases maintained by the National Center for Biotechnology Information using Gapped BLAST 2.0; limited homology (36%) was detected within the 46-residue N-terminal region with a protease inhibitor from the honeybee Apis mellifera (SWISS-PROT locus 4699856) (Bania et al. 1999). No significant homology to previously sequenced protease inhibitors of nematodes or to any other inhibitor family was found. However, the amino acid sequence CTRQCVPGCVC (residues 36–46) exhibited similarity to reported sequences of serine protease inhibitors from Ascaris suum, Anisakis simplex, and Ancylostoma caninum (Stanssens et al. 1996; Lu et al. 1998) (Fig. 4). Significantly, these sequences contain the region that interacts with the catalytic site of the inhibited enzymes. By analogy to the reported reactive sites of the A. mellifera inhibitor AmCI (sequence CTMQC) and the A. suum inhibitor ATI (sequence CTREC), the sequence CTRQC of the T. suis inhibitor is suggested as the reactive site (Fig. 4) with arginine the suggested P1 reactive site residue and glutamine as the suggested P81 reactive site residue.

DISCUSSION

FIG. 2. Elution profile of trypsin–agarose affinity column-bound fraction of Trichuris suis extract separated by reverse phase HPLC (Jupiter C-18).

The trypsin/chymotrypsin inhibitor TsTCI isolated from the adult stage of the intestinal nematode T. suis displayed limited homology with a cathepsin G/chymotrypsin inhibitor (AmCI) isolated from the hemolymph of the honeybee A. mellifera (Bania et al. 1999). Based on a 44% sequence identity and similarities in the alignment of the 10 cysteine residues and in the position of the reactive site between AmCI and the trypsin inhibitor ATI from A. suum, AmCI was considered to be a member of the Ascaris inhibitor family. In contrast, TsTCI contained only eight cysteine residues and no sequence homology was apparent with the A. suum inhibitors. However, TsTCI does display an amino acid sequence similar to that present in AmCI as well as in serine protease inhibitors from the nematodes A. suum (Peanasky et al. 1987), A. simplex (Lu et al. 1998), and A. caninum (Stanssens et al. 1996). These 11 to 14 amino acid sequences contain four cysteine residues encompassing the inhibitory reactive site, with cysteine residues present at the

In Vitro RELEASED TRYPSIN AND CHYMOTRYPSIN INHIBITOR

5

FIG. 3. Nucleotide sequence and deduced amino acid sequence of TsTCI precursor. The single asterisk denotes the putative initiator methionine codon (Kozak, 1988); the double asterisk denotes the stop codon. The start of the mature protein (end of the signal peptide) is marked by a forward slash. Underlined sequences are sense primers used to discern the 58 end; double underlined sequence is the antisense primer used to discern the 38 end. A 58 untranslated region including the 22-bp SL-1 primer sequence is shown.

P3 and the P82 positions. In addition, the 6.6-kDa T. suis inhibitor is similar in mass to the inhibitors of A. mellifera (6.0 kDa), A. suum (6.5 kDa), A. simplex (6.8 kDa), and A. caninum (8.7 kDa). However, based on the fact that TsTCI shares only limited homology with only one member of the Ascaris inhibitor family (the honeybee inhibitor AmCI) and does not display a similar pattern of cysteine residues or a similar reactive site position as AmCI or the nematode inhibitors, TsTCI does not appear to be a member of this family. The A. suum and A. caninum inhibitors have precisely defined functions in the host–parasite relationship. The trypsin-specific inhibitor (ATI) and the chymotrypsin/elastasespecific inhibitor (A/E-1) from A. suum, a nematode found in the lumen of the small intestines of pigs, are components of an unusual gut-associated mechanism that protects the parasite from host digestive enzymes (Hawley et al. 1994). The high degree of specificity of ATI is illustrated by its inhibition of host (pig) trypsin but not human trypsin (Peanasky et al. 1987). In addition to ATI and A/E-1, inhibitors of the aspartyl protease pepsin and the metalloproteases carboxypeptidase A and B inactivate ingested host digestive enzymes within the worm’s intestinal tract. Hematophagous parasites such as the hookworm A. caninum utilize protease inhibitors as anticoagulants to maintain the flow of blood

