Trisomy 8 and monosomy 7 detected in bone marrow using primed in situ labeling, fluorescence in situ hybridization, and conventional cytogenetic analyses.

Cancer Genetics and Cytogenetics 125 (2001) 30–40

Trisomy 8 and monosomy 7 detected in bone marrow using primed in situ labeling, fluorescence in situ hybridization, and conventional cytogenetic analyses. A study of 54 cases with hematological disorders Ju Yana, Xiao-Xiang Zhangb,c, Raouf Fetnid, Régen Drouina,* a

Division of Pathology, Department of Medical Biology, Faculty of Medicine, Laval University, and Unité de Recherche en Génétique Humaine et Moléculaire, Hôpital Saint-François d’Assise, CHUQ, 10 de l’Espinay, Québec, Québec, Canada, G1L 3L5 b Department of Pathology, Duke University Medical Center, Durham, North Carolina, USA c Smithkline Beecham Clinical Laboratories, 7600 Tyrone Avenue, Van Nuys, California, USA 91405 d Laboratoire de Cytogénétique, Département d’Hématologie, Hôpital Maisonneuve-Rosemont, 5415 blvd. 1’Assomption, Montréal, Québec, Canada, H1T 2M4 Received 18 April 2000; accepted 24 August 2000

Abstract

Trisomy 8 and monosomy 7 are the two most frequent aneuploidies found in hematological disorders such as myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). In this study, primed in situ labeling (PRINS), fluorescence in situ hybridization (FISH) and conventional cytogenetic approaches were used to investigate 54 cases of hematopoietic disorders. Of these cases, there were 22 cases of trisomy 8, 2 cases of tetrasomy 8, 14 cases of monosomy 7, and 16 cases with two copies of both chromosomes 7 and 8. PRINS was carried out in interphase nuclei of bone marrow samples using primers that can specifically detect ␣-satellite DNA sequences of chromosomes 7 and 8. In parallel, using the ␣-satellite probes for chromosomes 7 and 8, FISH was performed for all the cases. PRINS and FISH techniques showed similar specificity and sensitivity. In comparison to FISH, PRINS is more advantageous since it is a faster, easier, and more cost-effective technique. Additionally, for most of the cases, a higher proportion of aneuploidy was detected in metaphases using conventional cytogenetics, as compared to the one found in interphase nuclei identified with PRINS and FISH techniques. In other words, for these cases, the cells with trisomy 8 or monosomy 7, had a distinct proliferative advantage compared to the disomic cell population. Therefore, to better quantify the proportion of aneuploid cells in bone marrow, we recommend to investigate the frequency of aneuploidy in nuclei using PRINS, rather than studying only the dividing cells as detected by conventional cytogenetic techniques. © 2001 Elsevier Science Inc. All rights reserved.

1. Introduction The diagnosis and the prognosis of hematopoietic disorders are greatly influenced by chromosome aberrations which often consist of aneuploidies. Trisomy 8 and monosomy 7 are the most frequent numerical chromosome aberrations occurring in acute non-lymphocytic leukemia (ANLL) and myelodysplastic syndromes (MDS). If the

* Corresponding author. Tel: 418-525-4444, ext. 3251; fax: 418-5254195. E-mail address: [email protected] (R. Drouin).

cases with multiple aberrations are taken into consideration, the frequencies of trisomy 8 and monosomy 7 represent approximately 15% and 12% of all cytogenetic abnormalities, respectively [1]. Traditionally, conventional cytogenetic analysis of bone marrow samples is used for the detection of chromosomal aberrations. However, a karyotype analysis reflects genetic alterations only in the dividing cell population. Since cells with chromosome abnormalities often present a higher dividing capacity than normal cells, karyotype analysis does not provide an accurate estimation of the proportion of genetically altered cells in the bone marrow [2]. Indeed, the non-dividing (interphase) cells represent the most im-

0165-4608/01/$ – see front matter © 2001 Elsevier Science Inc. All rights reserved. PII: S0165-4608(00)00 3 5 5 - 1

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

portant fraction of the bone marrow cells, and are not studied using conventional cytogenetic analysis. The proportion of genetically altered cells constitutes an important parameter in order to determine the clinical evolution, prognosis and response to treatment. It is also crucial for the detection of minimal residual leukemia cells in the bone marrow [3,4]. The tremendous development of molecular cytogenetics now allows the easy detection of chromosome aberrations in all cells from various samples. Since the metaphase preparations obtained from bone marrow sometimes yield very few and poor quality mitoses for chromosome analysis, the molecular approach constitutes an important way to study chromosome aberrations. Fluorescence in situ hybridization (FISH) is widely applied to study chromosome aberrations in metaphases as well as in interphase nuclei (interphase cytogenetics) [5–7]. FISH can make use of repetitive DNA (alpha-satellite) sequence probes specific to the centromere regions of the individual chromosomes, and it is particularly useful to detect chromosomal aneuploidy in non-dividing cells [8]. The main advantage of interphase cytogenetics over metaphase analysis is that no cell culture is required, thereby making the procedure suitable for any types of cell preparations, and hence clinical samples [6]. The FISH procedures are thus quick and reliable for investigations using the whole cell population. However, FISH requires expensive probes and is still time-consuming regardless of the probes being commercially obtained or prepared in the laboratory. A good alternative technique, the primed in situ labeling (PRINS) [9] has been used for many diagnostic purposes, including the detection of chromosome aberrations in different cell preparations. PRINS involves annealing of chromosomespecific primers to target repetitive DNA sequences, followed by in situ primer extension using Taq DNA polymerase to incorporate labeled dUTP. The newly synthesized DNA strand is revealed immunochemically as a fluorescent signal [10– 12]. The reliability, sensitivity, and resolution of PRINS have recently been greatly improved. Indeed, PRINS now provides a rapid and highly effective way for investigating chromosome aberrations [13–18]. It has been successfully applied to study chromosome abnormalities in whole cell populations in bone marrow samples of patients suffering from hematopoietic disorders [2,19,20]. Combination of conventional cytogenetic techniques and FISH and/or PRINS for cytogenetic diagnosis has led to the suggestion that cells bearing certain chromosome aneuploidy show a proliferative advantage in culture. In fact, a higher aneuploid proportion of cells was found in the dividing cell population as compared to the non-dividing cell population in most studies [2,3,8,21–24]. The aims of our study were: (1) to compare and evaluate the sensitivity and specificity of PRINS with that of FISH for the detection of trisomy 8 and monosomy 7 in interphase nuclei from bone marrow samples; and (2) to compare the proportion of aneuploid cells in the dividing cell population to that in the non-dividing population thus to evaluate if tri-

31

somy 8 and monosomy 7 in hematologic disorders confer a proliferative advantage as suggested by others [2,3,21–24].

2. Materials and methods 2.1. Cases and cell preparation Bone marrow samples from a total of 54 patients suffering from various hematological disorders were studied using GTG-banding, PRINS and FISH analyses. Sixteen cases did not have any numerical aberrations involving chromosomes 7 and 8, and they were considered as normal controls. Among the 38 aneuploid cases, 25 were male and the age ranged from 20 to 88 years. Twenty-four cases were diagnosed as myelodysplastic syndrome (MDS), 13 cases were acute myeloblastic leukemia (AML), and one case was chronic myeloid leukemia (CML). The cells from 29 out of 54 samples had been stored for 1–8 years either in fixative at ⫺20⬚C or in RPMI 1640 medium with DMSO kept in liquid nitrogen. These cases had been performed karyotype analyses previously. Just before PRINS and FISH experiments, the cells kept in nitrogen were thawed, cultured for 24 h and then harvested as usual. The other 25 samples were studied using freshly obtained bone marrow. For these samples, 24 h of short-term cell culture without PHA was set up. Five milliliters of RPMI 1640 medium supplemented with 15% of fetal calf serum and 1% L-glutamine were added to each culture tube. The cell concentration in the medium was adjusted to 1 ⫻ 106/ml. Colcemid at a final concentration of 0.05 ␮g/ml was added 60 min before harvesting. Cells were treated with 0.075 M KCl hypotonic solution at 37⬚C for 15 min followed by three changes of 3:1 methanol:glacial acetic acid fixative solution. The cells were finally resuspended in this fixative solution. The slides for GTG-banding were prepared from the cell suspension and the remaining cell suspension was kept at ⫺20⬚C until PRINS and FISH were performed. GTGbanding was performed according to standard techniques [25] and karyotype designation following the International System for Human Cytogenetic Nomenclature (ISCN) 1995 [26]. For FISH and PRINS detection, the cells suspended in fixative solution were spread on slides in a Thermotron (CDS-5) at 30⬚C and 40% of humidity. Some slides were prepared by pipetting 3 ␮l of fixed cell suspension onto the slide and as many as 8 different samples could be handled on the same slide [2,13]. The slides were put in a 2 ⫻ SSC (1 ⫻ SSC ⫽ 150 mM sodium chloride and 15 mM sodium citrate solution) bath at 37⬚C for 30 min and then dehydrated in 70%, 80%, and 100% ethanol. After air-drying the slides, PRINS and FISH procedures were performed. 2.2. Fluorescence in situ hybridization Centromere-specific alpha satellite DNA probes, for the detection of chromosomes 7 and 8 in the FISH investiga-

32

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

tion, were purchased from Oncor (Gaithersburg, MD, USA) and Vysis Inc. (Downers Grove, IL, USA). The FISH procedure was performed as described by the manufacturers with some slight modifications. For Oncor probes, briefly, the slides were denatured with 70% deionized formamide/2 ⫻ SSC at 70⬚C for 2 min, then successively passed through 70%, 80%, and 100% ethanol at ⫺20⬚C. Following air-drying of the slides, the denatured probe (70⬚C for 5 min) labeled with digoxigenin was added onto the slide and then covered with a coverslip. The hybridization reaction was carried out in a humidity chamber at 37⬚C overnight. The post-hybridization washes of the slides were done in 60% formamide/2 ⫻ SSC at 43⬚C for 5 min, 2 ⫻ SSC at 43⬚C for 5 min, and PBT buffer (PBS plus 0.1% Tween-20 and 1% human serum albumin, pH 7.4) at room temperature for 5 min. To reveal the hybridization signal, the preparations were taken through successive incubations for 45 min each at 37⬚C with the following antibodies: 2% mouse anti-digoxigenin monoclonal antibody (Roche Molecular Biochemicals), 2% anti-mouse Ig-digoxigenin (Roche Molecular Biochemicals), and 1% anti-digoxigeninrhodamine (Roche Molecular Biochemicals). Following each incubation, the slides were washed twice in PBT buffer for 5 min each at room temperature. The cells were counterstained and mounted with 125 ng/ml 4,6-diamino-2-phenylindole (DAPI) II solution (Vysis) following the last wash. For Vysis probes, the procedures were similar as above but no antibody reaction steps were needed after hybridization since these probes were directly labeled with a fluorochrome. The post-hybridization washes were done by immersing the slides in prewarmed 50% formamide/2 ⫻ SSC solution twice for 5 min each and 2 ⫻ SSC once for 5 min at 43⬚C. The slides were transferred to a bath of 2 ⫻ SSC/ 0.1% Nonidet P-40 (BDH) for one min at room temperature and were then counterstained and mounted with DAPI II. 2.3. Primed in situ labeling Oligonucleotide primers (GCTTGAAATCTCCACCTGAAATGCCACAGC for chromosome 7 and CTATCAATAGAAATGTTCAGCACAGTT for chromosome 8) [14,18] were custom synthesized by Laval University facilities. For each slide, the PRINS reaction solution was made by mixing 4 ␮l of each of 2.5 ␮M dATP, dCTP and dGTP, 4 ␮l of 0.25 ␮M dTTP (Roche Molecular Biochemicals), 1 ␮l of 1 mM Dig-11-dUTP (Roche Molecular Biochemicals) or Bio11-dUTP (Enzo), 2 ␮l of 2.5 ␮M primer, 2.5 U Taq DNA polymerase (Roche Molecular Biochemicals), 5 ␮l of 10 ⫻ PCR buffer (Roche Molecular Biochemicals) and distilled water for a total volume of 50 ␮l. After the slides were denatured in 70% Formamide/2 ⫻ SSC at 70⬚C for 2 min, dehydrated in a cold (⫺20⬚C) ethanol series and air-dried, they were transferred to a flat block for microscope slides of a thermocycler (PTC-100, MJ Research) at 62.5⬚C for 3 min. The PRINS reaction solution was then added to each slide and the coverslip was carefully mounted on it to avoid