during ingestion. The A. caninum anticoagulant peptide (AcAP), a specific inhibitor of factor Xa, is the most potent naturally occurring anticoagulant yet described (Ki 5 0.323 nM) (Cappello et al. 1995). Protease inhibitor-mediated modulation of host immune effector systems has been proposed as an important parasite defense mechanism for evading host attack. This function has been suggested for inhibitors related to the Kunitz-type family of serine protease inhibitors described from the trematode Fasciola hepatica (Bozas et al. 1995) and the nematode Anisakis simplex (Morris and Sakanari 1994). Inhibitors belonging to the serpin superfamily of serine protease inhibitors have been implicated as modulators of viral-induced host immune responses (Ray et al. 1992; Macen et al. 1993) and were recently identified for the first time in the filarial nematode Brugia malayi (Yenbutr and Scott 1995) and the trematode Schistosoma mansoni (Modha et al. 1996). A trypsin/chymotrypsin inhibitor secreted by the cestode Taenia taeniaeformis (Suquet et al. 1984) has been shown to inhibit lymphocyte proliferation (Leid et al. 1986), complement activation (Hammerberg and Williams 1978), and leukocyte function (Potter and Leid 1968; Leid et al. 1987). Potential parasite or host protease targets for the T. suis inhibitor TsTCI have yet to be identified. TsTCI might function in the regulation of an endogenous enzyme; however,

6

RHOADS, FETTERER, AND HILL

by inactivating mast cell- and/or neutrophil-released serine proteases which function as critical mediators of the inflammatory process. In addition, this inhibitor may be a factor in the mechanism of T. suis-induced immune suppression exemplified by a decrease in host resistance to opportunistic intestinal pathogens such as Campylobacter jejuni (Mansfield and Urban 1996) and responsible for the more severe clinical aspects of T. suis infections.

ACKNOWLEDGMENTS

FIG. 4. Comparison of amino acid sequences of reactive site regions of protease inhibitors from Trichuris suis, Apis mellifera, Ascaris suis, Anisakis simplex, and Ancylostoma caninum. TsTCI, T. suis trypsin/chymotrypsin inhibitor; AmCI, A. mellifera cathepsin G/chymotrypsin inhibitor; ATI, A. suum trypsin inhibitor; C/E-1, A. suum chymotrypsin/elastase inhibitor; AX-SPI-1,2,3, A. simplex elastase isoinhibitors; AcAP, A. caninum anticoagulant peptide. Bold letters indicate the reactive site residues. Residues around the reactive site peptide bond of the inhibitor that combine with the catalytic site of the enzyme in a substrate-like manner are designated P3 to P82. The peptide bond is between residues P1 and P81. P1 –P81 residues were determined for ATI, AcAP, and AmCI by partial proteolytic cleavage at the reactive site by the cognate protease (Peanasky et al. 1987; Stanssens et al. 1996; Bania et al. 1999). Gaps (2) were introduced to emphasize the similar pattern of cysteine residues (marked.).

We are indebted to C. Byrd and G. Soriano for expert technical assistance. We also thank Dr. R. Winant, PAN Facility, Beckman Center, Palo Alto, CA, for expertise and advise on amino acid sequence analyses.

REFERENCES

Bania, J., Stachowiak, D., and Polanowski, A. 1999. Primary structure and properties of the cathepsin G/chymotrypsin inhibitor from the larval hemolymph of Apis mellifera. European Journal of Biochemistry 262, 680–687. Batte, E. G., McLamb, R. D., Muse, K. E., and Tally, S. D. 1977. Pathophysiology of swine trichuriasis. American Journal of Veterinary Research 38, 1075–1079.

no serine proteases have been detected in T. suis. A metalloprotease localized to the stichosome (Hill et al. 1993) and a cysteine protease localized to the gut (Hill and Sakanari 1997) have been demonstrated; TsTCI had no effect on these proteases. Although the T. suis inhibitor described in this study has specificity for the serine proteases trypsin and chymotrypsin, major enzymes of the mammalian digestive tract, T. suis, in contrast to A. suum, is localized in the cecum and colon where host digestive enzymes would not be abundant. Also, although T. suis is reported to be a blood feeder (Beer and Lean 1973; Bundy and Cooper 1989), TsTCI did not inhibit thrombin or factor Xa, key proteases in the blood coagulation pathway, and thus does not appear to aid in the digestion of blood by preventing clot formation. The distinctive structure of the TsTCI inhibitor, its potent affinity for the serine proteases trypsin and chymotrypsin, and its presence in the external environment of T. suis argue for an important function in the biology of this parasite and particularly in its interaction with the host. TsTCI might function in modulating host immune effector mechanisms