any air bubbles. A single-step primer annealing and extension [14] was performed at 62.5⬚C for 10 min. The reaction was arrested by immersing the slides in a stop buffer (500 mM NaCl and 50 mM EDTA, pH 8.0) at 62.5⬚C for 1 min and rinsed in washing buffer (4 ⫻ SSC, 0.2% Tween 20) at room temperature for 5 min. For signal detection, the slides were mounted with 50 ␮l of blocking buffer (5% of skimmed milk dissolved in the washing buffer) and covered with a coverslip for 5 min. After draining the blocking buffer of the slides, 50 ␮l of either 1% Anti-Dig-Rhodamine (Vector Laboratories, Burlingame, CA, USA) (if Dig-11-dUTP was used as the labeled nucleotide in the extension step) or 0.5% fluorescein-avidin DCS (Vector Laboratories) (if Bio-11-dUTP was used as the labeled nucleotide in the extension step) in the blocking buffer was applied onto the slide. The slides were incubated in a moist chamber at 37⬚C for 30 min and then washed twice in washing buffer for 5 min at room temperature and counterstained with DAPI II. Dual-color PRINS showing simultaneously, chromosomes 7 and 8, in different colors on the same nucleus, was also carried out as described by Pellestor et al. [27] and Gosden et al. [28]. This procedure requires a blocking step with 4 different dideoxynucleotide triphosphates (ddATP, ddCTP, ddGTP, and ddTTP) after the first PRINS reaction to prevent the 3⬘ends of the products of the previous primer extension to act as primers for the next reaction. For this purpose, a blocking solution was prepared by mixing 1 ␮l of each ddNTP 50 ␮M (Roche Molecular Biochemicals), 4 ␮l of 10 ⫻ nick translation buffer (500 mM Tris-HCl, pH 7.2, 50 mM MgSO4, 0.1 mM dithiothreitol, 1 mg/ml of bovine serum albumin), 2 U of Klenow enzyme (Roche Molecular Biochemicals), and distilled water to a total volume of 40 ␮l. Following the first PRINS reaction, the slides were transferred from stop buffer (same as single PRINS) to 1 ⫻ nick translation buffer and washed in this buffer for 5 min. The blocking solution was then applied to the slide for 10–30 min at 37⬚C. After the slides were dehydrated in 70%, 80%, and 100% of ethanol for 2 min each, the second PRINS reaction with a different labeled nucleotide was performed. For dual-color detection, a mixture of 1% Anti-Dig-Rhodamine and 0.5% fluorescein-avidin DCS was added onto the slide for 30 min at 37⬚C and the slide was then counterstained with DAPI II.

2.4. Image analysis and scoring Images were viewed under the fluorescent microscope with the proper filter set. To compare the sensitivity and specificity of PRINS and FISH, 100 to 400 interphase nuclei were blindly scored by two individuals for each sample of PRINS and FISH. The number of fluorescent signals for each nucleus was noted as: 0 (no signal could be seen), 1, 2, 3, or 4 signals. The pictures were captured by using an Olympus BX60 microscope equipped with Compulog IMAC-CCD S30 video camera module and the in situ imaging system (ISIS 2) software version 2.5 (MetaSystems, Belmont, MA, USA).

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

33

Table 1 Clinical information and karyotypes for cases with trisomy 8 and monosomy 7 Case no.

Age/Sex

Diagnosis

G-banding karyotype

Tri./tetra.8 cases 1 2 3 4 5a

64/M 75/F 67/M 65/F 58/M

MDS AML (M5) MDS MDS AML (M2)

80/M NA/M NA/M NA/F 64/F NA/M NA/M NA/F 69/M NA/F 65/M 70/M NA/M NA/F NA/F 60/M 45/F 69/M 17/F

MDS MDS AML AML AML (M4) MDS MDS MDS MDS MDS MDS MDS MDS MDS AML MDS AML MDS AML

47,XY,⫹8[8]/46,XY[7] 47,XX,⫹8[9]/46,XX[13] 48,XY,⫹8,⫹8[12]/46,XY[18] 47,XX,⫹8[5]/46,XX[15] 46,XY,t(9;22)(q34;q11)[8]/51,idem,⫹Y⫹8,⫹9, ⫹18,⫹der(22)t(9;22)[17] 47,XY,⫹8[7] 47,XY,⫹8[20] 47,XY,⫹8[20] 47,XX,⫹8[18]/46,XX[2] 47,XX,⫹8[20] 47,XY,⫹8[20] 47,XY,⫹8[16]/46,XY[4] 48,XX,⫹8,⫹12[20] 48,XY,⫹8,⫹mar[10]/46,XY[10] 47,XX,⫹8[15]/46,XX[5] 47,XY,⫹8[8]/46,XY[12] 47,XY,⫹8[11]/46,XY[9] 47,XY,⫹8[10]/46,XY[10] 48,XX,⫹8,⫹9[2]/46,XX[18] 47,XX,⫹8,dup(16)[11]/47,idem,der(14]/46,XX[5] 47,XY,⫹8[10]/46,XY[18] 47,XX,⫹8[27] 47,XY,⫹8[25] 47,XX,⫹8[31]/46,XX[11]

75/M 20/M 80/M 69/M 67/M NA/M 38/M NA/M 53/M NA/M 71/F 66/M

MDS AML AML (M1) MDS AML AML MDS MDS MDS CML MDS AML

88/F 57/F

MDS MDS

6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Mono. 7 cases 25 26 27 28 29 30 31 32 33 34 35 36 37 38

N/Ab N/Ab N/Ab 45,XY,⫺7[8]/46,XY[13] 43,X,⫺Y,der(3)t(3;?)(p22;?),⫺5,⫺7[20] 45,XY,⫺7,inv(11)(p15q23)[20] 45,XY,⫺7[14]/46,XY[6] 45,XY,⫺7[10]/46,XY[11] 45,XY,⫺7[18]/46,XY[2] 45,XY,⫺7[12]/45,XY,⫺7,del(12)(p11p13)[8] 46,XX,del(5)(q13q31),⫺7,del(20)(p13),⫹mar[20] 45,XY,⫺1,⫺5,⫺7,r(12),der(13), der(17), del(18)(pH.2),⫹mar 45,XX,⫺7[18]/46,XX[8] 45,XX,⫺7[20]

⫹8 or ⫺7 (%) 53 41 40 25 68 100 100 100 90 100 100 80 100 50 75 40 55 50 10 83 36 100 100 74

38 100 100 70 48 90 100 100 100 69 100

a

PRINS and FISH finally confirmed that the karyotype of this case was 46,XX,t(9;22)(q34;q11)[32%]/51,idem,ⴙ8,ⴙ8,⫹der(22)t(9;22)⫻2[68%]. For these cases, the bone marrow culture failed to provide any analyzable mitoses but monosomy 7 was found using FISH and PRINS. Abbreviations: NA, not available; M, male; F, female.