Beer, R. J. S. 1973. Studies on the biology of the life-cycle of Trichuris suis Schrank, 1788. Parasitology 67, 253–262. Beer, R. J. S., and Lean, I. J. 1973. Clinical trichuriasis produced experimentally in growing pigs. 1. Pathophysiology of infection. The Veterinary Record 93, 189–195. Bieth, J. 1974. Some kinetic consequences of the tight binding of protein-proteinase-inhibitors to proteolytic enzymes and their application to the determination of dissociation constants. Bayer-Symposium V. Proteinase Inhibitors, pp. 463–469, Springer-Verlag. Blaxter, M. L., Ingram, L., Tweedie, S. 1994. Sequence, expression and evolution of the globins of the parasitic nematode Nippostrongylus brasiliensis. Molecular and Biochemical Parasitology 68, 1–14. Bozas, S. E., Panaccio, M., Creaney, J., Dosen, M., Parsons, J. C., Vlasuk, G. V., Walker, I. D., and Spithill, T. W. 1995. Characterization of a novel Kunitz-type molecule from the trematode Fasciola hepatica. Molecular and Biochemical Parasitology 74, 19–29. Bundy, D. A. P., and Cooper, E. S. 1989. Trichuris and trichuriasis in humans. Advances in Parasitology 28, 107–173. Cappello, M., Vlasuk, G. P., Bergum, P. W., Huang, S., and Hotez, P. J. 1995. Ancylostoma caninum anticoagulant peptide: A hookwormderived inhibitor of human coagulation factor Xa. Proceedings of the National Academy of Science USA 92, 6152–6156.

7

In Vitro RELEASED TRYPSIN AND CHYMOTRYPSIN INHIBITOR

Carney, D. F., Jagels, M. A., Hugli, T. E., Sands, H., and Rubin, H. 1998. Effect of serine proteinase inhibitors on neutrophil function: a1-proteinase inhibitor, antichymotrypsin, and a recombinant hybrid mutant of antichmotrypsin (LEX032) modulate neutrophil adhesion interactions. Journal of Leukocyte Biology 63, 75–82. Hammerberg, B., and Williams, J. F. 1978. Interaction between Taenia taeniaeformis and the complement system. Journal of Immunology 120, 1033–1038.

Polanowska, J., Krokoszynska, I., Czapinska, H., Watorek, W., Dadlez, M., and Otlewski, J. 1998. Specificity of human cathepsin G. Biochimica Biophysica Acta 28, 189–198. Potter, K. A., and Leid, R. W. 1986. Isolation and partial characterization of an eosinophil chemotactic factor from metacestodes of Taenia taeniaeformis (ECF-Tt). Journal of Immunology 136, 1712–1717.

Hawley, J. H., Martzen, M. R., and Peanasky, R. J. 1994. Proteinase inhibitors in Ascarida. Parasitology Today 10, 308–313.

Ray, C. A., Black, R. A., Kronheim, S. R., Greenstreet, T. A., Sleath, P. R., Salvesen, G. S., and Pickup, D. J. 1992. Viral inhibition of inflammation: cowpox virus encodes an inhibitor of the interleukin1b converting enzyme. Cell 69, 597–604.

Hill, D. E., Gamble, H. R., Rhoads, M. L., Fetterer, R. H., and Urban, J. F., Jr. 1993. Trichuris suis: A zinc metalloprotease from culture fluids of adult parasites. Experimental Parasitology 77, 170–178.

Rutter, J. M., and Beer, R. J. S. 1975. Synergism between Trichuris suis and the microbial flora of the large intestine causing dysentery in pigs. Infection and Immunity 11, 395–404.

Hill, D. E., and Sakanari, J. A. 1997. Trichuris suis: Thiol protease activity from adult worms. Experimental Parasitology 85, 55–62.