b

3. Results 3.1. Cytogenetic studies Some clinical information, including diagnosis and cytogenetic results for the cases with aneuploidy of chromosomes 7 and 8 are summarized in Table 1. For each patient, 7 to 30 metaphases were analyzed by standard GTG-banding. These studies revealed 22 cases with trisomy 8, 1 case with tetrasomy 8 (case 3), 1 case with trisomy 8 and trisomy 9 (case 5), 11 cases with monosomy 7, and 16 cases with two apparently normal copies of chromosomes 7 and 8. For three cases (cases 25, 26, and 27), the culture failed to provide any analyzable mitoses, but monosomy 7 was diagnosed using PRINS and FISH. Percentages of abnormal cells ranged

from 8% to 100% for trisomy 8 and from 38% to 100% for monosomy 7. There were 18 out of the 24 cases, where trisomy/tetrasomy 8 was the only abnormality and 6 cases in which there were additional chromosome aberrations. For monosomy 7, 6 cases had only monosomy 7 while 5 cases showed additional chromosome abnormalities (Table 1). 3.2. Comparison of PRINS with FISH Fig. 1 shows fluorescent signals corresponding to chromosomes 7 and 8 in control samples and in samples (Figs. 1a and b) displaying aneuploidy (Figs. 1c–f) using PRINS (Figs. 1a, c, e, and f), or FISH (Figs. 1b and d). Very bright and clear fluorescent signals were seen with FISH as well as with PRINS. For most of the samples, the fluorescent sig-

34

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

Fig. 1. Identification of chromosomes 7 and 8 using PRINS and FISH in interphase nuclei and metaphases obtained from bone marrow samples. (a) Fluorescent signals corresponding to chromosome 8 were revealed by PRINS in a control sample. The signals are easily visible using a ⫻40 objective. (b) Identification of chromosome 7 in a control sample using the FISH procedure. (c) Detection of one signal per nucleus in a case with monosomy 7 using the PRINS procedure. (d) Detection of a monosomy 7 using the FISH procedure. (e) Identification of trisomy and tetrasomy 8 using the PRINS technique. Note that nuclei showing 2, 3, or 4 fluorescent signals are present in this field. (f) Dual-color PRINS detection in a trisomy 8 case. The picture simultaneously shows two red signals specific to chromosome 7 and three green signals specific to chromosome 8 in a metaphase and an interphase nucleus.

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

35

Fig. 2. Proportion in percentage of cells containing different numbers of fluorescent signals for chromosome 8. Study of 16 normal control cases with two copies of chromosome 8. Two hundred nuclei per case were counted for each of PRINS and FISH techniques.

nals were clear and intense enough to be visible at a magnification of ⫻400 (objective 40⫻) (Fig. 1a). In a trisomy 8 case, dual-color PRINS was used for the simultaneous detection of chromosomes 7 and 8 in the same nuclei and metaphases, and displayed unambiguous fluorescent signals in two different colors, in an interphase nucleus and in a metaphase (Fig. 1f). Three green signals correspond to the three copies of chromosome 8 and two red signals are associated with the two copies of chromosome 7. The bone marrow samples from 16 cases, that did not show any chromosome abnormalities using conventional cytogenetic analyses, were used as controls to evaluate and compare the sensitivity and specificity of the PRINS and FISH techniques. The proportions of nuclei showing 2 fluorescent spots were very similar for both techniques: 93.75% using PRINS compare to 92.97% using FISH for chromosome 8 detection (Fig. 2), and 94.69% using PRINS compare to 94.35% using FISH for chromosome 7 detection (Fig. 3). For the 38 abnormal cases, no significant difference was observed between the results obtained by FISH and PRINS techniques for the detection of aneuploidy for chromosomes 7 and 8 (P⬎.05, paired t-test). For trisomy 8, 3.5% to 92% of nuclei with three fluorescent spots were revealed by PRINS while 5.5% to 88.5% were shown by FISH (Table 2). For monosomy 7, frequencies of cells with one fluorescent spot ranged from 8% to 95% with both techniques (Table 3). In case 3, a trisomy 8 clone was identified by PRINS and FISH techniques in addition to a tetrasomy 8 clone

which was defined as the sole abnormality by conventional cytogenetics. In case 5, interestingly, FISH and PRINS also revealed coexistence of tetrasomy 8 and trisomy 8 in interphase nuclei in contrast to conventional GTG-banding, which showed trisomy 8 and trisomy 9. This observation was further confirmed by FISH using centromere-specific alpha satellite DNA probe for chromosome 9, in which 94.5% of cells from this case showed only 2 signals. Furthermore, PRINS and FISH revealed 3 cases (cases 25, 26, and 27) carrying monosomy 7 clone which was not found by conventional cytogenetics because of the poor quality of GTG-banded metaphases from those bone marrow samples. 3.3. Comparison of conventional cytogenetics with molecular cytogenetics The proportion of cells showing aneuploidies for chromosomes 7 and 8 was established using conventional cytogenetics, PRINS and FISH in 14 cases of monosomy 7 and 24 cases of trisomy/tetrasomy 8. As shown in Table 4, the majority of cases showed higher proportions of aneuploidy in dividing cells (detected by conventional cytogenetics) than in non-dividing cells (detected by PRINS and FISH). Only 3 cases of trisomy 8 and 2 cases of monosomy 7 (cases 1, 14, 20, 32, and 37) showed slightly higher proportions of aneuploidy in interphase nuclei detected by PRINS and/or FISH than in GTG-banded metaphases (Table 4). These cases should be considered as showing the same proportions of aneuploid cells among both dividing and non-dividing

36

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

Fig. 3. Proportion in percentage of cells containing different numbers of fluorescent signals for chromosome 7. Study of 16 normal control cases with two copies of chromosome 7. Two hundred nuclei per case were counted for each of PRINS and FISH techniques.

cells. In 14 cases (cases 6–8, 10, 11, 13, 22, 23, 29, 30, 34– 36), GTG-banding revealed aneuploidies for chromosomes 7 or 8 in all analyzed metaphases (100%) but, for the same cases, FISH and PRINS analyses showed only 8–95% of aneuploid cells (Table 4). On the other hand, the lowest aneuploid proportion was found in one case where trisomy 8 was present in 10% of GTG-banded metaphases but it could be detected in only 3.5% and 5.5% of interphase nuclei as revealed using PRINS and FISH techniques, respectively. To confirm whether the frequency of aneuploidy is indeed higher in metaphases than in interphase nuclei for the cases studied, the paired t-test was done to set a comparison between the frequencies obtained from PRINS and conventional cytogenetics, as well as between FISH and conventional cytogenetics. The analysis of the results showed significant differences (P⬍.001 for trisomy 8 and P⬍.05 for monosomy 7 detections).