Stanssens, P., Bergum, P. W., Gansemans, Y., Jespers, L., Laroche, Y., Huang, S., Maki, S., Messens, J., Lauwereys, M., Cappello, M., Hotez, P. J., Lasters, I., and Vlasuk, G. P. 1996. Anticoagulant repertoire of the hookworm Ancylostoma caninum. Proceedings of the National Academy of Science USA 93, 2149–2154.

Kozak, M. 1986. Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283–292. Leid, R. W., Grant, R. F., and Suquet, C. M. 1987. Inhibition of equine neutrophil chemotaxis and chemokinesis by a Taenia taeniaeformis proteinase inhibitor, taeniaestatin. Parasite Immunology 9, 195–204. Leid, R. W., Suquet, C. M., Bouwer, H. G. A., and Hinrichs, D. J. 1986. Interleukin inhibition by a parasite proteinase inhibitor, taeniaestatin. Journal of Immunology 137, 2700–2702. Lu, C. C., Nguyen, T., Morris, S, Hill, D., and Sakanari, J. A. 1998. Anisakis simplex: Mutational bursts in the reactive site centers of serine protease inhibitors from an Ascarid nematode. Experimental Parasitology 89, 257–261. Macen, J. L., Upton, C., Nation, N., and McFadden, G. 1993. SERP1, a serine proteinase inhibitor encoded by myxoma virus, is a secreted glycoprotein that interferes with inflammation. Virology 195, 348–363. Mansfield, L. S., and Urban, J. F., Jr. 1996. The pathogenesis of necrotic proliferative colitis in swine is linked to whipworm induced suppression of mucosal immunity to resident bacteria. Veterinary Immunology and Immunopathology 50, 1–17. Modha, J., Roberts, M. C., and Kusel, J. R. 1996. Schistosomes and serpins: A complex business. Parasitology Today 12, 119–121. Morris, S. R., and Sakanari, J. A. 1994. Characterization of the serine protease and serine protease inhibitor from the tissue-penetrating nematode Anisakis simplex. The Journal of Biological Chemistry 269, 27650–27656. Peanasky, R. J., Martzen, M. R., Homandberg, G. A., Cash, J. M., Babin, D. R., and Litweiler, B. 1987. Proteinase inhibitors from intestinal parasitic helminths: structure and indications of some possible functions. In “Molecular Paradigms for Eradicating Helminthic Parasites” (A. J. MacInnis, Ed.), pp. 349–366. A. R. Liss, New York.

Stoschek, C. M. 1990. Quantitation of protein. In “Methods of Enzymology, Guide to Protein Purification” (M. P. Deutscher, Ed.), Vol. 182, pp. 50–68. Academic Press, New York. Suquet, C., Green-Edwards, C. and Leid, R. W. 1984. Isolation and partial characterization of a Taenia taeniaeformis metacestode proteinase inhibitor. International Journal for Parasitology 14, 165–172. Travis, J. 1988. Structure, function, and control of neutrophil proteinases. American Journal of Medicine 84, 37–42. Urban, J. F., Jr., Mansfield, L. S., Shea-Donohue, T., Gause, W. C., and Finkelman, F. D. 1998. Mechanisms of the intestinal immunity to nematode parasites and the consequences to invasion by opportunistic bacteria. In: “Old Herborn University Seminar Monograph II. Immunomodulation of the Gastrointestinal Mucosa.” (P. J. Heidt, J. C. Cebra, V. D. Rusch, D. Van der Waaij, and R. I. Walker, Eds.), pp. 59–69, Herborn Letterae, Herborn-Dill, Germany. Von Heijne, G. 1986. A new method for predicting signal sequence cleavage sites. Nucleic Acids Research 14, 4683–4691. Walls, A. F., He, S., Teran, L., and Holgate, S. T. 1993. Mast cell proteases as mediators of vascular leakage and cell accumulation. Journal of Allergy and Clinical Immunology 91, 256. Yenbutr, P. and Scott, A. L. 1995. Molecular cloning of a serine proteinase inhibitor from Brugia malayi. Infection and Immunity 63, 1745–1753. Zarlenga, D. S., and Gamble, H. R. 1987. Simultaneous isolation of preparative amounts of RNA and DNA from Trichinella spiralis by cesium trifluoroacetate isopycnic centrifugation. Analytical Biochemistry 162, 569–574. Received 30 September 1998; accepted with revision 24 September, 1999