4. Discussion The advent of FISH and PRINS techniques has played an important role in the detection of chromosome aberrations not only in metaphase but also in interphase nuclei. A successful bone marrow culture is not anymore an absolute prerequisite to study chromosome aberrations in clinical samples. On the other hand, frozen cells can be conveniently used for FISH and PRINS analyses [2–4,8]. Moreover, archived materials can be used in retrospective investigation of chromosome aberrations

[5,29,30]. Samples from 29 out of 54 cases studied in our group had been stored for 1 to 8 years. PRINS and FISH provided very intense fluorescent signals on nuclei from these frozen samples. One of the main goals of this study was to compare the sensitivity and specificity of PRINS and FISH techniques for detecting chromosome aberrations in interphase nuclei. Our results showed that both techniques had similar specificity and sensitivity. The frequencies of nuclei showing 2 fluorescent signals of chromosome 7 or 8 per nucleus in the 16 control samples did not show any significant differences between the PRINS and FISH techniques (Figs. 2 and 3). The proportion of false positive nuclei that showed 3 and more signals for the detection of chromosomes 7 and 8 was well below 2% (Figs. 2 and 3). The proportion of false negative nuclei that showed 0 or 1 signal for the detection of chromosomes 7 and 8, was below 6% (Figs. 2 and 3). Regarding the frequencies of nuclei with trisomy 8 and monosomy 7 in the abnormal cases, the results obtained with FISH were not significantly different than those obtained with PRINS (P⬎.05, paired t-test). Considering that the rate of false positive signals is well below 2%, we recommend to set up the threshold detection level of trisomy/tetrasomy at 2.5%. On the other hand, considering that the rate of false negative signals is up to 6%, we recommend to set up the threshold detection level of monosomy at 7.5%. Taking into account the cost, PRINS is approximately ten times more cost-effective than FISH [19] and is less time-consuming. Indeed, the whole PRINS procedure can be completed in 1

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

37

Table 2 Comparison of PRINS and FISH using chromosome 8 alpha satellite sequences in 24 cases with trisomy 8 PRINS: percentage of nuclei with different number of signals Case no.

0

1

2

3a

4

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24

6 5 2 6.7 4 0.75 0 1.5 0 0 0 0.5 0.5 0 0 0 0 0 0 1 0 2.5 0 1.5

8 4.5 5 11 6 0.25 1 4.5 0 0 3.5 2 2.5 1.5 2 1 0 3.5 7.5 0 0.5 2.5 0 0

24 49 37 59 53 14 22.5 18.5 17 15.5 3.5 42.5 58 45.5 55 73.5 76.5 53.5 88.5 15 92 15 79.5 39.5

58 39.5 33 23.3 27 85 76.5 70.5 83 84 92 54.5 38.5 52 43 25.5 23.5 43 3.5 84 7.5 79 20.5 59

4 2 23 10

5 0.5 1 0.5 0.5 1

0.5

1 0

No. of nuclei scored

FISH: percentage of nuclei with different number of signals 0

1

2

3a

4

200 200 200 300 200 400 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200

4 4 3 3.5 1 2.3 1 1.5 3 1 0 0 1.5 0 15 0 0 0 0.5 0 1 0 0 1

9.5 4.5 6 3 2 2.7 2 1 0.5 0.5 0 3.5 2.5 1 0.5 2 0.5 2.5 8.5 2 3.5 0.5 4.5 1

28.5 59 53 76.5 50.8 31.3 23 17 12 19 14 57 68 37 34 75.5 75.5 64.5 85.5 21 87 11 58 38

57 31.5 21 17 29.5 63 73.5 78.5 82 77 86 39.5 28 61 50 22.5 24 32 5.5 74.5 8.5 88.5 37 60

1 1 17 16.7 0.7 0.5 2 2.5 2.5

1 0.5 0.5 1 2.5

0.5 0

No. of nuclei scored 200 200 200 200 400 300 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200 200

A statistical analysis using the t-test showed no significant difference between PRINS and FISH techniques regarding the proportion of trisomic cells (P ⬎ .05).

a

h, whereas FISH usually requires 24 h. In our laboratory, the primer concentration was set up as low as 5 pM in 50 ␮l of PRINS reaction solution. This concentration is 10 to 40 times lower than those routinely used by others [10–12,18– 20]. In our study, this low primer concentration gave unambiguous fluorescent signals, and a very high level of sensitivity and specificity. Moreover, the one-step procedure allowed the primer annealing and the DNA strand elongation

at the same temperature (62.5⬚C) as recommended by Koch et al. [14]. This allows PRINS to be performed in an incubator instead of relying on a special thermocycler machine with a flat block. With these modifications, we have additionally optimized and simplified the PRINS technique, thereby making it even cheaper. In the light of our results, we suggest that PRINS is unquestionably suitable for aneuploidy investigation of bone marrow samples and should be used preferentially to FISH.

Table 3 Comparison of PRINS and FISH using chromosome 7 alpha satellite sequences in 14 cases with monosomy 7 PRINS: percentage of nuclei with different number of signals Case no.

0

1a

2

25 26 27 28 29 30 31 32 33 34 35 36 37 38

1.5 0.5 1 2 2.5 1.5 0 9 4 1.5 0 1 3 3

85.5 80.5 65.5 32.5 95 93.5 50.5 39 76 8 91 54 87 42.5

13 19 33.5 65.5 2.5 5 49.5 52 20 90.5 8.5 45 10 54

3

0.5

0.5

No. of nuclei scored

FISH: percentage of nuclei with different number of signals 0

1a

2

200 200 200 200 200 200 200 120 200 200 200 200 200 200

1 1 11 2 0.5 0.5 3 3 0 0.5 1 0.5 0.5 1

73 87 77 26.5 92 95 58 53 80 8 92 38 68.5 49

26 11.5 12 70.5 7.5 4.5 38.5 43 20 91 7 61 30.5 50

3 0.5 1

0.5 1 0.5 0.5 0.5

No. of nuclei scored 200 200 100 200 200 200 200 140 200 200 200 200 200 200

A statistical analysis using t-test showed no significant difference between PRINS and FISH regarding the proportion of monosomic cells (P ⬎ .05).

a

38

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

Table 4 Comparison of the proportion of aneuploidy detected by G-banding with those obtained with PRINS and FISH

Case no. Trisomy 8 1 2 3a 4 5a 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Monosomy 7 25 26 27 28 29 30 31 32 33 34 35 36 37 38

Diagnosis

Aneuploidy with GTG (%)

Aneuploidy with PRINS (%)

Aneuploidy with FISH (%)

MDS AML (M5) MDS MDS AML (M2) MDS MDS AML AML AML (M4) MDS MDS MDS MDS MDS MDS MDS MDS MDS AML MDS AML MDS AML

53 41 0 (40) 25 0 (68) 100 100 100 90 100 100 80 100 50 75 40 55 50 10 83 36 100 100 74

65.5 39.5 33 (23) 23.3 27 (10) 85 76.5 70.5 83 84 92 54.5 38.5 52 43 25.5 23.5 43 3.5 84 7.5 79 20.5 59

57 31.5 21 (17) 17 29.5 (16.7) 63 73.5 78.5 82 77 86 39.5 28 61 50 22.5 24 32 5.5 74.5 8.5 88.5 37 60

MDS AML AML (M1) MDS AML AML MDS MDS MDS CML MDS AML MDS MDS

N/A N/A N/A 38 100 100 70 48 90 100 100 100 69 100

85.5 80.5 65.5 32.5 95 93.5 50.5 39.5 76 8 91 54 87 42.5

73 87 77 26.5 92 95 58 53 80 8 92 38 68.5 49

a

The numbers in parentheses represent the proportions of tetrasomy 8 cells.

Out of the 54 cases we studied, 38 were identified as carrying monosomy 7 or trisomy/tetrasomy 8. It is not surprising that MDS and AML were found in the majority of the 38 aneuploid cases (24 cases were MDS and 13 cases were AML). Since monosomy 7 and trisomy 8 occur mainly in MDS and AML, although there is no preference for any of the particular subsets proposed by the FAB group [31,32], these aneuploidies appear to be relatively specific for myeloid disorders [1]. It is well known that monosomy 7 is mostly associated with a poor clinical course [1,19,30,33], whereas trisomy 8 is likely associated with an intermediate to poor prognosis [34]. When considering male/female ratio, however, these aneuploidies appeared to be predominant in males: 14 out of 24 (1.4:1) for trisomy 8 cases and 11 out of 14 (3.7:1) for monosomy 7 cases were men. It has

been reported that there is a slightly higher incidence of MDS or AML in males compared to females. Indeed, the ratios of men:women suffering from MDS or AML vary from 1.1:1 to 1.5:1 [35]. Our sample of 22 patients with trisomy 8 is in agreement with these ratios. However, our MDS cases with trisomy 8 present a very high occurrence in males (11 males to 4 females). For monosomy 7, the ratio of male to female was really higher than the upper threshold of the basic sex ratio mentioned above for both AML and MDS (altogether 11 males to 3 females). This was especially evident in AML where all of the 5 patients were male (Table 1). The male predominance associated with monosomy 7 has also been observed by another group [2]. However, if trisomy 8 is also associated with male predominance in certain hematologic disorders is still under debate. We and other groups [2,3,19,20] have observed a significant difference in the frequency of aneuploid cells detected by conventional cytogenetics and interphase cytogenetics. In most of the cases, higher frequencies of aneuploid cells were found in metaphases studied by conventional cytogenetics, than those detected in interphase nuclei using PRINS and FISH. In 40% of the aneuploid cases (14 out of 35), we noticed that, the differences were less than ⫾10% (Table 4). For these cases, the aneuploidy frequencies should be considered as being roughly the same in both dividing and nondividing cell populations. These small differences may be mostly caused by the non-precise conventional cytogenetic study in which a relatively low number of metaphases (30 at most) was analyzed. We considered that the differences in aneuploid frequencies greater than 10% as being significant differences. The greatest difference was seen in a Ph-negative CML case (case 34) in our study group, in which monosomy 7 was found in 100% of the metaphase population but in only 8% of the interphase nuclei. The lowest aneuploid frequency was seen in a MDS case (case 19) in which trisomy 8 was found in 10% (2/20) of metaphases. For the same case, PRINS and FISH detections revealed only 3.5% and 5.5% of trisomy 8 nuclei, respectively (Tables 1 and 4). This is a good example to illustrate the detection sensitivity of PRINS and FISH. Using these molecular cytogenetic techniques, we were able to show very low levels of aneuploidy in non-dividing cell populations. The higher proportion of aneuploidy in dividing cells compared to non-dividing cells appears to be frequently observed in hematopoietic disorders such as MDS or AML. It appeared in 60% (21 out of 35) of the cases in our sample of patients. Many other studies reported similar results concerning aneuploidies of chromosomes 7 and 8 [2,3,8,19– 24,30,36,37]. These findings lead to the suggestion that monosomy 7 and trisomy 8 confer a high dividing capacity to the aneuploid cells in culture and thus a proliferative advantage over the normal cells, both in vivo and in vitro [2,22–24]. The occurrence of cells with chromosome aberrations conferring a proliferative advantage seems to be a common phenomenon in hematological disorders. In addition to monosomy 7 and trisomy 8, some other numerical or

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40

structural chromosome abnormalities were also reported as playing the same role [38–44]. Interestingly, when a tetrasomy 8 clone and a trisomy 8 clone are present in the same individual, according to some investigators, the former appears to confer a higher proliferative advantage to the cells than the latter [21,45]. Our results are in agreement with these observations. Among the 38 aneuploid cases we studied, two had a tetrasomy 8 clone. In case 3, 40% of the metaphases with tetrasomy 8 were defined as the sole aberration by GTG-banding analysis. However, PRINS and FISH techniques revealed tetrasomy 8 in 23% and 17% of the nuclei, respectively, and trisomy 8 in 33% and 21% of the nuclei, respectively. Similar results were obtained for the case 5. This patient’s karyotype was previously defined as 46,XY, t(9; 22)(q34;q11)[32%]/51,idem,⫹Y⫹8,⫹9,⫹18,⫹der (22)t(9; 22)[68%], and no tetrasomy 8 clone was found by the conventional GTG-banding analysis (Table 1). Unexpectedly, in addition to a trisomy 8 clone, PRINS and FISH revealed 10% and 16.7% of nuclei with tetrasomy 8, respectively. To rule out the presence of a trisomy 9, FISH using a centromere-specific alpha satellite DNA probe for chromosome 9 was carried out and showed that 94.5% of nuclei presented two fluorescent signals, and only 1% of nuclei displayed three signals. Therefore, PRINS and FISH techniques provided the correct identification of the tetrasomy 8 clone in which the fourth chromosome 8 was previously mis-recognized as being a chromosome 9 by GTG-banding analysis. Thus the final karyotype for this patient should be 46,XY,t(9;22)(q34; q11)[32%]/51, idem,⫹Y⫹ 8,⫹8,⫹18,⫹der(22)t(9;22)[68%]. The proportion of tetrasomy 8 for these two cases was much higher in metaphases than in interphase nuclei, and no trisomy 8 clone was found with conventional cytogenetics. These findings highly support the suggestion that tetrasomy 8 may confer a higher proliferative advantage than either trisomy 8 cells or normal cells. In contrast to our study and most reports, some authors claimed that the aneuploid cells are present in a higher proportion of non-dividing cells, rather than dividing cells, in a relatively small number of patients [3,20,36]. The reason, or the mechanism, for such a phenomenon is still unclear. It might be because of wrongly interpreted banding results; the false monosomy and trisomy fluorescent spots caused by signal overlapping or splitting [29,33]; or, in certain circumstances, the culture conditions might favor normal cells. Indeed, it has been reported that FISH can reveal aneuploidy which is undetectable by conventional cytogenetics [3,8,20,29,33]. We conclude that molecular cytogenetics can play an extremely important role for the clinical diagnosis, prognosis evaluation, follow-up and the detection of residual diseases in patients.

Acknowledgments We are extremely grateful to Marc Bronsard and Eric F. Bouchard for their excellent technical assistance for the PRINS and the FISH analyses, Vickram Bissonauth for his

39

valuable contribution to the preparation of the manuscript, and Mrs. Geneviève Chevalier for the critical review of the manuscript. This work was supported by grants from the Quebec Network of Applied Genetic Medicine (RMGA) with funds from “le Fonds de la Recherche en Santé du Québec” (FRSQ) to R.D. and “La Fondation de l’Hôpital Saint-François d’Assise”. “Le Centre de Recherche” is supported by the FRSQ. R.D. is a research scholar (junior II level) of the FRSQ program.

References [1] Heim S, Mitelman F. Cancer cytogenetics. New York: Wiley-Liss, 1995. [2] Pedersen B, Koch J, Bendix Hansen K, Hindkjaer J, Lindbjerg Andersen C. The monosomy 7 clone in interphase and metaphase cell population: a combined chromosome and primed in situ labeling study. Acta Haematol 1997;97:216–21. [3] Brizard F, Brizard A, Guilhot F, Tanzer J, Berger R. Detection of monosomy 7 and trisomies 8 and 11 in myelodysplastic disorders by interphase fluorescent in situ hybridization. Comparison with acute non-lymphocytic leukemias. Leukemia 1994;8:1005–11. [4] White DL, Hutchins CJ, Turczynowicz S, Suttle J, Haylock DN, Hughes TP, Juttner CA, To LB. Detection of minimal residual disease in an AML patient with trisomy 8 using interphase FISH. Pathology 1997;29:289–93. [5] Luke S, Shepelsky M. FISH: recent advances and diagnostic aspects. Cell Vis 1998;5:49–53. [6] Wolfe KQ, Herrington CS. Interphase cytogenetics and pathology: a tool for diagnosis and research. J Pathol 1997;181:359–61. [7] Werner M, Wilkens L, Aubele M, Nolte M, Zitzelsberger H, Komminoth P. Interphase cytogenetics in pathology: principles, methods, and applications of fluorescence in situ hybridization (FISH). Histochem Cell Biol 1997;108:381–90. [8] Wyandt HE, Chinnappan D, Ioannidou S, Salama M, O’Hara C. Fluorescence in situ hybridization to assess aneuploidy for chromosomes 7 and 8 in hematologic disorders [see comments]. Cancer Genet Cytogenet 1998;102:114–24. [9] Koch JE, Kolvraa S, Petersen KB, Gregersen N, Bolund L. Oligonucleotide-priming methods for the chromosome-specific labelling of alpha satellite DNA in situ. Chromosoma 1989;98:259–65. [10] Pellestor F, Girardet A, Lefort G, Andreo B, Charlieu JP. Selection of chromosome-specific primers and their use in simple and double PRINS techniques for rapid in situ identification of human chromosomes. Cytogenet Cell Genet 1995;70:138–42. [11] Pellestor F, Quenesson I, Coignet L, Girardet A, Andreo B, Lefort G, Charlieu JP. FISH and PRINS, a strategy for rapid chromosome screening: application to the assessment of aneuploidy in human sperm. Cytogenet Cell Genet 1996;72:34–6. [12] Pellestor F, Quennesson I, Coignet L, Girardet A, Andreo B, Charlieu JP. Direct detection of disomy in human sperm by the PRINS technique. Hum Genet 1996;97:21–5. [13] Hindkjaer J, Brandt CA, Stromkjaer H, Koch J, Kolvraa S, Bolund L. Primed IN situ labelling (PRINS) as a rational procedure for identification of marker chromosomes using a panel of primers differentially tagging the human chromosomes. Clin Genet 1996;50:437–41. [14] Koch J, Hindkjaer J, Kolvraa S, Bolund L. Construction of a panel of chromosome-specific oligonucleotide probes (PRINS-primers) useful for the identification of individual human chromosomes in situ. Cytogenet Cell Genet 1995;71:142–7. [15] Koch J. Primed in situ labeling as a fast and sensitive method for the detection of specific DNA sequences in chromosomes and nuclei. Methods 1996;9:122–8. [16] Speel EJ, Lawson D, Hopman AH, Gosden J. Multi-PRINS: multiple

40

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25] [26] [27]

[28]

[29] [30]

[31]

J. Yan et al. / Cancer Genetics and Cytogenetics 125 (2001) 30–40 sequential oligonucleotide primed in situ DNA synthesis reactions label specific chromosomes and produce bands. Hum Genet 1995;95: 29–33. Werner M, Nasarek A, Tchinda J, von Wasielewski R, Komminoth P, Wilkens L. Applications of single-color and double-color oligonucleotide primed in situ labeling in cytology. Mod Pathol 1997;10:1164–71. Pellestor F, Girardet A, Coignet L, Andreo B, Charlieu JP. Assessment of aneuploidy for chromosomes 8, 9, 13, 16, and 21 in human sperm by using primed in situ labeling technique. Am J Hum Genet 1996;58:797–802. Wilkens L, Komminoth P, Nasarek A, von Wasielewski R, Werner M. Rapid detection of karyotype changes in interphase bone marrow cells by oligonucleotide primed in situ hybridization (PRINS). J Pathol 1997;181:368–73. Velagaleti GV, Tharapel SA, Tharapel AT. Validation of primed in situ labeling (PRINS) for interphase analysis: comparative studies with conventional fluorescence in situ hybridization and chromosome analyses. Cancer Genet Cytogenet 1999;108:100–6. Muhlematter D, Castagne C, Bruzzese O, Clement F, Schmidt PM, Bellomo MJ. Tetrasomy 8 in a patient with acute nonlymphocytic leukemia: a metaphase and interphase study with fluorescence in situ hybridization. Cancer Genet Cytogenet 1996;89:44–8. Fagioli F, Cuneo A, Bardi A, Carli MG, Bigoni R, Balsamo R, Previati R, Pazzi I, Roberti G, Rigolin GM, Castoldi G. Heterogeneity of lineage involvement by trisomy 8 in myelodysplastic syndrome. A multiparameter analysis combining conventional cytogenetics, DNA in situ hybridization, and bone marrow culture studies. Cancer Genet Cytogenet 1995;82:116–22. Harrison KJ, Massing B, McKenna C, Kalousek DK. Molecular cytogenetic analysis of monosomy 7 in pediatric patients with myelodysplastic syndrome. Am J Hematol 1995;48:88–91. Fugazza G, Bruzzone R, Dejana AM, Gobbi M, Ghio R, Patrone F, Rattenni S, Sessarego M. Cytogenetic clonality in chronic myelomonocytic leukemia studied with fluorescence in situ hybridization. Leukemia 1995;9:109–14. Seabright M. A rapid banding technique for human chromosomes. Lancet 1971;2:971–2. ISCN. An International System for Human Cytogenetic Nomenclature. Mitelman F, editor. Basel: S. Karger, 1995. Pellestor F, Charlieu J. Analysis of sperm aneuploidy by PRINS. In: Gosden JR, editor. PRINS and in situ PCR protocols. Totowa, NJ: Humana Press Inc., 1997. p. 23–9. Gosden JR, Lawson D. Multiple sequential oligonucleotide primed in situ DNA syntheses (MULTI-PRINS). In: Gosden JR, editor. PRINS and in situ PCR protocols. Totowa, NJ: Humana Press Inc., 1997. p. 39–44. Gray JW, Pinkel D, Brown JM. Fluorescence in situ hybridization in cancer and radiation biology. Radiat Res 1994;137:275–89. Baurmann H, Cherif D, Berger R. Interphase cytogenetics by fluorescent in situ hybridization (FISH) for characterization of monosomy7-associated myeloid disorders. Leukemia 1993;7:384–91. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA,

[32]

[33] [34] [35]

[36]

[37]

[38] [39]

[40]

[41]

[42]

[43]

[44]

[45]

Gralnick HR, Sultan C. Proposals for the classification of the myelodysplastic syndromes. Br J Haematol 1982;51:189–99. Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, Gralnick HR, Sultan C. Proposed revised criteria for the classification of acute myeloid leukemia. A report of the French-American-British Cooperative Group. Ann Intern Med 1985;103:620–5. Masey JA. The myelodysplastic syndromes. Br J Biomed Sci 1997; 54:65–70. Sandberg AA. The chromosomes in human cancer and leukemia. New York: Elsevier, 1990. Deiss A. Acquired disorders associated with hematologic malignancies. In: Lee GR, Bithell TC, Foerster J, Athens JW, Lukens JN, editors. Wintrobe’s clinical hematology. Philadelphia, London: Lea & Febiger, p. 1949–59. Kolluri RV, Manuelidis L, Cremer T, Sait S, Gezer S, Raza A. Detection of monosomy 7 in interphase cells of patients with myeloid disorders. Am J Hematol 1990;33:117–22. Kibbelaar RE, Mulder JW, Dreef EJ, van Kamp H, Fibbe WE, Wessels JW, Beverstock GC, Haak HL, Kluin PM. Detection of monosomy 7 and trisomy 8 in myeloid neoplasia: a comparison of banding and fluorescence in situ hybridization. Blood 1993;82:904–13. Ganick DJ. Hematological changes in Down’s syndrome. Crit Rev Oncol Hematol 1986;6:55–69. Liso V, Capalbo S, Lapietra A, Pavone V, Guarini A, Specchia G. Evaluation of trisomy 12 by fluorescence in situ hybridization in peripheral blood, bone marrow and lymph nodes of patients with B-cell chronic lymphocytic leukemia. Haematologica 1999;84:212–7. Kumaravel TS, Tanaka K, Arif M, Ohshima K, Ohgami A, Takeshita M, Kikuchi M, Kamada N. Clonal identification of trisomies 3, 5 and X in angioimmunoblastic lymphadenopathy with dysproteinemia by fluorescence in situ hybridization. Leuk Lymphoma 1997;24:523–32. Pedersen-Bjergaard J, Rowley JD. The balanced and the unbalanced chromosome aberrations of acute myeloid leukemia may develop in different ways and may contribute differently to malignant transformation. Blood 1994;83:2780–6. Taylor AM, Lowe PA, Stacey M, Thick J, Campbell L, Beatty D, Biggs P, Formstone CJ. Development of T-cell leukaemia in an ataxia telangiectasia patient following clonal selection in t(X;14)-containing lymphocytes. Leukemia 1992;6:961–6. Cuneo A, Wlodarska I, Sayed Aly M, Piva N, Carli MG, Fagioli F, Tallarico A, Pazzi I, Ferrari L, Cassiman JJ, et al. Non-radioactive in situ hybridization for the detection and monitoring of trisomy 12 in B-cell chronic lymphocytic leukaemia. Br J Haematol 1992;81:192–6. Metcalfe JA, Heppell-Parton A, McConville CM, Taylor AM. Characterization of a B-lymphocyte t(2;14)(p11;q32) translocation from an ataxia telangiectasia patient conferring a proliferative advantage on cells in vitro. Cytogenet Cell Genet 1991;56:91–8. Trakhtenbrot L, Neumann Y, Mandel M, Toren A, Gipsh N, Rosner E, Rechavi G, Brok-Simoni F. In vitro proliferative advantage of bone marrow cells with tetrasomy 8 in Ewing sarcoma. Cancer Genet Cytogenet 1996;90:176–8.